The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	4370	83811	4773053	tail,head,capsid,protease,holin,integrase,plate,portal,terminase,tRNA	Salmonella_phage(56.36%)	100	25008:25024	83330:83346
WP_023893413.1|4370_4889_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|4885_4993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|5198_5645_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|5624_6419_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|6519_7704_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|7822_8170_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|8155_8467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|8535_8787_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|8982_9081_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|9219_9468_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|9781_10423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|10652_10835_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|10837_11200_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|11372_12011_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|12206_12752_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|12834_12990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|13068_13317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|13571_14420_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|14488_15082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|15226_16015_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|16122_16770_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|16966_17293_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|17486_18620_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|18701_19292_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|19285_20083_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000966637.1|20076_20889_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|20878_21853_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|21852_23487_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|24168_24483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|24631_25162_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
25008:25024	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|25244_26288_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|26626_27094_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|27246_27519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|27718_27844_-	lipoprotein	NA	NA	NA	NA	NA
WP_080155368.1|28221_28566_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|29787_30345_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|31156_31420_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|31551_31764_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|32178_32700_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|32890_33130_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|33619_34408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|35403_36528_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|36975_37188_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|37441_38113_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|38105_39374_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|39376_39796_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|40132_40345_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|40469_41603_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|41640_41853_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_095470790.1|41842_42448_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	96.8	8.9e-103
WP_095470789.1|42417_43671_-|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	94.0	1.4e-174
WP_001207833.1|43657_44245_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.5	8.3e-114
WP_000785578.1|44247_45327_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|45319_45733_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|45737_46271_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|46270_47329_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|47325_48666_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_165882362.1|48699_50628_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.7	0.0e+00
WP_000588852.1|50712_51039_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|51035_51392_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|51391_52888_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|52877_53042_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|53063_53609_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|53605_54118_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|54089_54503_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|54514_54838_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171046.1|55177_56395_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|56404_57253_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|57266_58571_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|58570_60313_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|60266_60731_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|60863_61208_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|61342_61570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|61666_62044_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|62086_62626_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|62622_63237_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|63236_63518_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|63504_63891_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|64041_64965_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|65071_65902_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|65932_66922_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|66929_67790_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|67806_68196_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|68192_69086_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|69085_69568_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_024160494.1|69569_70544_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	79.6	6.0e-117
WP_080155401.1|70761_71904_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	3.7e-182
WP_000509731.1|71900_72455_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|72483_72708_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|72805_73501_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|74315_74687_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000008351.1|75707_76247_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|77048_77522_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|78282_78519_+	excisionase	NA	NA	NA	NA	NA
WP_000741321.1|78508_79651_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.4e-173
WP_000444509.1|79764_81015_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|81186_81852_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|81848_82178_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|82189_82651_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|82704_83811_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
83330:83346	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 2
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	353229	362311	4773053	protease,integrase	Ralstonia_phage(16.67%)	8	342637:342649	365682:365694
342637:342649	attL	AATAAAAAGATCA	NA	NA	NA	NA
WP_080155296.1|353229_354471_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|354998_355376_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|355537_355735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|355947_358224_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|358254_358575_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|358898_359120_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|359249_361196_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|361192_362311_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
365682:365694	attR	TGATCTTTTTATT	NA	NA	NA	NA
>prophage 3
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	1444084	1449890	4773053		Enterobacteria_phage(100.0%)	10	NA	NA
WP_165882479.1|1444084_1444966_-	poxvirus D5 -like family protein	NA	Q7M2A8	Enterobacteria_phage	91.5	3.3e-154
WP_165882400.1|1444983_1445829_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	86.6	1.5e-135
WP_165882402.1|1446425_1446746_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|1446742_1446970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|1446966_1447518_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|1447514_1447781_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|1447885_1448014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023244191.1|1448321_1449065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|1449068_1449308_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|1449323_1449890_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
>prophage 4
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	1713948	1758726	4773053	tail,tRNA,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1713948_1714947_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1715034_1716345_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1716591_1717107_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1717206_1717416_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1717437_1717551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1717547_1718873_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1719051_1719660_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1719768_1720137_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1720307_1722728_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1722826_1723699_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1723712_1724210_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1724390_1725308_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1725471_1726830_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1726918_1728028_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1728389_1729580_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1729711_1731256_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1731270_1732161_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1732326_1732737_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1732879_1734976_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1734975_1735713_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1735709_1736378_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1736411_1736654_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1737097_1738747_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1739091_1740441_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1740571_1740919_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1741494_1741782_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1741784_1742390_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1742402_1742717_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1742876_1743332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1743328_1743526_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1743515_1744943_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|1744942_1745467_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|1745518_1745836_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1745795_1745924_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_080155326.1|1746020_1748375_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	2.4e-66
WP_023242911.1|1748374_1749328_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1749327_1749537_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1749524_1750568_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1750577_1751300_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1751627_1751990_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1751986_1752916_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1752915_1754463_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1754626_1754986_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1754976_1756092_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1756084_1756717_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1756719_1758201_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1758210_1758726_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 5
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	3267251	3273055	4773053		Enterobacteria_phage(100.0%)	8	NA	NA
WP_165882306.1|3267251_3269585_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
WP_000743145.1|3269599_3269920_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|3269916_3270144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|3270140_3270692_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_001604627.1|3270688_3270955_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|3271492_3272230_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|3272226_3272472_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3272488_3273055_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 6
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	3276585	3372575	4773053	tail,head,capsid,holin,integrase,portal,plate,tRNA,terminase,lysis	Salmonella_phage(53.52%)	98	3280698:3280715	3351080:3351097
WP_001536726.1|3276585_3277611_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|3277614_3278247_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|3278363_3278603_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_079809624.1|3278638_3279148_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.3	1.5e-82
WP_000957775.1|3279155_3279389_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|3279336_3279795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|3280014_3280356_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|3280423_3280657_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|3280656_3280884_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
3280698:3280715	attL	AGAACGCCAGCGCCACAT	NA	NA	NA	NA
WP_000104119.1|3280880_3281738_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.0	1.3e-128
WP_079964478.1|3281728_3284140_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.8	0.0e+00
WP_001154444.1|3284295_3284484_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_000790439.1|3284552_3284852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328720.1|3284962_3285841_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	3.0e-51
WP_001284991.1|3286290_3287955_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_063328721.1|3288058_3289099_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	99.7	7.9e-200
WP_080155336.1|3289098_3290865_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.4	0.0e+00
WP_000216276.1|3291007_3291841_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_063328723.1|3291857_3292919_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_080155337.1|3292922_3293573_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	99.1	9.2e-114
WP_063328725.1|3293666_3294131_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	3.8e-85
WP_063328726.1|3294130_3294334_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	1.9e-33
WP_000171565.1|3294337_3294553_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_079964475.1|3294533_3295049_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.2	6.7e-75
WP_063328728.1|3295045_3295474_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	80.7	6.6e-52
WP_063328729.1|3295569_3296001_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	91.6	1.9e-70
WP_063328730.1|3295993_3296437_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.1	1.6e-56
WP_023184683.1|3296487_3298194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328731.1|3298332_3298911_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.4	1.8e-105
WP_000177401.1|3298907_3299267_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	1.4e-58
WP_000268275.1|3299253_3300162_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.3	3.2e-157
WP_063328732.1|3300154_3300760_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	2.4e-116
WP_001274653.1|3300756_3302523_+|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	52.3	4.7e-136
WP_000680168.1|3302525_3303053_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000046109.1|3303183_3304356_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207647.1|3304365_3304881_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_001280962.1|3304935_3305238_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|3305252_3305372_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_080155390.1|3305364_3308172_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_000980409.1|3308168_3308654_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_165882439.1|3308650_3309751_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.1	3.8e-192
WP_000980498.1|3309819_3310038_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|3310589_3311753_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023244174.1|3311760_3313941_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_038389487.1|3315412_3326887_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|3327506_3327989_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|3328138_3328615_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|3328604_3328895_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|3329060_3329399_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|3329547_3331209_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|3331294_3332173_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|3332295_3332886_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|3332920_3333526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|3333646_3334933_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|3334952_3335744_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|3335909_3337271_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|3337584_3337833_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|3337851_3338400_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|3338444_3339212_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|3339252_3339600_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|3339756_3340977_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|3340969_3341488_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3341928_3342999_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|3343008_3344130_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|3344187_3345096_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|3345056_3346217_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|3346316_3346364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132356.1|3346527_3347520_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|3347586_3347892_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|3347989_3348328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960662.1|3348353_3348686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960661.1|3348695_3349265_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
WP_076009995.1|3349267_3349486_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	5.2e-05
WP_079960660.1|3349524_3352182_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
3351080:3351097	attR	ATGTGGCGCTGGCGTTCT	NA	NA	NA	NA
WP_000088096.1|3352209_3352533_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_023210894.1|3352532_3353552_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
WP_054175274.1|3353548_3355333_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|3355543_3356380_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|3356414_3357443_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|3357454_3358153_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|3358212_3358704_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|3358700_3359183_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|3359179_3359884_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|3359880_3361008_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|3361004_3361460_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|3361472_3361769_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|3361765_3362107_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|3362106_3362439_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|3362585_3362843_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|3363030_3364998_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|3364994_3365324_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|3365320_3366505_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|3366497_3367085_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|3367094_3369107_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3369109_3369640_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3369629_3370355_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|3370326_3370872_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|3370874_3372575_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
>prophage 7
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	3859068	3868239	4773053	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3859068_3860016_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3859999_3860731_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3860711_3860819_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3860878_3861610_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3861832_3863518_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3863514_3864234_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3864280_3864748_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_165882447.1|3864804_3865335_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3865506_3865965_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3866205_3868239_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 8
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	3936330	3942627	4773053		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3936330_3937734_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3937911_3938805_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3939181_3940267_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3940266_3941166_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3941213_3942092_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3942096_3942627_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 9
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	4052887	4060136	4773053		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|4052887_4053307_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|4053309_4054578_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|4055032_4055245_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|4055255_4055444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|4055703_4056897_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|4057545_4057857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|4057936_4058632_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|4058705_4060136_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 10
NZ_CP045513	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 chromosome Sal-3948, complete sequence	4773053	4163889	4171652	4773053	integrase	Enterobacteria_phage(28.57%)	12	4166099:4166121	4178222:4178244
WP_080155354.1|4163889_4164120_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	6.5e-14
WP_000168393.1|4164257_4164632_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4164632_4165508_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4165524_4165878_+	YebY family protein	NA	NA	NA	NA	NA
4166099:4166121	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4166249_4167329_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4167325_4168432_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_165882455.1|4168462_4168693_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.1	5.1e-27
WP_001050883.1|4168746_4169280_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4169536_4169704_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4169768_4169957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4170011_4170503_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4171055_4171652_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4178222:4178244	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP045514	Salmonella enterica subsp. enterica serovar Anatum strain Sal-3948 plasmid p77k, complete sequence	77622	5474	52874	77622	integrase,transposase	Escherichia_phage(39.13%)	42	NA	NA
WP_001067858.1|5474_6179_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000084744.1|6513_6906_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|7225_7612_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_063073416.1|7743_10710_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_021532377.1|10712_11273_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067855.1|11429_12134_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|12436_13297_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|13395_14100_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|15489_16158_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|16193_16430_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|16426_16789_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|16806_18501_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001067855.1|18689_19394_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|19583_20399_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_128111736.1|20464_21169_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_000550473.1|22121_22271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534857.1|22615_22855_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_000323025.1|22854_23142_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_001531258.1|23445_24228_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_000627495.1|24224_25247_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.9e-174
WP_001162839.1|26046_28254_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_000449742.1|28256_30839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085950818.1|31259_32380_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_004193081.1|32392_32761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000600827.1|32808_33786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_032435955.1|34377_34512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|36612_37005_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|37427_38132_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001381192.1|38622_39615_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376623.1|39583_40084_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|40211_41051_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|41044_41392_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|41555_42347_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|42352_42598_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|42754_43252_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845054.1|43396_44410_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|44715_45273_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|45275_48248_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000844627.1|49318_49561_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|49592_50243_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|50348_51548_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001067855.1|52169_52874_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
