The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	4370	83775	4813791	protease,integrase,terminase,head,tRNA,plate,holin,capsid,tail,portal	Salmonella_phage(56.14%)	101	25008:25024	83294:83310
WP_023893413.1|4370_4889_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|4885_4993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|5198_5645_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|5624_6419_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|6519_7704_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|7822_8170_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|8155_8467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|8535_8787_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|8982_9081_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|9219_9468_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|9781_10423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|10652_10835_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|10837_11200_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|11372_12011_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|12206_12752_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|12834_12990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|13068_13317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|13571_14420_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|14488_15082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|15226_16015_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|16122_16770_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|16966_17293_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|17486_18620_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|18701_19292_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|19285_20083_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|20076_20889_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|20878_21853_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|21852_23487_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|24168_24483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|24631_25162_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
25008:25024	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|25244_26288_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|26626_27094_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|27246_27519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|27718_27844_-	lipoprotein	NA	NA	NA	NA	NA
WP_080155368.1|28221_28566_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|29787_30345_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|31156_31420_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|31551_31764_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|32178_32700_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|32890_33130_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|33619_34408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|35403_36528_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|36975_37188_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|37441_38113_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|38105_39374_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|39376_39796_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|40132_40345_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|40469_41603_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|41640_41853_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_095470790.1|41842_42448_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	96.8	8.9e-103
WP_095470789.1|42417_43671_-|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	94.0	1.4e-174
WP_023171039.1|43657_44245_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|44247_45327_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|45319_45733_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|45737_46271_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|46270_47329_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_000863821.1|47325_48666_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	1.7e-250
WP_023171042.1|48699_50628_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|50712_51039_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|51035_51392_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|51391_52888_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|52877_53042_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|53063_53609_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|53605_54118_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|54089_54503_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|54514_54838_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171046.1|55141_56359_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|56368_57217_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|57230_58535_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|58534_60277_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|60230_60695_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|60827_61172_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|61306_61534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|61630_62008_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|62050_62590_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|62586_63201_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|63200_63482_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|63468_63855_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|64005_64929_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|65035_65866_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|65896_66886_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|66893_67754_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|67770_68160_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|68156_69050_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|69049_69532_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_024160494.1|69533_70508_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	79.6	6.0e-117
WP_000620702.1|70504_70729_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_080155401.1|70725_71868_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	3.7e-182
WP_000509731.1|71864_72419_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|72447_72672_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|72769_73465_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|74279_74651_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000008351.1|75671_76211_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|77012_77486_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|78246_78483_+	excisionase	NA	NA	NA	NA	NA
WP_000741321.1|78472_79615_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.4e-173
WP_000444509.1|79728_80979_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|81150_81816_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|81812_82142_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|82153_82615_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|82668_83775_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
83294:83310	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 2
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	353216	362298	4813791	protease,integrase	Ralstonia_phage(16.67%)	8	351609:351621	370795:370807
351609:351621	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_080155296.1|353216_354458_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|354985_355363_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|355524_355722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|355934_358211_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|358241_358562_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|358885_359107_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|359236_361183_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|361179_362298_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
370795:370807	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 3
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	1444088	1453036	4813791	integrase	Enterobacteria_phage(83.33%)	12	1441312:1441328	1453206:1453222
1441312:1441328	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|1444088_1446422_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|1446436_1446757_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|1446753_1446981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|1446977_1447529_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|1447525_1447792_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|1447896_1448025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023244191.1|1448332_1449076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|1449079_1449319_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|1449334_1449901_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|1450339_1451281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|1451289_1451745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|1451767_1453036_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
1453206:1453222	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 4
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	1713959	1758737	4813791	plate,tail,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1713959_1714958_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1715045_1716356_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1716602_1717118_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1717217_1717427_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1717448_1717562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1717558_1718884_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1719062_1719671_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1719779_1720148_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1720318_1722739_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1722837_1723710_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1723723_1724221_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1724401_1725319_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1725482_1726841_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1726929_1728039_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1728400_1729591_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1729722_1731267_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1731281_1732172_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1732337_1732748_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1732890_1734987_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1734986_1735724_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1735720_1736389_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1736422_1736665_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1737108_1738758_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1739102_1740452_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1740582_1740930_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1741505_1741793_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1741795_1742401_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1742413_1742728_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1742887_1743343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1743339_1743537_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1743526_1744954_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|1744953_1745478_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|1745529_1745847_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1745806_1745935_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_080155326.1|1746031_1748386_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	2.4e-66
WP_023242911.1|1748385_1749339_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1749338_1749548_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1749535_1750579_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1750588_1751311_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1751638_1752001_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1751997_1752927_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1752926_1754474_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1754637_1754997_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1754987_1756103_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1756095_1756728_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1756730_1758212_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1758221_1758737_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 5
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	3267866	3273670	4813791		Enterobacteria_phage(100.0%)	8	NA	NA
WP_165882306.1|3267866_3270200_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
WP_000743145.1|3270214_3270535_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|3270531_3270759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|3270755_3271307_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_001604627.1|3271303_3271570_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|3272107_3272845_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|3272841_3273087_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3273103_3273670_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 6
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	3277200	3373190	4813791	integrase,terminase,head,tRNA,plate,lysis,holin,capsid,tail,portal	Salmonella_phage(53.52%)	98	3281313:3281330	3351695:3351712
WP_001536726.1|3277200_3278226_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|3278229_3278862_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|3278978_3279218_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_079809624.1|3279253_3279763_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.3	1.5e-82
WP_000957775.1|3279770_3280004_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|3279951_3280410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|3280629_3280971_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|3281038_3281272_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|3281271_3281499_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
3281313:3281330	attL	AGAACGCCAGCGCCACAT	NA	NA	NA	NA
WP_000104119.1|3281495_3282353_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.0	1.3e-128
WP_079964478.1|3282343_3284755_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.8	0.0e+00
WP_001154444.1|3284910_3285099_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_000790439.1|3285167_3285467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328720.1|3285577_3286456_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	3.0e-51
WP_001284991.1|3286905_3288570_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_063328721.1|3288673_3289714_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	99.7	7.9e-200
WP_080155336.1|3289713_3291480_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.4	0.0e+00
WP_000216276.1|3291622_3292456_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_063328723.1|3292472_3293534_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_080155337.1|3293537_3294188_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	99.1	9.2e-114
WP_063328725.1|3294281_3294746_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	3.8e-85
WP_063328726.1|3294745_3294949_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	1.9e-33
WP_000171565.1|3294952_3295168_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_079964475.1|3295148_3295664_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.2	6.7e-75
WP_063328728.1|3295660_3296089_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	80.7	6.6e-52
WP_063328729.1|3296184_3296616_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	91.6	1.9e-70
WP_063328730.1|3296608_3297052_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.1	1.6e-56
WP_023184683.1|3297102_3298809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328731.1|3298947_3299526_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.4	1.8e-105
WP_000177401.1|3299522_3299882_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	1.4e-58
WP_000268275.1|3299868_3300777_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	98.3	3.2e-157
WP_063328732.1|3300769_3301375_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	2.4e-116
WP_001274653.1|3301371_3303138_+|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	52.3	4.7e-136
WP_000680168.1|3303140_3303668_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000046109.1|3303798_3304971_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207647.1|3304980_3305496_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_001280962.1|3305550_3305853_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|3305867_3305987_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_080155390.1|3305979_3308787_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_000980409.1|3308783_3309269_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_001102264.1|3309265_3310366_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.4	3.4e-193
WP_000980498.1|3310434_3310653_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|3311204_3312368_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023244174.1|3312375_3314556_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_038389487.1|3316027_3327502_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|3328121_3328604_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|3328753_3329230_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|3329219_3329510_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|3329675_3330014_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|3330162_3331824_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|3331909_3332788_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|3332910_3333501_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|3333535_3334141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|3334261_3335548_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|3335567_3336359_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|3336524_3337886_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|3338199_3338448_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|3338466_3339015_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|3339059_3339827_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|3339867_3340215_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|3340371_3341592_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|3341584_3342103_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3342543_3343614_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|3343623_3344745_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|3344802_3345711_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|3345671_3346832_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|3346931_3346979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132356.1|3347142_3348135_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|3348201_3348507_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|3348604_3348943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960662.1|3348968_3349301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960661.1|3349310_3349880_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
WP_076009995.1|3349882_3350101_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	5.2e-05
WP_079960660.1|3350139_3352797_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
3351695:3351712	attR	ATGTGGCGCTGGCGTTCT	NA	NA	NA	NA
WP_000088096.1|3352824_3353148_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_023210894.1|3353147_3354167_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
WP_054175274.1|3354163_3355948_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|3356158_3356995_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|3357029_3358058_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|3358069_3358768_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|3358827_3359319_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|3359315_3359798_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|3359794_3360499_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|3360495_3361623_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|3361619_3362075_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|3362087_3362384_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|3362380_3362722_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|3362721_3363054_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|3363200_3363458_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|3363645_3365613_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|3365609_3365939_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|3365935_3367120_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|3367112_3367700_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|3367709_3369722_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3369724_3370255_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3370244_3370970_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|3370941_3371487_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|3371489_3373190_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
>prophage 7
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	3859684	3868855	4813791	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3859684_3860632_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3860615_3861347_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3861327_3861435_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3861494_3862226_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3862448_3864134_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3864130_3864850_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3864896_3865364_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3865420_3865951_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3866122_3866581_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3866821_3868855_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 8
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	3936946	3943243	4813791		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3936946_3938350_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3938527_3939421_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3939797_3940883_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3940882_3941782_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3941829_3942708_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3942712_3943243_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 9
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	3971098	4010837	4813791	protease,integrase,terminase,head,plate,holin,capsid,tail,portal	Salmonella_phage(82.76%)	59	3962496:3962510	3998409:3998423
3962496:3962510	attL	GGGCGGCGATATCCG	NA	NA	NA	NA
WP_001007943.1|3971098_3972280_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	99.5	1.3e-227
WP_001754984.1|3972643_3972883_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_039501142.1|3972888_3973758_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	94.8	1.3e-158
WP_000187056.1|3973754_3974435_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	3.9e-131
WP_001648679.1|3974431_3975217_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.2	1.4e-148
WP_039501144.1|3975222_3975519_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	9.8e-47
WP_039501146.1|3975609_3975810_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	4.1e-12
WP_001009036.1|3976096_3976501_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869364.1|3976630_3976867_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001538023.1|3976832_3977207_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_165898914.1|3977291_3978275_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	94.4	1.2e-152
WP_000800012.1|3978277_3979027_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_057520438.1|3979037_3979385_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.6e-51
WP_000065341.1|3979381_3979783_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_077945196.1|3979779_3980463_+	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	55.6	1.4e-40
WP_057520437.1|3980462_3980936_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.9	5.6e-68
WP_077945195.1|3980939_3981569_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	58.9	3.0e-77
WP_016062831.1|3981720_3982353_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	100.0	3.8e-112
WP_001217670.1|3982841_3983081_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000929790.1|3983415_3984018_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001241019.1|3984017_3984224_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_039501156.1|3984226_3984838_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	96.6	6.1e-91
WP_000801757.1|3984834_3984975_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_057520435.1|3984971_3985661_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	1.2e-58
WP_162264800.1|3985861_3986203_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001005893.1|3986205_3986820_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	97.1	5.0e-109
WP_001530346.1|3986816_3987209_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001005132.1|3987449_3988004_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	4.5e-101
WP_001135098.1|3988054_3988405_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929171.1|3988530_3989025_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_000088175.1|3989021_3990755_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000605609.1|3990766_3990949_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466263.1|3990948_3992190_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.0	6.5e-241
WP_001193639.1|3992167_3992818_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257526.1|3992832_3994038_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_000601352.1|3994088_3994289_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|3994291_3994615_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702410.1|3994611_3995016_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_001135699.1|3994987_3995500_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000779216.1|3995496_3996057_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_000497740.1|3996060_3996225_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_057520465.1|3996214_3997711_+|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	99.6	5.2e-277
WP_000515952.1|3997710_3998067_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588851.1|3998063_3998390_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	98.1	3.3e-51
WP_031608922.1|3998474_4000403_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
3998409:3998423	attR	GGGCGGCGATATCCG	NA	NA	NA	NA
WP_000863824.1|4000436_4001777_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	2.2e-250
WP_001066633.1|4001773_4002832_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	5.0e-202
WP_024158934.1|4002831_4003365_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	99.4	1.4e-96
WP_000605051.1|4003369_4003783_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|4003775_4004855_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|4004857_4005445_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_080155405.1|4005431_4006982_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	80.8	1.2e-215
WP_080155406.1|4006994_4007549_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	96.1	1.0e-97
WP_000267959.1|4007538_4007712_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	65.1	1.7e-11
WP_001259328.1|4007787_4008921_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	7.2e-37
WP_000532385.1|4008972_4009347_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	35.0	9.0e-13
WP_001530989.1|4009820_4010255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343069.1|4010363_4010555_+	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_000798891.1|4010570_4010837_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	89.8	4.0e-39
>prophage 10
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	4093653	4100902	4813791		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|4093653_4094073_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|4094075_4095344_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|4095798_4096011_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|4096021_4096210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|4096469_4097663_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|4098311_4098623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|4098702_4099398_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|4099471_4100902_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 11
NZ_CP045465	Salmonella enterica subsp. enterica serovar Anatum strain Sal-2097 chromosome, complete genome	4813791	4204655	4212418	4813791	integrase	Enterobacteria_phage(28.57%)	12	4206865:4206887	4218988:4219010
WP_080155354.1|4204655_4204886_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	6.5e-14
WP_000168393.1|4205023_4205398_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4205398_4206274_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4206290_4206644_+	YebY family protein	NA	NA	NA	NA	NA
4206865:4206887	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4207015_4208095_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4208091_4209198_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_165882455.1|4209228_4209459_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.1	5.1e-27
WP_001050883.1|4209512_4210046_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4210302_4210470_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4210534_4210723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4210777_4211269_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4211821_4212418_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4218988:4219010	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
