The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	4370	83766	4773013	plate,tail,capsid,holin,terminase,integrase,head,tRNA,protease,portal	Salmonella_phage(54.39%)	101	25008:25024	83285:83301
WP_023893413.1|4370_4889_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|4885_4993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|5198_5645_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|5624_6419_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|6519_7704_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|7822_8170_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|8155_8467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|8535_8787_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|8982_9081_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|9219_9468_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|9781_10423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|10652_10835_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|10837_11200_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|11372_12011_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|12206_12752_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|12834_12990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|13068_13317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|13571_14420_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|14488_15082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|15226_16015_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|16122_16770_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|16966_17293_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|17486_18620_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|18701_19292_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|19285_20083_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|20076_20889_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|20878_21853_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|21852_23487_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|24168_24483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|24631_25162_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
25008:25024	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|25244_26288_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|26626_27094_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|27246_27519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|27718_27844_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|28221_28566_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|29787_30345_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|31156_31420_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|31551_31764_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|32178_32700_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|32890_33130_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|33619_34408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|35403_36528_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|36975_37188_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|37441_38113_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|38105_39374_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|39376_39796_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|40132_40345_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|40469_41603_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|41640_41853_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_095470790.1|41842_42448_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	96.8	8.9e-103
WP_095470789.1|42417_43671_-|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	94.0	1.4e-174
WP_023171039.1|43657_44245_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|44247_45327_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|45319_45733_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|45737_46271_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|46270_47329_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_000863821.1|47325_48666_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	1.7e-250
WP_023171042.1|48699_50628_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|50712_51039_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|51035_51392_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|51391_52888_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|52877_53042_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|53063_53609_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|53605_54118_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|54089_54503_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|54514_54838_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_072600590.1|54837_55089_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.8e-10
WP_023171046.1|55132_56350_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|56359_57208_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|57221_58526_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|58525_60268_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|60221_60686_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|60818_61163_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|61297_61525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|61621_61999_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|62041_62581_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|62577_63192_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|63191_63473_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|63459_63846_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|63996_64920_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|65026_65857_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|65887_66877_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|66884_67745_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|67761_68151_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|68147_69041_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|69040_69523_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_024160494.1|69524_70499_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	79.6	6.0e-117
WP_080155401.1|70716_71859_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.6	3.7e-182
WP_000509731.1|71855_72410_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|72438_72663_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|72760_73456_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|74270_74642_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000008351.1|75662_76202_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|77003_77477_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|78237_78474_+	excisionase	NA	NA	NA	NA	NA
WP_000741321.1|78463_79606_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.4e-173
WP_000444509.1|79719_80970_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|81141_81807_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|81803_82133_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|82144_82606_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|82659_83766_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
83285:83301	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 2
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	353206	362288	4773013	protease,integrase	Ralstonia_phage(16.67%)	8	351599:351611	370785:370797
351599:351611	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_080155296.1|353206_354448_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|354975_355353_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|355514_355712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|355924_358201_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|358231_358552_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|358875_359097_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|359226_361173_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|361169_362288_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
370785:370797	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 3
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	1444324	1453272	4773013	integrase	Enterobacteria_phage(83.33%)	12	1441548:1441564	1453442:1453458
1441548:1441564	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|1444324_1446658_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|1446672_1446993_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|1446989_1447217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|1447213_1447765_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|1447761_1448028_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|1448132_1448261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023244191.1|1448568_1449312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|1449315_1449555_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|1449570_1450137_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|1450575_1451517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|1451525_1451981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|1452003_1453272_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
1453442:1453458	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 4
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	1714195	1758973	4773013	plate,tRNA,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|1714195_1715194_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|1715281_1716592_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|1716838_1717354_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|1717453_1717663_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|1717684_1717798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|1717794_1719120_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|1719298_1719907_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|1720015_1720384_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|1720554_1722975_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|1723073_1723946_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|1723959_1724457_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|1724637_1725555_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|1725718_1727077_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|1727165_1728275_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|1728636_1729827_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|1729958_1731503_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|1731517_1732408_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|1732573_1732984_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|1733126_1735223_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|1735222_1735960_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|1735956_1736625_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|1736658_1736901_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|1737344_1738994_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|1739338_1740688_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|1740818_1741166_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|1741741_1742029_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|1742031_1742637_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|1742649_1742964_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|1743123_1743579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|1743575_1743773_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|1743762_1745190_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|1745189_1745714_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|1745765_1746083_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|1746042_1746171_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|1746267_1748622_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|1748621_1749575_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|1749574_1749784_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|1749771_1750815_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|1750824_1751547_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|1751874_1752237_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|1752233_1753163_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|1753162_1754710_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|1754873_1755233_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|1755223_1756339_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|1756331_1756964_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|1756966_1758448_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|1758457_1758973_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 5
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	3267337	3273141	4773013		Enterobacteria_phage(100.0%)	8	NA	NA
WP_165882306.1|3267337_3269671_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
WP_000743145.1|3269685_3270006_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|3270002_3270230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080155335.1|3270226_3270778_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	5.6e-35
WP_001604627.1|3270774_3271041_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|3271578_3272316_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|3272312_3272558_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|3272574_3273141_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 6
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	3276671	3372661	4773013	plate,capsid,tail,holin,terminase,integrase,head,tRNA,lysis,portal	Salmonella_phage(52.86%)	97	3280784:3280801	3351166:3351183
WP_001536726.1|3276671_3277697_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052560.1|3277700_3278333_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102104.1|3278449_3278689_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_079809624.1|3278724_3279234_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.3	1.5e-82
WP_000957775.1|3279241_3279475_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|3279422_3279881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|3280100_3280442_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|3280509_3280743_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|3280742_3280970_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
3280784:3280801	attL	AGAACGCCAGCGCCACAT	NA	NA	NA	NA
WP_000104119.1|3280966_3281824_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.0	1.3e-128
WP_165882307.1|3281814_3284226_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.6	0.0e+00
WP_001154444.1|3284381_3284570_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_000790439.1|3284638_3284938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328720.1|3285048_3285927_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.8	3.0e-51
WP_001284991.1|3286376_3288041_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_063328721.1|3288144_3289185_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	99.7	7.9e-200
WP_080155336.1|3289184_3290951_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.4	0.0e+00
WP_000216276.1|3291093_3291927_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_063328723.1|3291943_3293005_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	99.7	6.0e-195
WP_080155337.1|3293008_3293659_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	99.1	9.2e-114
WP_063328725.1|3293752_3294217_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.7	3.8e-85
WP_063328726.1|3294216_3294420_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	97.0	1.9e-33
WP_000171565.1|3294423_3294639_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_079964475.1|3294619_3295135_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.2	6.7e-75
WP_063328728.1|3295131_3295560_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	80.7	6.6e-52
WP_063328729.1|3295655_3296087_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	91.6	1.9e-70
WP_063328730.1|3296079_3296523_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.1	1.6e-56
WP_023184683.1|3296573_3298280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063328731.1|3298418_3298997_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.4	1.8e-105
WP_000177401.1|3298993_3299353_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	98.3	1.4e-58
WP_063328732.1|3300240_3300846_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	2.4e-116
WP_001274653.1|3300842_3302609_+|tail	tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	52.3	4.7e-136
WP_000680168.1|3302611_3303139_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000046109.1|3303269_3304442_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207647.1|3304451_3304967_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_001280962.1|3305021_3305324_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|3305338_3305458_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_080155390.1|3305450_3308258_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_000980409.1|3308254_3308740_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_001102264.1|3308736_3309837_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.4	3.4e-193
WP_000980498.1|3309905_3310124_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|3310675_3311839_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023244174.1|3311846_3314027_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_038389487.1|3315498_3326973_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|3327592_3328075_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|3328224_3328701_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|3328690_3328981_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|3329146_3329485_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|3329633_3331295_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|3331380_3332259_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|3332381_3332972_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|3333006_3333612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|3333732_3335019_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|3335038_3335830_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|3335995_3337357_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|3337670_3337919_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|3337937_3338486_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|3338530_3339298_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|3339338_3339686_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|3339842_3341063_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|3341055_3341574_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3342014_3343085_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|3343094_3344216_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210990.1|3344273_3345182_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|3345142_3346303_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|3346402_3346450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132356.1|3346613_3347606_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|3347672_3347978_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|3348075_3348414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960662.1|3348439_3348772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079960661.1|3348781_3349351_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	3.4e-43
WP_076009995.1|3349353_3349572_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.7	5.2e-05
WP_079960660.1|3349610_3352268_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.3	7.9e-244
3351166:3351183	attR	ATGTGGCGCTGGCGTTCT	NA	NA	NA	NA
WP_000088096.1|3352295_3352619_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_023210894.1|3352618_3353638_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
WP_054175274.1|3353634_3355419_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|3355629_3356466_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|3356500_3357529_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|3357540_3358239_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_031602415.1|3358298_3358790_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.3e-48
WP_000080871.1|3358786_3359269_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|3359265_3359970_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|3359966_3361094_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|3361090_3361546_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|3361558_3361855_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|3361851_3362193_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|3362192_3362525_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|3362671_3362929_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|3363116_3365084_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|3365080_3365410_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|3365406_3366591_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|3366583_3367171_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|3367180_3369193_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|3369195_3369726_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267951.1|3369715_3370441_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|3370412_3370958_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|3370960_3372661_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
>prophage 7
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	3859194	3868365	4773013	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|3859194_3860142_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|3860125_3860857_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|3860837_3860945_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|3861004_3861736_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|3861958_3863644_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|3863640_3864360_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|3864406_3864874_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|3864930_3865461_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|3865632_3866091_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|3866331_3868365_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 8
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	3936456	3942753	4773013		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|3936456_3937860_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|3938037_3938931_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|3939307_3940393_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|3940392_3941292_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|3941339_3942218_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|3942222_3942753_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 9
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	4053048	4060297	4773013		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|4053048_4053468_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|4053470_4054739_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|4055193_4055406_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|4055416_4055605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|4055864_4057058_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|4057706_4058018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|4058097_4058793_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|4058866_4060297_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 10
NZ_CP045464	Salmonella enterica subsp. enterica serovar Anatum strain Sal-1135 chromosome, complete genome	4773013	4164050	4171813	4773013	integrase	Enterobacteria_phage(28.57%)	12	4166260:4166282	4178383:4178405
WP_080155354.1|4164050_4164281_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	6.5e-14
WP_000168393.1|4164418_4164793_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|4164793_4165669_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4165685_4166039_+	YebY family protein	NA	NA	NA	NA	NA
4166260:4166282	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|4166410_4167490_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|4167486_4168593_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|4168623_4168854_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|4168907_4169441_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|4169697_4169865_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4169929_4170118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|4170172_4170664_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|4171216_4171813_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
4178383:4178405	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
