The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	11555	33913	4356270	holin	Bacillus_phage(85.71%)	24	NA	NA
WP_003231758.1|11555_11948_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|11907_14010_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|14027_15017_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003231751.1|15066_15687_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	2.7e-46
WP_003231750.1|15750_16518_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	5.9e-51
WP_074794263.1|17141_17783_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	42.5	8.5e-27
WP_032721590.1|17806_18100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003230849.1|18533_19067_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	99.4	5.1e-94
WP_113712840.1|19190_20081_-	endonuclease YokF	NA	O64020	Bacillus_phage	94.3	8.8e-107
WP_042976294.1|20261_20513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113712841.1|20598_21132_+	SMI1/KNR4 family protein	NA	A0A1P8CWM2	Bacillus_phage	92.6	8.1e-07
WP_113712842.1|21271_23023_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	88.7	6.9e-281
WP_113712843.1|23024_23621_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	84.0	2.7e-88
WP_082786706.1|23947_24031_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_041338710.1|24292_24652_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	100.0	3.5e-62
WP_041054825.1|24693_25029_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	100.0	4.2e-54
WP_113712844.1|25202_25535_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	97.3	3.2e-54
WP_144460143.1|25527_26778_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	96.6	2.7e-234
WP_144460145.1|26817_26994_-	aspartate phosphatase	NA	A0A1P8CWP3	Bacillus_phage	96.6	3.4e-23
WP_019712879.1|26983_28120_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	99.5	2.1e-214
WP_061891069.1|28247_28499_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	100.0	1.4e-38
WP_017696898.1|28519_28912_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	100.0	2.2e-62
WP_144460147.1|29028_30132_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	A0A1P8CWN6	Bacillus_phage	98.1	9.3e-183
WP_032721605.1|31357_33913_-	Pre-neck appendage protein	NA	D6R401	Bacillus_phage	33.5	1.7e-110
>prophage 2
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	45200	81179	4356270		Bacillus_phage(96.97%)	47	NA	NA
WP_144452862.1|45200_45884_-	immunity protein	NA	Q37974	Bacillus_phage	94.7	1.3e-110
WP_144452864.1|45957_46422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144452866.1|46506_46692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144452868.1|46746_47304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144452870.1|48452_48872_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	79.0	5.1e-57
WP_101860429.1|48871_49360_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	70.5	5.6e-55
WP_144460149.1|49438_50278_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_144452877.1|50296_50449_-	XkdX family protein	NA	NA	NA	NA	NA
WP_032721617.1|50448_50739_-	hypothetical protein	NA	O64053	Bacillus_phage	39.8	4.0e-16
WP_144452879.1|50756_51815_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	57.0	3.3e-36
WP_144452881.1|51814_52174_-	hypothetical protein	NA	O64055	Bacillus_phage	79.8	1.6e-46
WP_009967521.1|52237_52465_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_114523556.1|52464_53076_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	96.6	6.3e-64
WP_010328117.1|53093_53888_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	38.6	4.3e-20
WP_017696881.1|53923_54652_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	43.0	2.1e-45
WP_041352945.1|54648_55155_-	hypothetical protein	NA	O64060	Bacillus_phage	85.7	2.0e-79
WP_144460152.1|55151_55802_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	99.5	1.6e-121
WP_144460154.1|55785_56040_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	98.8	6.5e-39
WP_019712890.1|56445_56916_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	99.4	1.1e-81
WP_003230962.1|56951_57968_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.4	6.4e-186
WP_010328108.1|58006_58543_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	99.4	1.4e-94
WP_121572574.1|58567_60004_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	91.4	4.2e-244
WP_113712862.1|60034_61555_-	hypothetical protein	NA	O64068	Bacillus_phage	98.6	5.6e-279
WP_071580922.1|61572_63342_-	hypothetical protein	NA	O64069	Bacillus_phage	99.7	0.0e+00
WP_004399257.1|63328_64249_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
WP_071580923.1|64351_64876_-	hypothetical protein	NA	U5J9P3	Bacillus_phage	38.9	2.5e-21
WP_086352767.1|64908_65238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460156.1|65474_66692_-	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	97.8	9.8e-226
WP_010328101.1|66704_66896_-	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
WP_017696867.1|67247_67424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017696866.1|67459_68707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460158.1|69038_69209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460160.1|69765_70044_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	92.3	6.0e-38
WP_144460163.1|70306_70921_-	hypothetical protein	NA	A0A1P8CWS4	Bacillus_phage	98.5	3.7e-112
WP_144460165.1|71336_73214_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	99.8	0.0e+00
WP_017696862.1|73253_73448_-	hypothetical protein	NA	O64077	Bacillus_phage	98.4	1.3e-28
WP_017696861.1|74482_74659_+	hypothetical protein	NA	O64080	Bacillus_phage	92.3	4.4e-10
WP_080010576.1|74677_74929_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	9.3e-30
WP_106293942.1|74973_75135_+	hypothetical protein	NA	O64081	Bacillus_phage	96.2	2.3e-18
WP_144460167.1|75245_76463_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.2	1.2e-199
WP_144460169.1|76805_77954_+	DUF342 domain-containing protein	NA	A0A0H3UZ18	Geobacillus_virus	31.3	4.7e-36
WP_144460171.1|77966_78458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165882326.1|78472_78910_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041338606.1|78945_79227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727199.1|79288_79513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727200.1|79566_80076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041338596.1|80543_81179_+	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	100.0	4.8e-115
>prophage 3
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	84501	143382	4356270	tRNA,integrase	Bacillus_phage(95.0%)	100	84467:84488	105963:105984
84467:84488	attL	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_004399418.1|84501_84702_+	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
WP_144453790.1|84704_85022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144453792.1|85070_85283_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	95.7	2.1e-27
WP_144453794.1|85272_86349_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	98.6	1.2e-195
WP_144453796.1|86455_87838_+	hypothetical protein	NA	O64100	Bacillus_phage	99.6	2.5e-262
WP_019712299.1|87861_88839_+	hypothetical protein	NA	O64101	Bacillus_phage	99.4	8.8e-177
WP_004399410.1|89027_89252_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_144453798.1|89434_89653_+	YopT family protein	NA	O64103	Bacillus_phage	97.2	1.2e-30
WP_017697045.1|89723_89921_+	hypothetical protein	NA	O64104	Bacillus_phage	98.5	6.8e-28
WP_003231036.1|90032_90227_+	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_144453853.1|90393_90594_+	hypothetical protein	NA	M4ZRU5	Bacillus_phage	87.5	2.9e-26
WP_144453800.1|90590_90977_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	38.8	5.6e-18
WP_165882324.1|90973_91147_+	hypothetical protein	NA	Q38078	Bacillus_phage	93.0	2.2e-22
WP_144453802.1|91143_91506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144453855.1|91558_91870_+	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	77.7	2.2e-41
WP_101502245.1|91866_92049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460175.1|92115_94314_+	AAA family ATPase	NA	Q4Z932	Staphylococcus_phage	43.5	1.2e-160
WP_032721704.1|94358_94565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160171066.1|94554_94692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460177.1|94730_94973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069323063.1|95004_95265_+	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	97.7	1.9e-41
WP_144460179.1|95282_95957_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	95.1	7.1e-125
WP_124058922.1|95976_96159_+	hypothetical protein	NA	O64120	Bacillus_phage	100.0	1.3e-28
WP_144460181.1|96344_96572_+	hypothetical protein	NA	O64123	Bacillus_phage	91.7	1.3e-30
WP_144460183.1|96601_96862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460185.1|96986_97388_+	hypothetical protein	NA	K4JWE2	Caulobacter_phage	39.4	3.7e-20
WP_144460189.1|98227_98641_+	hypothetical protein	NA	A0A1P8CWZ8	Bacillus_phage	98.5	4.4e-77
WP_144460191.1|98706_99519_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	94.8	7.2e-148
WP_144460193.1|99589_100264_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	97.9	7.7e-79
WP_144453821.1|100334_100556_+	hypothetical protein	NA	O64132	Bacillus_phage	98.6	8.4e-35
WP_144453823.1|100616_101504_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	94.6	2.3e-160
WP_114523521.1|101493_101766_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	92.2	7.9e-43
WP_144453825.1|101804_102200_+	hypothetical protein	NA	O64133	Bacillus_phage	97.7	3.2e-69
WP_144453829.1|103116_104877_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	98.5	0.0e+00
WP_113712893.1|104964_105261_+	hypothetical protein	NA	O64136	Bacillus_phage	98.0	6.8e-48
WP_019712321.1|105323_105704_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	96.0	1.2e-65
WP_144453831.1|106018_106390_+	hypothetical protein	NA	O64139	Bacillus_phage	97.6	8.5e-64
105963:105984	attR	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_144453833.1|106411_107326_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	89.8	8.1e-156
WP_042976136.1|108421_108892_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	98.7	1.5e-86
WP_068947553.1|108906_110421_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	99.4	4.0e-285
WP_068947554.1|110436_111573_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	99.5	3.9e-224
WP_144453835.1|111572_113303_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	97.9	0.0e+00
WP_113712896.1|113315_117233_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	98.3	0.0e+00
WP_041352033.1|118085_118244_+	hypothetical protein	NA	A0A1P8CX11	Bacillus_phage	92.3	2.4e-20
WP_017697078.1|118280_118478_+	hypothetical protein	NA	O64149	Bacillus_phage	96.9	1.2e-29
WP_032721947.1|118510_118726_+	YorP family protein	NA	O64150	Bacillus_phage	97.2	8.7e-37
WP_010331040.1|118718_118874_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	96.1	3.3e-22
WP_032721772.1|118873_119371_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	95.2	2.4e-85
WP_032721774.1|119379_119898_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	93.6	1.5e-90
WP_032721776.1|119921_120179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080287614.1|120319_121834_+	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	81.5	1.6e-225
WP_017697085.1|121877_122096_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	98.6	1.2e-30
WP_032721780.1|122098_122464_+	hypothetical protein	NA	O64156	Bacillus_phage	97.5	3.5e-62
WP_032721782.1|122503_122731_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	98.7	1.3e-35
WP_010886541.1|122743_122926_+	hypothetical protein	NA	O64158	Bacillus_phage	100.0	1.5e-26
WP_114523511.1|122992_123205_+	hypothetical protein	NA	O64159	Bacillus_phage	95.7	2.6e-33
WP_032721785.1|123239_123503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460195.1|123529_124078_+	metallophosphoesterase	NA	A0A223LD99	Bacillus_phage	60.0	1.1e-56
WP_041352019.1|124313_124634_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	98.1	2.1e-55
WP_144460197.1|124646_125054_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	80.9	1.6e-55
WP_046132578.1|125068_125416_+	hypothetical protein	NA	O64164	Bacillus_phage	97.4	6.8e-55
WP_109962707.1|125433_125559_+	hypothetical protein	NA	O64165	Bacillus_phage	80.5	1.2e-09
WP_144460199.1|125590_125857_+	hypothetical protein	NA	A0A1P8CX34	Bacillus_phage	98.3	6.6e-26
WP_032721799.1|125892_126084_+	hypothetical protein	NA	U5PY38	Bacillus_phage	41.9	1.3e-07
WP_032721802.1|126099_126477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721804.1|126483_126708_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	76.9	2.5e-26
WP_032721806.1|126700_126835_+	hypothetical protein	NA	O64168	Bacillus_phage	93.0	2.4e-16
WP_004399360.1|126855_127050_+	hypothetical protein	NA	O64169	Bacillus_phage	100.0	7.6e-32
WP_009967463.1|127100_127301_+	hypothetical protein	NA	O64170	Bacillus_phage	100.0	2.1e-32
WP_144460201.1|127392_127746_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	99.1	7.1e-60
WP_017697102.1|127745_128141_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	100.0	6.1e-68
WP_128472232.1|128067_128826_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	88.0	6.3e-106
WP_041338455.1|131413_131935_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.3	7.7e-87
WP_144460203.1|132515_132758_+	thioredoxin	NA	A0A1P8CX24	Bacillus_phage	91.1	3.2e-35
WP_144460205.1|132750_132963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041352007.1|132985_133342_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
WP_144460207.1|133462_133867_+	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	36.9	7.5e-13
WP_032721825.1|133917_134280_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	40.5	3.5e-14
WP_032721828.1|134351_134780_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.7	4.0e-73
WP_032721830.1|134867_135050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721832.1|135374_135668_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	95.7	2.5e-42
WP_032721835.1|135664_135880_+	hypothetical protein	NA	A0A1P8CX47	Bacillus_phage	100.0	3.7e-35
WP_032721838.1|136395_137235_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.4	3.4e-161
WP_032721841.1|137234_137756_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	44.1	5.2e-35
WP_032721843.1|137880_138243_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	66.7	2.4e-34
WP_032721845.1|138246_138543_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	79.4	1.0e-35
WP_032721847.1|138543_138765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041056461.1|138801_139080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041338424.1|139134_139347_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	98.6	7.1e-31
WP_144460527.1|139514_139883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721857.1|139922_140228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160171068.1|140268_140418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721859.1|140439_140856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721949.1|140935_141268_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	60.4	5.2e-28
WP_032721861.1|141248_141797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721863.1|141797_141971_+	hypothetical protein	NA	O64190	Bacillus_phage	86.0	3.5e-20
WP_144460529.1|141967_142219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074794857.1|142280_142466_+	hypothetical protein	NA	O64193	Bacillus_phage	94.8	7.3e-24
WP_032721881.1|142467_142710_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	91.2	1.4e-35
WP_032721883.1|142782_143382_+	hypothetical protein	NA	O64195	Bacillus_phage	91.4	1.2e-94
>prophage 4
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	801124	830450	4356270	terminase,tail,holin,plate,portal	Bacillus_phage(36.36%)	36	NA	NA
WP_015714309.1|801124_802720_+	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	60.9	3.8e-76
WP_015714310.1|802734_803313_+	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_009967791.1|803430_803577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|803573_803936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399085.1|803951_804431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229946.1|804595_805414_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
WP_003246208.1|805458_805881_-|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_003229944.1|806905_807070_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_009967793.1|807066_807402_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229943.1|807411_808512_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_003229942.1|808514_808787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229941.1|808783_809362_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
WP_003229940.1|809345_810392_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_004398572.1|810384_810810_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229938.1|810822_811086_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_004398524.1|811082_812063_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	2.1e-40
WP_004398548.1|812075_812735_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
WP_003246092.1|812727_817485_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_003229934.1|817487_817625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229933.1|817666_818116_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_074794433.1|818922_819012_+	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_015714312.1|819383_819827_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_015714313.1|819829_821230_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.1	1.8e-74
WP_032679171.1|821230_821422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714315.1|821418_821856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714316.1|821868_822372_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	2.9e-38
WP_015714317.1|822368_822731_-	YqbH/XkdH family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.3e-11
WP_015714318.1|822727_823123_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_015714319.1|823127_823439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714320.1|823449_824385_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	65.4	1.1e-104
WP_015714321.1|824403_825378_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	70.3	2.0e-59
WP_015714322.1|825383_825950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714323.1|825992_826910_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.2e-52
WP_015714324.1|826906_828439_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.5	1.4e-147
WP_015714325.1|828442_829738_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.2	8.7e-156
WP_015714326.1|829730_830450_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	52.5	1.1e-56
>prophage 5
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	833568	841444	4356270		uncultured_Caudovirales_phage(60.0%)	14	NA	NA
WP_015714331.1|833568_834684_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	39.5	1.9e-50
WP_015714332.1|834850_835057_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	69.7	6.0e-19
WP_015714333.1|835138_835567_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	66.4	2.8e-42
WP_074794430.1|835662_835812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074794427.1|835802_836744_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	2.1e-58
WP_116758330.1|836625_837303_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.5e-05
WP_015714338.1|837379_838234_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	77.6	5.6e-119
WP_003229905.1|839295_839490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120028409.1|839449_839623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714340.1|839619_839877_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_015714341.1|839873_840443_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003229902.1|840516_840657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398958.1|840686_840917_-	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_004398704.1|841093_841444_+	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
>prophage 6
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	994441	1103295	4356270	tRNA,tail,terminase,head,holin,coat,plate,capsid,portal,protease	Bacillus_phage(58.82%)	115	NA	NA
WP_003229725.1|994441_995587_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|995613_996642_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_015714444.1|996671_996872_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|996864_997869_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|997879_998485_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|998623_999136_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_015714445.1|999183_1000491_-	MFS transporter	NA	NA	NA	NA	NA
WP_015714446.1|1000561_1001587_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003246159.1|1001824_1002472_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|1002517_1002640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158305252.1|1002745_1003171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|1003177_1003318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041850175.1|1003481_1004936_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_015714449.1|1004977_1005700_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015714450.1|1005802_1006399_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_003229695.1|1006544_1007708_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_015714451.1|1007824_1008931_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015714452.1|1008917_1009787_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_015714453.1|1009740_1011336_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015714454.1|1011439_1012627_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	31.7	8.9e-22
WP_004398582.1|1012586_1013129_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014477545.1|1013152_1014010_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|1014026_1014470_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003229675.1|1014529_1015816_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|1015849_1016428_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|1016505_1016628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|1016748_1017033_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_015714455.1|1017385_1017694_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_015714456.1|1017840_1018707_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_015714457.1|1018699_1019494_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014664846.1|1019642_1020449_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|1020450_1021131_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|1021183_1021702_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_009967915.1|1021698_1022571_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|1022601_1023615_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_144460379.1|1024842_1025772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460381.1|1025811_1026423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460383.1|1026438_1026696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460385.1|1026621_1026861_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	59.0	6.6e-17
WP_103330434.1|1027436_1027982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460387.1|1028017_1028206_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	50.0	7.2e-11
WP_144460389.1|1028361_1029981_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	60.1	9.5e-75
WP_017696318.1|1029992_1030409_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	57.2	6.7e-41
WP_144460391.1|1030442_1031420_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	72.0	9.1e-65
WP_046663946.1|1031463_1031886_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_144460393.1|1031926_1032766_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	33.5	5.7e-31
WP_144481587.1|1032784_1032928_-	XkdX family protein	NA	NA	NA	NA	NA
WP_144481586.1|1032928_1033282_-	hypothetical protein	NA	O64053	Bacillus_phage	40.0	3.6e-11
WP_144481588.1|1033295_1034768_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	64.5	2.3e-67
WP_144481585.1|1034783_1037351_-	peptidase G2	NA	D6R401	Bacillus_phage	66.8	0.0e+00
WP_144460272.1|1037402_1039106_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.3	5.1e-180
WP_144460274.1|1039120_1039960_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.7	2.4e-98
WP_144460277.1|1039953_1044441_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.0e-66
WP_072693021.1|1044639_1045017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460279.1|1045083_1045695_-|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	34.4	4.7e-11
WP_144460281.1|1045709_1046102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460285.1|1046495_1046810_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	2.9e-12
WP_063695024.1|1046799_1047102_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	3.6e-12
WP_144460287.1|1047119_1047536_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	52.4	4.2e-11
WP_032725456.1|1047558_1048854_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.3	5.2e-92
WP_019260075.1|1048892_1049519_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	75.8	7.6e-81
WP_144460289.1|1049481_1050762_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.8	3.1e-153
WP_165882333.1|1050766_1050937_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	69.8	1.9e-10
WP_144460291.1|1050950_1052660_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.8	8.4e-207
WP_144460293.1|1052656_1053172_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	4.9e-33
WP_144460295.1|1053400_1053766_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	53.3	1.0e-29
WP_144460297.1|1053755_1053941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460299.1|1054085_1054643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460301.1|1054868_1055306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460303.1|1055747_1056161_-	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.0	1.6e-63
WP_144460305.1|1056246_1056597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460307.1|1056775_1057177_-	hypothetical protein	NA	A8ASP1	Listeria_phage	35.4	2.8e-12
WP_144460309.1|1057353_1057869_-	hypothetical protein	NA	D6R425	Bacillus_phage	96.5	9.9e-95
WP_144460311.1|1057902_1058442_-	nuclease	NA	Q9ZXC2	Bacillus_phage	95.0	5.2e-94
WP_144460313.1|1058438_1058876_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	92.4	1.7e-74
WP_144460315.1|1059076_1061494_-	DNA primase	NA	D6R422	Bacillus_phage	88.8	0.0e+00
WP_014479858.1|1061554_1061992_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
WP_019260095.1|1062015_1062213_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	87.5	1.1e-17
WP_041055408.1|1062202_1063141_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	93.2	2.8e-164
WP_144460317.1|1063144_1063699_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	95.1	2.9e-92
WP_165882334.1|1063765_1063903_-	hypothetical protein	NA	D6R417	Bacillus_phage	91.2	2.0e-10
WP_041055414.1|1063892_1064168_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	49.4	1.3e-21
WP_164906784.1|1064164_1064320_-	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	62.5	3.6e-08
WP_060399201.1|1064388_1064661_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	94.4	1.4e-39
WP_069839654.1|1064940_1065375_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	91.0	2.6e-64
WP_060399203.1|1065388_1065835_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	88.5	3.5e-72
WP_164906785.1|1065865_1067302_+	recombinase family protein	NA	Q9T200	Bacillus_phage	84.8	2.3e-229
WP_080332209.1|1067305_1067722_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004398496.1|1067758_1068328_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_015714459.1|1068480_1069479_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_015714460.1|1070497_1071790_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015714461.1|1071849_1074492_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003222590.1|1074939_1075131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|1075149_1076175_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_015714462.1|1076207_1077932_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_015384279.1|1078062_1079355_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_015251538.1|1079384_1080359_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_015714463.1|1080355_1081144_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_074794634.1|1081133_1082078_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|1082110_1082941_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_004399038.1|1082948_1084316_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_015714465.1|1084545_1085043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229618.1|1085647_1087972_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_014477564.1|1088152_1089811_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|1089963_1091226_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_144460319.1|1091497_1092772_-	trigger factor	NA	NA	NA	NA	NA
WP_003229609.1|1092999_1094004_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015714467.1|1094122_1094722_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229604.1|1094734_1096153_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_015714468.1|1096202_1097300_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_015714469.1|1097320_1098877_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_003222549.1|1098863_1099892_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|1099915_1100434_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_004398643.1|1100430_1102155_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	8.3e-61
WP_015714470.1|1102959_1103295_+|coat	inner spore coat protein CotQ	coat	NA	NA	NA	NA
>prophage 7
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	1561406	1583554	4356270	tail,head,holin,plate,protease	Bacillus_phage(61.54%)	21	NA	NA
WP_144460399.1|1561406_1562522_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	72.2	1.1e-146
WP_144460397.1|1562869_1564636_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.9	9.5e-129
WP_144459422.1|1564649_1565114_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_144459424.1|1565167_1566142_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	70.9	7.0e-65
WP_041345135.1|1566185_1566608_-|holin	holin family protein	holin	D6R405	Bacillus_phage	83.5	1.3e-55
WP_144460396.1|1566648_1567488_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	33.0	2.8e-30
WP_083252875.1|1567506_1567650_-	XkdX family protein	NA	NA	NA	NA	NA
WP_144459428.1|1567650_1568004_-	hypothetical protein	NA	O64053	Bacillus_phage	41.8	1.1e-12
WP_144459430.1|1568017_1569493_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	63.5	4.9e-62
WP_144481581.1|1569505_1572070_-	peptidase G2	NA	D6R401	Bacillus_phage	66.2	0.0e+00
WP_144459434.1|1572076_1573960_-	autolysin	NA	M5AC19	Bacillus_phage	25.7	2.3e-48
WP_144459436.1|1573972_1574803_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_144459484.1|1574807_1575710_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	75.0	2.8e-52
WP_160215017.1|1579118_1579283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695872.1|1579303_1579687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460215.1|1579686_1580319_-	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	29.7	1.7e-11
WP_144460217.1|1580315_1580699_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_144460219.1|1580703_1581114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165882337.1|1581097_1581442_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_144460223.1|1581404_1581698_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J3M5	uncultured_Caudovirales_phage	51.4	1.9e-13
WP_026113656.1|1582960_1583554_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	59.0	5.4e-52
>prophage 8
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	1589678	1601218	4356270	integrase	Bacillus_phage(36.36%)	18	1584633:1584646	1605796:1605809
1584633:1584646	attL	ATAATTAAAATAAG	NA	NA	NA	NA
WP_144460225.1|1589678_1591007_-	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.1	7.9e-136
WP_144460227.1|1591007_1591364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460229.1|1591356_1592130_-	Replication protein O	NA	A0A2P1JTY8	Anoxybacillus_phage	47.0	2.3e-39
WP_144460231.1|1592144_1592549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460233.1|1592677_1593526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128473253.1|1593538_1594192_-	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	39.5	2.0e-36
WP_128473254.1|1594244_1594625_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	41.6	1.6e-20
WP_164907153.1|1594616_1594787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164907154.1|1594826_1594985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460235.1|1594981_1595293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019712253.1|1595323_1595593_-	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	51.7	7.1e-20
WP_088325932.1|1595605_1595851_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXX9	Bacillus_phage	75.9	3.4e-29
WP_088325930.1|1596028_1596400_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	72.7	1.2e-22
WP_144460237.1|1596407_1596875_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	58.8	1.2e-43
WP_144460239.1|1596925_1598083_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	68.6	3.4e-151
WP_003228608.1|1598146_1599544_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003222809.1|1599564_1600008_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	1.9e-14
WP_015714668.1|1599997_1601218_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.1	1.2e-117
1605796:1605809	attR	ATAATTAAAATAAG	NA	NA	NA	NA
>prophage 9
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	2072006	2190835	4356270	tRNA,lysis,holin,coat,bacteriocin,protease	Bacillus_phage(22.22%)	113	NA	NA
WP_003227570.1|2072006_2073677_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|2073673_2074102_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_015714887.1|2074678_2076025_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|2076037_2076199_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003227564.1|2076195_2076915_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_074794356.1|2076907_2078218_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_144460258.1|2078207_2079368_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003227558.1|2079372_2080653_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003227556.1|2080649_2081351_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_015714888.1|2081356_2082733_-	YncE family protein	NA	NA	NA	NA	NA
WP_015250986.1|2082771_2084127_-	YncE family protein	NA	NA	NA	NA	NA
WP_015714889.1|2084123_2084354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714890.1|2084356_2085502_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	1.1e-77
WP_009968329.1|2085485_2085605_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_015714892.1|2085861_2086341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|2086489_2087278_+	membrane protein	NA	NA	NA	NA	NA
WP_015714894.1|2087264_2087939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714895.1|2087939_2088746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|2088748_2089396_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_015714897.1|2089388_2089949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|2089997_2090870_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|2090930_2091761_-	spermidine synthase	NA	NA	NA	NA	NA
WP_015384942.1|2091962_2094038_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015714898.1|2094330_2094849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|2094862_2095522_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|2095630_2095819_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|2095861_2096281_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015714899.1|2096400_2098317_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.3	9.0e-141
WP_015714901.1|2099161_2100562_-	MFS transporter	NA	NA	NA	NA	NA
WP_015714902.1|2100561_2101032_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|2101143_2101644_-	YwgA family protein	NA	NA	NA	NA	NA
WP_015250978.1|2101679_2102981_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|2103142_2103367_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_015714903.1|2103582_2104359_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_015714904.1|2104502_2105396_-	DMT family transporter	NA	NA	NA	NA	NA
WP_015714905.1|2105563_2106409_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014481233.1|2106457_2107357_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_015714906.1|2107502_2108474_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003242896.1|2108743_2109508_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_015714908.1|2109640_2110420_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_015714909.1|2110434_2111634_-	transaminase BacF	NA	NA	NA	NA	NA
WP_019712823.1|2111634_2112819_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003227500.1|2112815_2114234_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_026009856.1|2114252_2115014_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003244300.1|2115016_2115724_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|2115713_2116328_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003227490.1|2116479_2117718_-	MFS transporter	NA	NA	NA	NA	NA
WP_003244348.1|2117927_2119340_-	amino acid permease	NA	NA	NA	NA	NA
WP_003227484.1|2121112_2122660_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|2122886_2124161_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|2124337_2124802_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003242881.1|2125125_2125581_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015714911.1|2125573_2126425_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	3.7e-38
WP_003227468.1|2126438_2127386_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	5.7e-72
WP_003227466.1|2127385_2128126_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	3.4e-48
WP_003227463.1|2128150_2129170_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003227461.1|2129172_2129895_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003227459.1|2129887_2131009_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003227457.1|2131008_2131878_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003227455.1|2131878_2133048_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_015714912.1|2133068_2134493_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|2134497_2135268_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|2135587_2136133_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|2136176_2136548_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|2136609_2137932_-	purine permease	NA	NA	NA	NA	NA
WP_014481255.1|2137951_2138269_-	YwdI family protein	NA	NA	NA	NA	NA
WP_064911637.1|2138436_2139807_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003242965.1|2139831_2140509_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_015714916.1|2140522_2141329_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003242645.1|2141519_2142335_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|2142424_2142673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227426.1|2144201_2145587_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003243563.1|2145888_2146659_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|2146697_2147528_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|2147567_2147870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227419.1|2148399_2150820_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
WP_072173246.1|2150857_2151859_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015714918.1|2152032_2152782_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_003227413.1|2152887_2154069_-	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_003227411.1|2154564_2154828_+	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003227410.1|2154869_2155244_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227407.1|2155872_2157822_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010886637.1|2157849_2158815_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_009968363.1|2159329_2159575_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015714919.1|2159645_2161187_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003227400.1|2161190_2162363_-	galactokinase	NA	NA	NA	NA	NA
WP_165882356.1|2162443_2162797_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003227396.1|2162843_2163515_-	transcriptional regulator SlrC	NA	NA	NA	NA	NA
WP_003243648.1|2163869_2164028_+	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_019712833.1|2164470_2164779_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003227390.1|2164775_2166317_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_003243445.1|2167227_2168478_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_064911639.1|2168496_2169654_-	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_064911640.1|2169650_2171096_-	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_064911641.1|2171252_2171921_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_015250932.1|2171917_2172736_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003227377.1|2172743_2173649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227375.1|2173754_2174141_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227371.1|2174122_2174800_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_015714923.1|2174902_2176105_+	MFS transporter	NA	NA	NA	NA	NA
WP_003227367.1|2176138_2176336_+	YwbE family protein	NA	NA	NA	NA	NA
WP_015714924.1|2176370_2177558_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.5	3.1e-75
WP_014665869.1|2177678_2178059_+	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_015714925.1|2178308_2179601_-	DUF1668 domain-containing protein	NA	NA	NA	NA	NA
WP_041520500.1|2179983_2180661_-	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_015714927.1|2180751_2182074_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_015714929.1|2182301_2184239_+|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	34.6	1.1e-45
WP_015714930.1|2184665_2186045_+	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_015714931.1|2186098_2186941_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_015714932.1|2186994_2187855_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
WP_003227346.1|2187964_2188678_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_003227345.1|2188827_2189343_+	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_074794362.1|2189593_2190835_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	2603201	2669510	4356270	tRNA,terminase,tail,integrase,holin,plate,capsid,portal	Bacillus_phage(42.22%)	81	2615934:2615993	2680620:2680741
WP_004399657.1|2603201_2603945_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003241966.1|2604106_2604544_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_015715121.1|2604564_2604957_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003235115.1|2605420_2606188_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015715122.1|2606373_2606817_+	YbaK family protein	NA	NA	NA	NA	NA
WP_015252979.1|2606876_2607590_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.0	8.3e-15
WP_003235124.1|2607685_2608744_+	iron-sulfur carrier protein/transcriptional regulator SalA	NA	NA	NA	NA	NA
WP_003235126.1|2608779_2609337_-	spore germination protein GerD	NA	NA	NA	NA	NA
WP_003235130.1|2610042_2610807_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
2615934:2615993	attL	ATTTGTTTGGTGGCGATAGCGAAGAGGTCACACCCGTTCCCATACCGAACACGGAAGTTA	NA	NA	NA	NA
WP_144460415.1|2616355_2617540_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	40.5	9.0e-75
WP_044430532.1|2617526_2618060_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.9	6.1e-39
WP_144460417.1|2618146_2618488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460419.1|2618520_2618820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144460421.1|2619065_2619395_-	helix-turn-helix domain-containing protein	NA	O64078	Bacillus_phage	47.6	6.9e-17
WP_044430524.1|2619555_2619789_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	56.9	2.7e-15
WP_144460423.1|2619801_2619993_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103031398.1|2620057_2620591_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103031399.1|2620580_2620841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165882342.1|2620841_2621006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031400.1|2621423_2621609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460425.1|2621605_2623579_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	48.0	4.9e-150
WP_044430512.1|2623621_2624362_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	59.2	1.3e-68
WP_144460427.1|2624358_2625060_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	70.0	1.9e-96
WP_144460429.1|2625264_2626023_+	hypothetical protein	NA	U5Q085	Bacillus_phage	31.9	2.0e-11
WP_087992043.1|2626036_2626318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460431.1|2626292_2627591_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.6	1.2e-93
WP_144460433.1|2627609_2627804_+	Fur-regulated basic protein FbpA	NA	A0A1L2JY24	Aeribacillus_phage	49.1	1.7e-07
WP_144460435.1|2627903_2628395_+	hypothetical protein	NA	A0A0C5AFC9	Paenibacillus_phage	48.0	5.8e-36
WP_144460437.1|2628410_2629103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165882325.1|2629211_2629406_+	hypothetical protein	NA	M4ZR07	Bacillus_phage	49.1	1.9e-06
WP_017696757.1|2629475_2629679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460441.1|2629718_2630198_+	hypothetical protein	NA	A0A0M3ULE9	Bacillus_phage	36.7	1.8e-21
WP_144460443.1|2630215_2630503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460445.1|2630499_2630757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460447.1|2630805_2631540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460449.1|2631616_2632003_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	58.9	4.9e-30
WP_144460451.1|2632057_2632795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165882343.1|2633277_2633445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460453.1|2633539_2633884_+	structural protein	NA	M4ZRM2	Bacillus_phage	57.9	4.8e-29
WP_144460455.1|2633951_2634419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460457.1|2634474_2634996_+	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	58.5	2.5e-53
WP_144460460.1|2635006_2636023_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	66.2	1.0e-130
WP_144481590.1|2636103_2636622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460464.1|2636774_2637023_+	hypothetical protein	NA	A8ATN7	Listeria_phage	37.1	2.7e-05
WP_144460466.1|2637090_2638200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460468.1|2638291_2639191_+|terminase	terminase	terminase	A0A1B1P7C9	Bacillus_phage	33.0	9.1e-19
WP_165882344.1|2639187_2640504_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.4	6.8e-156
WP_144460472.1|2640504_2642037_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	54.6	2.5e-154
WP_144460474.1|2642033_2642951_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.9	1.8e-54
WP_144460476.1|2642994_2643636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460478.1|2643659_2644847_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	52.0	3.8e-81
WP_019713110.1|2644878_2645814_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.3	1.3e-105
WP_144460480.1|2645825_2646179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460482.1|2646184_2646577_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	38.5	3.8e-14
WP_144460484.1|2646573_2646936_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_144460486.1|2646932_2647433_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.8	6.8e-40
WP_144460488.1|2647445_2647883_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_033880532.1|2647879_2648071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460490.1|2648071_2649472_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.7	1.1e-74
WP_014112406.1|2649473_2649917_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	4.5e-27
WP_144460492.1|2650419_2650869_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.4	2.0e-11
WP_019713118.1|2650910_2651048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460494.1|2651050_2656387_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.9	4.9e-43
WP_144460496.1|2656379_2657039_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	35.8	1.5e-26
WP_144460498.1|2657051_2658032_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.3	2.7e-40
WP_010330118.1|2658028_2658295_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_144460500.1|2658307_2658733_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	34.8	1.9e-11
WP_144460523.1|2658725_2659772_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	3.5e-70
WP_144460502.1|2659755_2660334_+	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.9e-14
WP_144460504.1|2660330_2660603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460506.1|2660606_2662361_+|terminase	terminase	terminase	A0A1P8CWR7	Bacillus_phage	42.2	1.0e-26
WP_044430377.1|2662372_2662702_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.4	2.9e-15
WP_010330111.1|2662698_2662863_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	69.8	1.9e-15
WP_144460509.1|2662954_2663848_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_144460511.1|2663915_2664200_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	68.1	4.9e-27
WP_144460513.1|2664215_2664479_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	1.6e-24
WP_144460515.1|2664534_2665509_+	LysM peptidoglycan-binding domain-containing protein	NA	D6QWL5	uncultured_phage	70.7	5.9e-64
WP_044430364.1|2665560_2666025_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_144460517.1|2666043_2667807_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	54.1	6.8e-127
WP_144460519.1|2668016_2669147_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.1	1.3e-70
WP_044430359.1|2669321_2669510_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	60.0	4.1e-14
2680620:2680741	attR	ATTTGTTTGGTGGCGATAGCGAAGAGGTCACACCCGTTCCCATACCGAACACGGAAGTTAAGCTCTTCAGCGCCGATGGTAGTCGGGGGTTTCCCCCTGTGAGAGTAGGACGCCGCCAAGCA	NA	NA	NA	NA
>prophage 11
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	3121100	3166883	4356270	tRNA,terminase,tail,head,integrase,portal,protease	uncultured_Caudovirales_phage(35.9%)	70	3113418:3113432	3161315:3161329
3113418:3113432	attL	CTTGATAGATTTCAC	NA	NA	NA	NA
WP_015715341.1|3121100_3121577_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_015252684.1|3121557_3122247_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003243019.1|3122256_3122712_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_015715342.1|3122704_3123745_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	8.8e-66
WP_049140773.1|3123975_3125904_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	2.4e-56
WP_003243499.1|3126029_3126542_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003234073.1|3126538_3127186_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003234072.1|3127206_3127380_+	sec-independent protein translocase protein TatAY	NA	NA	NA	NA	NA
WP_015252680.1|3127386_3128151_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
WP_003225680.1|3128382_3128574_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003234069.1|3128570_3129305_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|3129542_3129827_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003234067.1|3129873_3131505_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	3.7e-159
WP_144460535.1|3131594_3132794_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	46.5	3.1e-83
WP_041057296.1|3132810_3133317_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	68.7	7.5e-63
WP_041057293.1|3133388_3133736_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	69.1	6.6e-18
WP_041057291.1|3133752_3134274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041057288.1|3134604_3134988_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	65.9	2.3e-32
WP_010329849.1|3135151_3135379_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	61.6	4.8e-17
WP_017697379.1|3135391_3135706_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	44.2	2.7e-10
WP_041057283.1|3135812_3136586_+	antirepressor	NA	A0A290FZK7	Caldibacillus_phage	68.4	4.8e-101
WP_144460533.1|3136737_3137307_+	helix-turn-helix domain-containing protein	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.6	8.8e-60
WP_015714340.1|3137303_3137561_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_120028409.1|3137557_3137731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229905.1|3137690_3137885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072175921.1|3137973_3138945_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	70.4	8.9e-129
WP_165882348.1|3138947_3139802_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	77.6	7.4e-119
WP_017696661.1|3139794_3139959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460358.1|3139966_3140665_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	44.2	8.6e-41
WP_144460356.1|3140549_3141488_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	51.1	5.2e-57
WP_157680844.1|3141484_3141622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165882349.1|3141715_3141868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015715363.1|3141854_3142313_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	81.3	1.1e-60
WP_165882350.1|3142432_3142600_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.9e-10
WP_017697395.1|3142680_3142887_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	78.9	8.4e-21
WP_052481594.1|3142918_3143248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064911548.1|3143244_3143493_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	42.3	7.8e-05
WP_164906408.1|3143833_3144169_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	50.5	1.5e-19
WP_095252451.1|3144165_3144594_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	61.1	8.1e-42
WP_144460352.1|3144900_3145122_+	hypothetical protein	NA	F8WPM3	Bacillus_phage	53.7	9.1e-13
WP_144460350.1|3145109_3145292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460348.1|3145288_3145690_+	hypothetical protein	NA	M4ZR14	Bacillus_phage	97.0	1.3e-62
WP_144460346.1|3145702_3145897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163226413.1|3145910_3146087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069150172.1|3146083_3146287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165490424.1|3146297_3146453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033884289.1|3146588_3146720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460344.1|3146735_3146921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041850216.1|3146941_3147403_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	1.8e-23
WP_072566768.1|3147667_3148096_+|terminase	terminase small subunit	terminase	A0A0K2CNQ5	Brevibacillus_phage	66.2	2.7e-45
WP_134976628.1|3148092_3149361_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1Q1PVS1	Bacillus_phage	79.9	2.6e-197
WP_144460342.1|3149401_3149635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134976622.1|3149637_3151092_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	48.6	1.3e-123
WP_144460340.1|3151078_3152002_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	45.8	1.2e-69
WP_165882351.1|3152128_3152281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128480753.1|3152425_3153091_+	scaffolding protein	NA	I1TLE1	Bacillus_phage	47.3	1.3e-22
WP_103803590.1|3154099_3154306_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	59.1	3.4e-14
WP_033884273.1|3154319_3154535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460338.1|3154539_3154836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460336.1|3154832_3155177_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_144460333.1|3155163_3155580_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	52.9	3.9e-33
WP_116315366.1|3155598_3155997_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_033884267.1|3156010_3156523_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	45.9	1.7e-30
WP_116315365.1|3156446_3156779_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	77.8	1.5e-27
WP_116315364.1|3156798_3157038_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_116315363.1|3157092_3157605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116315388.1|3157652_3157961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460331.1|3157965_3162681_+	hypothetical protein	NA	A0A1W6JQL3	Staphylococcus_phage	27.3	2.0e-32
3161315:3161329	attR	GTGAAATCTATCAAG	NA	NA	NA	NA
WP_144460329.1|3162677_3163442_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_144460326.1|3163454_3166883_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.1	1.4e-131
>prophage 12
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	3212499	3220865	4356270		Synechococcus_phage(50.0%)	8	NA	NA
WP_015715438.1|3212499_3213795_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	4.5e-19
WP_015715439.1|3213868_3214594_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
WP_003219409.1|3214586_3214841_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_015715440.1|3214837_3215521_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_015715441.1|3215504_3217733_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	5.0e-159
WP_003233947.1|3217708_3219139_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_015715442.1|3219240_3220281_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.2e-64
WP_015252651.1|3220277_3220865_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 13
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	3707772	3751974	4356270	tRNA,coat	Planktothrix_phage(25.0%)	47	NA	NA
WP_003232972.1|3707772_3708012_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|3708176_3709115_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|3709137_3710379_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|3710454_3711240_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|3711431_3712418_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|3712414_3713404_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003232963.1|3713490_3715122_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_003245828.1|3715197_3716148_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003239298.1|3717280_3718033_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_015483084.1|3718067_3719060_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003232957.1|3719803_3721441_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|3721548_3722484_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_015715665.1|3722487_3723405_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_074794192.1|3723409_3724486_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|3724487_3725405_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_074794275.1|3725512_3726730_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|3726894_3727473_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|3727653_3728049_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|3728091_3728748_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|3728917_3729058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245194.1|3729024_3729681_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003245684.1|3729675_3729798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245839.1|3729841_3730993_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|3731039_3733052_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|3733089_3733257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|3733570_3734470_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|3734466_3734865_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_074794278.1|3735119_3735665_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	61.0	1.6e-39
WP_015715669.1|3735868_3736441_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_015715670.1|3736565_3736934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|3736962_3737598_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|3737616_3738417_+	NAD kinase	NA	NA	NA	NA	NA
WP_074794281.1|3738479_3739331_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_015715672.1|3739343_3740078_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	23.3	3.2e-06
WP_015715673.1|3740314_3742159_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|3742407_3743118_+	thiaminase II	NA	NA	NA	NA	NA
WP_015715675.1|3743692_3744802_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_010886482.1|3744801_3745002_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010886483.1|3744998_3745769_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003245868.1|3745765_3746776_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003245050.1|3746794_3747610_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|3747745_3748522_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_074794198.1|3748622_3749306_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_003244982.1|3749399_3749846_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_003239243.1|3749973_3750462_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003244668.1|3750613_3751132_-|coat	spore coat protein CotX	coat	NA	NA	NA	NA
WP_015715677.1|3751587_3751974_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 14
NZ_CP026662	Bacillus subtilis strain H1 chromosome, complete genome	4356270	3779331	3889674	4356270	tRNA,terminase,tail,holin,coat,plate,portal,protease	Bacillus_phage(24.44%)	116	NA	NA
WP_015715700.1|3779331_3779799_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003232825.1|3779838_3780033_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_015715701.1|3780164_3780482_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_072692652.1|3781101_3782091_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_015715704.1|3782213_3782462_-|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_003245023.1|3782715_3784119_+	peptidoglycan-N-acetylmuramic acid deacetylase PdaC	NA	NA	NA	NA	NA
WP_014476498.1|3784158_3784632_-	YjfA family protein	NA	NA	NA	NA	NA
WP_014476499.1|3784760_3784928_-	putative motility protein	NA	NA	NA	NA	NA
WP_015715705.1|3785054_3785954_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_009967034.1|3785963_3786362_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_015715707.1|3786462_3787038_-	YjgB family protein	NA	NA	NA	NA	NA
WP_015715708.1|3787183_3790141_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_015715709.1|3790133_3790694_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_072692632.1|3791610_3792237_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003232791.1|3792267_3792546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715711.1|3792935_3794126_+	monooxygenase YjiB	NA	NA	NA	NA	NA
WP_015715712.1|3794148_3795327_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.0	4.3e-08
WP_003232781.1|3795367_3795556_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_015715713.1|3795729_3796542_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003232776.1|3796587_3797340_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_015715714.1|3797339_3798092_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.1e-17
WP_029726246.1|3798211_3799186_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_015715717.1|3799317_3799815_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003220510.1|3800203_3800626_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_015383407.1|3800665_3801844_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015715718.1|3802040_3803462_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_015715719.1|3803529_3804909_+	MFS transporter	NA	NA	NA	NA	NA
WP_015715721.1|3806031_3807051_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015252298.1|3807075_3808155_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003245605.1|3808151_3808988_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
WP_003244946.1|3810390_3811392_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_015715723.1|3812906_3814400_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_014476525.1|3814438_3815203_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015715724.1|3815424_3815889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715725.1|3816037_3817309_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_015252291.1|3817453_3818590_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|3818579_3818714_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|3818744_3819002_-	YciI family protein	NA	NA	NA	NA	NA
WP_003244876.1|3819122_3820076_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_015715726.1|3820115_3820493_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	4.7e-17
WP_015252289.1|3820598_3821201_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|3821277_3822114_+	manganese catalase	NA	NA	NA	NA	NA
WP_015715727.1|3822157_3822754_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|3822916_3823258_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_015715728.1|3823435_3823615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015715729.1|3823601_3824438_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	28.6	3.6e-25
WP_074794201.1|3824337_3825138_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.3	2.5e-60
WP_003245588.1|3825137_3825305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479479.1|3825389_3825740_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003244900.1|3825736_3825943_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.6e-11
WP_015715732.1|3826058_3826568_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.1e-21
WP_144460130.1|3826684_3827482_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.5	1.9e-60
WP_003232697.1|3827478_3828780_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	9.1e-153
WP_003232695.1|3828783_3830271_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003232691.1|3830290_3831118_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|3831143_3832079_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_003232687.1|3832100_3832484_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	41.1	3.7e-14
WP_003232682.1|3832480_3832837_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003232681.1|3832833_3833319_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	3.6e-38
WP_003232680.1|3833331_3833772_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|3833775_3833994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|3833990_3835391_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|3835392_3835836_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|3835926_3836373_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_072692631.1|3836414_3836555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144460132.1|3836555_3841637_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.2e-43
WP_003232674.1|3841629_3842289_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_003245730.1|3842304_3843282_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_015715735.1|3843281_3843548_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_015715736.1|3843605_3844031_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	6.6e-12
WP_015715737.1|3844023_3845070_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	2.4e-71
WP_015483131.1|3845053_3845632_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_015715738.1|3845628_3845901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232660.1|3848025_3848355_+	phage-like element PBSX protein XkdW	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	41.3	1.7e-15
WP_015715740.1|3848351_3848516_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.4e-15
WP_015715741.1|3848559_3849399_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232655.1|3849451_3849721_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_014479566.1|3849733_3849997_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_015715742.1|3850009_3850903_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	70.1	2.8e-84
WP_144460135.1|3850940_3851081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015715743.1|3851166_3851337_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_015715744.1|3851336_3852083_-	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_014479569.1|3852192_3853194_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003218470.1|3853206_3853824_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_015252262.1|3854099_3855416_-	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_015715745.1|3855804_3856755_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_015715746.1|3856971_3859122_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_015715747.1|3859133_3860105_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_033884949.1|3860268_3860463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064911527.1|3860620_3861982_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
WP_064911526.1|3862150_3862969_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_014479576.1|3863097_3863922_+	D-aminopeptidase DppA	NA	NA	NA	NA	NA
WP_003245446.1|3863938_3864865_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_014476568.1|3864870_3865833_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_029727040.1|3865837_3866845_+	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
WP_074794288.1|3866847_3868497_+	dipeptide ABC transporter substrate-binding protein DppE	NA	NA	NA	NA	NA
WP_015715753.1|3869539_3870640_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_015715755.1|3871538_3872528_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	4.2e-17
WP_015715756.1|3872571_3873621_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_003232597.1|3873710_3874571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232595.1|3874730_3875249_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_015715757.1|3875487_3876684_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_015715759.1|3877121_3877853_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_049139777.1|3877944_3878472_+	DinB family protein	NA	NA	NA	NA	NA
WP_064911525.1|3878461_3878980_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232583.1|3879201_3879540_+	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
WP_015252242.1|3879539_3879857_+	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
WP_003245802.1|3879927_3880830_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_015715761.1|3881180_3882278_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	1.6e-70
WP_014476586.1|3882289_3883537_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	8.6e-100
WP_003232574.1|3883662_3884088_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_014476587.1|3884118_3884562_-	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_064911524.1|3884703_3885114_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003245084.1|3885367_3885838_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_053581884.1|3886010_3888299_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_029946400.1|3888714_3889674_-|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
