The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	0	4300	2908404		Bacillus_virus(100.0%)	2	NA	NA
WP_173111014.1|1836_2199_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_173114985.1|2230_4300_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.3	6.3e-15
>prophage 2
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	16920	22752	2908404		Escherichia_phage(50.0%)	4	NA	NA
WP_114548519.1|16920_17631_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	3.9e-33
WP_114548464.1|17648_19391_-	DUF3365 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	30.1	8.5e-21
WP_114548465.1|19485_20082_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	45.6	2.5e-41
WP_173111017.1|20085_22752_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.7	2.0e-85
>prophage 3
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	28840	29302	2908404		Tetraselmis_virus(100.0%)	1	NA	NA
WP_173111026.1|28840_29302_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.9	2.0e-17
>prophage 4
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	32794	34423	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173111038.1|32794_34423_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	24.5	3.6e-21
>prophage 5
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	41836	42571	2908404		Planktothrix_phage(100.0%)	1	NA	NA
WP_173111053.1|41836_42571_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	9.1e-25
>prophage 6
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	46503	49509	2908404		Lactococcus_phage(50.0%)	2	NA	NA
WP_173111073.1|46503_47703_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	29.9	9.6e-32
WP_173111076.1|47856_49509_-	AarF/ABC1/UbiB kinase family protein	NA	H8ZJ56	Ostreococcus_tauri_virus	27.1	8.8e-36
>prophage 7
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	60078	65625	2908404		Clostridium_phage(33.33%)	5	NA	NA
WP_173114994.1|60078_60630_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	43.9	6.6e-28
WP_173114997.1|60689_61400_-	hypothetical protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	5.7e-16
WP_114538915.1|61537_62269_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_173111085.1|62455_63544_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_173111088.1|63756_65625_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	30.3	2.2e-59
>prophage 8
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	69171	69966	2908404		Bacillus_phage(100.0%)	1	NA	NA
WP_114548497.1|69171_69966_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	1.0e-13
>prophage 9
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	75633	83490	2908404		Staphylococcus_phage(66.67%)	5	NA	NA
WP_173111101.1|75633_76473_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	1.1e-21
WP_173111104.1|76465_77731_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173111108.1|78053_80387_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	41.0	2.8e-160
WP_173111111.1|80797_81586_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_173111114.1|81573_83490_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.1e-12
>prophage 10
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	121622	173527	2908404	protease,transposase	Bacillus_virus(22.22%)	38	NA	NA
WP_173111176.1|121622_123437_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	43.4	8.0e-22
WP_173111179.1|123585_124209_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_173111182.1|124218_124905_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_173115006.1|124987_125686_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_173111185.1|125746_127204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111188.1|127290_128241_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_157011821.1|128271_128430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111191.1|128507_129134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111195.1|129555_129819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111198.1|129832_130510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114538866.1|131270_131765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111201.1|131825_133364_-	MBG-2 domain-containing protein	NA	NA	NA	NA	NA
WP_173111204.1|133400_137828_-	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_173111207.1|137992_139402_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_173110999.1|139567_140587_-|transposase	transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	42.9	3.2e-12
WP_173111210.1|141170_142469_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_173111213.1|142947_143688_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_173111216.1|143900_144500_-	signal peptidase I	NA	NA	NA	NA	NA
WP_173111219.1|144658_149389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111222.1|149404_151588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161128181.1|153120_153633_+	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_173111225.1|153932_156773_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.6e-117
WP_114549491.1|156782_158726_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	1.2e-140
WP_114549492.1|158982_160089_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_114549493.1|160089_161190_-	DNA polymerase III subunit beta	NA	A0A1I9SD41	Arthrobacter_phage	25.6	1.8e-21
WP_114549494.1|163127_164756_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_022737978.1|165166_165301_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_114538851.1|165312_165699_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_114538850.1|165631_165916_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_022737989.1|165944_166721_+	YidC/Oxa1 family membrane protein insertase	NA	NA	NA	NA	NA
WP_173111228.1|166817_167405_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_114538847.1|167500_168175_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_173115009.1|168510_169290_+	ParA family protein	NA	Q8JL10	Natrialba_phage	36.2	1.1e-25
WP_157011916.1|169456_170335_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.5	7.1e-16
WP_114540649.1|170577_170793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114540650.1|170789_171515_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.1	3.6e-42
WP_173111231.1|171583_172813_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_114549764.1|173068_173527_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	34.7	1.3e-16
>prophage 11
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	176738	179708	2908404		Bacillus_phage(100.0%)	1	NA	NA
WP_173111243.1|176738_179708_+	DNA polymerase III subunit epsilon	NA	A0A127AW80	Bacillus_phage	26.1	1.7e-45
>prophage 12
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	184437	188660	2908404	transposase	Lactococcus_phage(33.33%)	6	NA	NA
WP_114549764.1|184437_184896_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	34.7	1.3e-16
WP_022738031.1|185355_185649_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_041714233.1|185695_186205_+	single-stranded DNA-binding protein	NA	A0A2I6PDH4	Staphylococcus_phage	40.4	9.1e-16
WP_022738039.1|186225_186486_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_117284093.1|186503_187088_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_173111252.1|187244_188660_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	40.6	1.8e-82
>prophage 13
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	192535	193861	2908404		Cedratvirus(100.0%)	1	NA	NA
WP_173111261.1|192535_193861_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.4	2.8e-72
>prophage 14
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	204144	207934	2908404		Streptococcus_phage(50.0%)	3	NA	NA
WP_173111285.1|204144_204981_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.3	4.2e-34
WP_114540553.1|205322_206726_-	APC family permease	NA	NA	NA	NA	NA
WP_173111288.1|207028_207934_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	27.6	1.9e-11
>prophage 15
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	216235	217063	2908404		Mycobacterium_phage(100.0%)	1	NA	NA
WP_114557600.1|216235_217063_+	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.3	2.1e-17
>prophage 16
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	221648	230351	2908404		Vibrio_phage(25.0%)	4	NA	NA
WP_173111311.1|221648_227693_+	N-6 DNA methylase	NA	I3PUW5	Vibrio_phage	41.0	4.2e-309
WP_173011775.1|227806_228475_+	DNA cytosine methyltransferase	NA	A0A0E3D9R0	Bacillus_phage	56.4	3.0e-67
WP_009305534.1|228465_229011_+	N-6-adenine methyltransferase	NA	A0A126HBP0	Lactococcus_phage	51.5	9.7e-32
WP_009305533.1|229007_230351_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	35.0	9.7e-49
>prophage 17
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	234001	235348	2908404		Streptococcus_phage(100.0%)	1	NA	NA
WP_009305528.1|234001_235348_+	relaxase/mobilization nuclease domain-containing protein	NA	A0A1B0RXG0	Streptococcus_phage	46.3	1.7e-05
>prophage 18
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	248755	304176	2908404	transposase,integrase	Paenibacillus_phage(20.0%)	34	282606:282665	299030:300543
WP_114518396.1|248755_250237_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	1.5e-18
WP_114518397.1|250246_251047_-	thioesterase	NA	NA	NA	NA	NA
WP_173115018.1|251030_251930_-	anion permease	NA	NA	NA	NA	NA
WP_173111316.1|252007_253300_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
WP_114538496.1|253963_254947_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_009608947.1|254943_255966_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_114538495.1|255962_261356_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	27.0	1.2e-36
WP_173111319.1|261352_271861_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	21.8	7.6e-56
WP_009305505.1|271898_273440_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_009305504.1|273440_274118_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_009305503.1|274254_276105_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	1.6e-22
WP_009305502.1|276094_277831_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	2.1e-35
WP_013981116.1|277845_278226_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_009305500.1|278284_279577_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.2	1.2e-115
WP_009305499.1|279606_280536_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	46.1	6.9e-70
WP_009305498.1|280587_281844_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	38.2	4.6e-69
WP_009305497.1|281885_282605_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
282606:282665	attL	GATCGCGTCCCGAACGTTGGTGTAGCGGACGTTTCGCGTGCCGAATAGTCGCGGCACGAG	NA	NA	NA	NA
WP_173111316.1|282719_284012_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
WP_013981114.1|284949_285402_+	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_009305495.1|285644_286157_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_009305494.1|286153_286540_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009305493.1|286496_287867_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_114540649.1|288513_288729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114540650.1|288725_289451_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.1	3.6e-42
WP_173111231.1|289519_290749_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_173111323.1|291736_292681_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_173111326.1|294219_294429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114540616.1|294719_295463_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_173111329.1|295459_296755_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.7	1.2e-67
WP_139913199.1|296910_298224_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	8.6e-26
WP_173111332.1|298226_299054_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_173111316.1|299143_300436_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
WP_173111335.1|300655_303169_-	S8 family peptidase	NA	NA	NA	NA	NA
299030:300543	attR	GATCGCGTCCCGAACGTTGGTGTAGCGGACGTTTCGCGTGCCGAATAGTCGCGGCACGAGAAACGGCCATCGCTAGAATCGTTTGTTGCGAAGTAAACCGATTCGAGAAAGGCGATGACCGCAATGGACACTTTAGCAGCAATCGGCGCCGACGCGCCCGAGATTCCCAGATTCGACGACGGCATGGTCAACATCAACGAGCTCGTCAGGACCCTCGCCGAGGCGATCGTCAACGAGATCATGGACGCGCAGGCCGAGGACGCCTGCGCCGAGGGCAACCAGCGCAACGGCTACCGGGAGCGCCGGCTCCTCACCAGCGTCGGGCGCATCACGCTGCGCATCCCGAAGCTCAGGCGGGGGACCTACTTCCCCGAGGACCTCATCGAGCGCTACAGCCGAGTCGACCGCGCCGTGGTGGCCGCGGTGGCCGAGATGGTCACCAGCGGGGTGTCCACCCGCAAGGTGGAGAAGGTGGCCCGCGCGCTGGGGGTCGACCGCATGAGCGCCAGCCAGGTGTCCCGCATCTGCGAGTCCCTGGACGCCGCCGTGGCCGACCTGCGGGGGCGACCCCTCGGCGGCGCGCGCTTCCCCTATCTCTGGATAGACGCCACCTACCTCAAGTGCCGCGACGGCGGCCACGTCTCCAGCTGCGCCGTGGTCACCGCCATCGGGGCCGCCGACACCGGCCACCGGGTCCTCCTGGGCGTGGACTCCGCCGACACCGAGGACTACGCCTCGTGGCGGGCCTTCCTGCTCTCGCTGCGCGAGCGGGGCGTCGCCGGCGTGCGCTGCGTCACCTCGGACGCCCACGCGGGCCTGAGGCGCGCCATCGAGGAGGTGTTCCCCGGCGCGGCCTGGCAGCGCTGCGTCGTGCACCTGGAGCGCAACGTGTGCGCGCTGGCCCGCAACAGGCGCGAGCGGGCGCTCCTGGGCTCGGTGATGCGGGCGGTGTTCGCGGAGTCGGACCCCGCGCTCGTGCGCGAGCTCTACCACCTGGCGGTCGACGAGATCGGCGCGGTCAGCGCCGCGGCCGGCGCGCTTTTGGAGGAGGCCGAGGCCGACGCGCTGGCCTACCTGGACTTCCCGCCGGCGCACCACCGCAGGCTGCGCACCAACAACGTCCAGGAGAGGATGAACCGGGAGATCAAGCGCCGCGCCAACGTCGTCCAGGTGTTCCCATCCAGGAAGTCGCTGATCCGGCTCCTGGGCGCGGTGCTGTCCGAGATGGACGAGGACTGGGCGGCGCGGCGCTGGTTCACCGAGGAGTCGATATCGGAGGTCTTCGAGGACAGGCGCCGCTGGAGGCCCGGACGGCCGCCGGCGTACGAGGGCACCGCGGCGGAGCACGCCGCGCGCATCATCGCCGTGGTGATGGCCGACGGGGGCGCCGTCAGGAAGGCGGCGTGATCCAATGGTGTAGAATAGCAGCGTTCTAGGGATGGTTCGATCTCCTCGGACGGCCTCCGGCCGCCCTCGCAGATCGAATCGCTACACCAACAATCGGGACACTACCA	NA	NA	NA	NA
WP_173111338.1|303168_304176_-	ATP-binding protein	NA	G8DDJ2	Micromonas_pusilla_virus	29.1	1.1e-20
>prophage 19
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	311389	324129	2908404		Bacillus_phage(66.67%)	11	NA	NA
WP_173111356.1|311389_312073_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.9	9.3e-40
WP_173111359.1|312062_313202_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.1	1.3e-41
WP_173111363.1|313198_314302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173111366.1|314298_315282_-	helix-turn-helix transcriptional regulator	NA	A0A2I7QHZ7	Vibrio_phage	32.0	4.3e-06
WP_173115024.1|315654_316239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173115027.1|316381_317017_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_173111369.1|317016_317745_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_173111372.1|317753_319244_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.7	1.9e-08
WP_173111375.1|319260_320241_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173111378.1|320437_322363_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.8	3.4e-23
WP_173111381.1|322362_324129_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.3e-34
>prophage 20
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	330100	331318	2908404		Tupanvirus(100.0%)	1	NA	NA
WP_114538584.1|330100_331318_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.2	5.3e-78
>prophage 21
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	340718	351406	2908404		Micromonas_pusilla_virus(25.0%)	7	NA	NA
WP_173111396.1|340718_342623_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.1	8.1e-142
WP_173111398.1|342628_343312_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_022738233.1|343399_344350_+	DnaJ domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	27.9	3.8e-15
WP_173115034.1|344373_344718_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173111401.1|344730_347544_+	AAA family ATPase	NA	K4FB40	Cronobacter_phage	32.8	2.3e-121
WP_173111404.1|347877_349212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173111407.1|349435_351406_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	33.2	6.1e-60
>prophage 22
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	362356	362659	2908404		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_173115037.1|362356_362659_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	38.2	9.2e-08
>prophage 23
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	380522	383974	2908404		Xanthomonas_phage(50.0%)	3	NA	NA
WP_173111453.1|380522_380966_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	3.7e-13
WP_173111456.1|381012_383226_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041714745.1|383215_383974_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.1e-36
>prophage 24
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	402917	405533	2908404		Planktothrix_phage(50.0%)	2	NA	NA
WP_173111489.1|402917_403691_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.4e-28
WP_173111492.1|403952_405533_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.7	9.1e-06
>prophage 25
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	410821	411547	2908404		Enterobacteria_phage(100.0%)	1	NA	NA
WP_114540650.1|410821_411547_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.1	3.6e-42
>prophage 26
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	415912	416692	2908404		Flavobacterium_phage(100.0%)	1	NA	NA
WP_022738414.1|415912_416692_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.6	7.1e-20
>prophage 27
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	431308	434768	2908404		Salmonella_phage(50.0%)	4	NA	NA
WP_173111524.1|431308_432262_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	44.3	3.2e-06
WP_173111527.1|432365_433040_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_173111530.1|433026_433665_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173115049.1|433889_434768_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	49.1	5.6e-05
>prophage 28
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	438566	440132	2908404		Staphylococcus_phage(100.0%)	1	NA	NA
WP_114538668.1|438566_440132_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.0	1.7e-28
>prophage 29
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	452766	454059	2908404	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_173111316.1|452766_454059_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
>prophage 30
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	460797	462321	2908404		Cyanophage(100.0%)	1	NA	NA
WP_173111569.1|460797_462321_-	AAA family ATPase	NA	H6WG28	Cyanophage	24.5	7.7e-18
>prophage 31
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	466534	480891	2908404		Bacillus_phage(33.33%)	13	NA	NA
WP_173111579.1|466534_467353_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	40.0	1.1e-34
WP_173111582.1|467409_467976_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173111585.1|468110_469745_+	MFS transporter	NA	NA	NA	NA	NA
WP_173111588.1|470125_470830_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	1.5e-37
WP_114548209.1|470892_472674_-	DUF3365 domain-containing protein	NA	W8CYF6	Bacillus_phage	31.0	2.1e-22
WP_173111591.1|472973_475334_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173111594.1|475338_475905_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	40.2	7.0e-33
WP_173111597.1|476004_477207_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_114548205.1|477206_477884_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	5.8e-26
WP_173111600.1|478192_479032_+	YncE family protein	NA	NA	NA	NA	NA
WP_173111603.1|479043_479463_+	DUF4418 family protein	NA	NA	NA	NA	NA
WP_173111606.1|479571_480231_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_173111609.1|480234_480891_+	helix-turn-helix transcriptional regulator	NA	A0A2K9V2V5	Faecalibacterium_phage	52.5	2.6e-07
>prophage 32
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	495829	503783	2908404		Grouper_iridovirus(50.0%)	2	NA	NA
WP_114538749.1|495829_499357_+	DNA-directed RNA polymerase subunit beta	NA	Q5GAH6	Grouper_iridovirus	22.9	4.5e-37
WP_173111627.1|499361_503783_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	3.8e-57
>prophage 33
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	520185	521613	2908404		Bacillus_phage(100.0%)	1	NA	NA
WP_173111651.1|520185_521613_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	24.2	3.0e-16
>prophage 34
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	533350	540150	2908404		Synechococcus_phage(50.0%)	6	NA	NA
WP_173111660.1|533350_534832_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	37.0	1.0e-59
WP_173111663.1|534849_535926_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.4	5.2e-61
WP_114538792.1|535954_536572_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.0	9.9e-25
WP_117284195.1|536775_537768_+	XdhC family protein	NA	NA	NA	NA	NA
WP_173111665.1|538074_538710_+	inosine monophosphate cyclohydrolase	NA	NA	NA	NA	NA
WP_173111668.1|538968_540150_+	phosphoribosylaminoimidazolecarboxamide formyltransferase	NA	S4VT61	Pandoravirus	24.9	1.1e-16
>prophage 35
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	548695	554607	2908404	protease,tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_173111683.1|548695_550672_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.6	7.7e-87
WP_173111686.1|552021_554607_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.2	1.3e-126
>prophage 36
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	565246	568310	2908404	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_173111708.1|565246_566806_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	35.6	8.6e-49
WP_173111711.1|566810_568310_+	U32 family peptidase	NA	Q6DW11	Phage_TP	34.7	2.5e-45
>prophage 37
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	589481	590693	2908404	tRNA	Serratia_phage(100.0%)	1	NA	NA
WP_173111741.1|589481_590693_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	26.7	4.4e-24
>prophage 38
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	607683	609465	2908404	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_173111759.1|607683_609465_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.4	2.8e-11
>prophage 39
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	613901	616334	2908404		Pneumococcus_phage(100.0%)	1	NA	NA
WP_173111767.1|613901_616334_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	37.8	5.8e-52
>prophage 40
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	626235	631024	2908404		Burkholderia_virus(50.0%)	4	NA	NA
WP_173111788.1|626235_627600_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.1	1.3e-53
WP_173111791.1|627834_629223_+	MFS transporter	NA	NA	NA	NA	NA
WP_173111794.1|629421_630243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173111797.1|630247_631024_-	DnaJ domain-containing protein	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	43.2	1.4e-07
>prophage 41
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	637632	643005	2908404		Escherichia_phage(100.0%)	5	NA	NA
WP_041714330.1|637632_638319_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.3	4.7e-15
WP_022739165.1|638337_639192_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_022739168.1|639188_639818_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_173111813.1|639932_640565_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	45.7	8.3e-51
WP_173111816.1|640578_643005_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.1	2.7e-190
>prophage 42
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	649992	651981	2908404		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173111829.1|649992_651981_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	30.5	5.6e-77
>prophage 43
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	658792	668199	2908404	transposase	Paenibacillus_phage(25.0%)	7	NA	NA
WP_173111316.1|658792_660085_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
WP_173111844.1|660494_662423_-	tetracycline resistance ribosomal protection protein Tet(W)	NA	E4ZFJ7	Streptococcus_phage	99.1	0.0e+00
WP_173111847.1|663246_665010_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.7	2.4e-23
WP_173111850.1|665018_665999_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_173111853.1|666444_666819_+	YraN family protein	NA	NA	NA	NA	NA
WP_173111856.1|666922_667300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173111859.1|667431_668199_+	ParA family protein	NA	A0A240F4U1	Ochrobactrum_phage	35.5	1.3e-13
>prophage 44
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	689135	690779	2908404		Streptomyces_phage(100.0%)	1	NA	NA
WP_173111899.1|689135_690779_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	44.8	7.7e-16
>prophage 45
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	697527	702290	2908404		Lactobacillus_phage(50.0%)	6	NA	NA
WP_173111912.1|697527_698316_-	ATP-binding protein	NA	A0A2P1CCD9	Lactobacillus_phage	25.7	2.3e-10
WP_173111915.1|698331_698787_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079535880.1|698796_699036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154249390.1|699077_699269_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173111918.1|699895_700810_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_173111921.1|701015_702290_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	25.0	3.0e-15
>prophage 46
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	723068	730118	2908404	transposase	Serratia_phage(25.0%)	6	NA	NA
WP_173111944.1|723068_723941_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	37.6	1.2e-36
WP_114539404.1|724260_725427_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	30.2	9.9e-42
WP_173111947.1|725667_726630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173115100.1|726808_727483_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173115103.1|727744_728491_+	ATP-grasp domain-containing protein	NA	A0A1Y0T0A4	Pseudomonas_phage	32.5	7.6e-19
WP_139913199.1|728804_730118_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	8.6e-26
>prophage 47
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	734891	741236	2908404	transposase	Erysipelothrix_phage(66.67%)	3	NA	NA
WP_173111963.1|734891_737909_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	39.1	2.0e-179
WP_173111966.1|737911_739780_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.0	1.2e-97
WP_173111316.1|739943_741236_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
>prophage 48
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	745366	748618	2908404		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_173111982.1|745366_748618_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	43.2	1.7e-240
>prophage 49
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	755789	757496	2908404		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_114549670.1|755789_757496_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.8	9.1e-36
>prophage 50
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	772739	775442	2908404		Lactobacillus_phage(50.0%)	3	NA	NA
WP_114539374.1|772739_774407_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	25.0	5.3e-20
WP_114539373.1|774619_775183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114539522.1|775253_775442_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	45.6	1.1e-06
>prophage 51
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	780924	781452	2908404		Klosneuvirus(100.0%)	1	NA	NA
WP_114539366.1|780924_781452_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.0	1.1e-21
>prophage 52
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	795640	797353	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173112038.1|795640_797353_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	28.3	1.6e-16
>prophage 53
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	812786	814427	2908404		Tupanvirus(100.0%)	1	NA	NA
WP_173112066.1|812786_814427_+	hypothetical protein	NA	A0A2K9L0Z8	Tupanvirus	22.4	1.9e-06
>prophage 54
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	821674	829507	2908404		Bacillus_phage(33.33%)	4	NA	NA
WP_173112084.1|821674_823459_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	2.3e-29
WP_173112087.1|823564_824041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173112091.1|824268_827607_+	SNF2 helicase associated domain-containing protein	NA	C7U0G1	Ostreococcus_tauri_virus	30.5	3.5e-39
WP_173112094.1|827914_829507_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	24.3	4.5e-21
>prophage 55
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	833057	834620	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_114539557.1|833057_834620_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	4.6e-26
>prophage 56
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	840456	842133	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173112109.1|840456_842133_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	24.2	9.0e-20
>prophage 57
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	845727	850750	2908404		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_173112116.1|845727_848406_-	DUF3516 domain-containing protein	NA	M1HBX1	Acanthocystis_turfacea_Chlorella_virus	35.5	6.6e-49
WP_173112119.1|848636_849986_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_114548880.1|849964_850750_-	DNA/RNA nuclease SfsA	NA	A0A127AYZ0	Bacillus_phage	37.9	5.0e-37
>prophage 58
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	860384	860960	2908404		Escherichia_phage(100.0%)	1	NA	NA
WP_114548874.1|860384_860960_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	47.0	3.1e-44
>prophage 59
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	879711	895270	2908404	holin,protease,tRNA	Bodo_saltans_virus(16.67%)	12	NA	NA
WP_114539589.1|879711_880548_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.8	4.5e-20
WP_114539590.1|880556_881297_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_114539591.1|881418_882309_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_114539592.1|882328_882844_-	ferritin	NA	NA	NA	NA	NA
WP_173112139.1|883094_886289_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	37.3	1.1e-31
WP_022740483.1|886598_886970_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_173112142.1|887014_888502_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	40.9	1.8e-75
WP_114548810.1|888561_889686_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_173112145.1|889678_890425_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_114548831.1|890652_891201_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.7	4.4e-16
WP_173115115.1|891273_893565_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QNJ1	Ostreococcus_lucimarinus_virus	48.0	2.5e-105
WP_173112148.1|893956_895270_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	33.6	2.0e-22
>prophage 60
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	898713	899409	2908404		Bacillus_phage(100.0%)	1	NA	NA
WP_022740466.1|898713_899409_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	1.0e-38
>prophage 61
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	903002	916411	2908404	tRNA	Enterococcus_phage(25.0%)	9	NA	NA
WP_173112162.1|903002_903866_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	30.1	1.2e-23
WP_173112165.1|903978_905418_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173115121.1|905457_907155_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	22.5	5.9e-11
WP_114548801.1|907505_908324_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_173112168.1|908427_908940_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_173112171.1|909045_911517_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.9e-60
WP_114548799.1|911668_912034_-	NifB/NifX family molybdenum-iron cluster-binding protein	NA	NA	NA	NA	NA
WP_173112174.1|912528_914316_+	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_173112189.1|914332_916411_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.3	1.1e-22
>prophage 62
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	919946	927045	2908404		Escherichia_phage(50.0%)	6	NA	NA
WP_114539616.1|919946_920756_+	response regulator	NA	W8CYM9	Bacillus_phage	30.4	7.7e-25
WP_173112195.1|920838_921924_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_173115127.1|921947_922454_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173112198.1|922356_923304_+	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	26.1	4.3e-19
WP_173112201.1|923959_926413_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	26.1	2.2e-43
WP_114539621.1|926415_927045_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	33.7	3.3e-23
>prophage 63
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	938881	944165	2908404		uncultured_virus(50.0%)	5	NA	NA
WP_173112228.1|938881_939583_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	33.3	4.5e-05
WP_022740431.1|939830_940118_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.3	2.8e-14
WP_022740430.1|940167_941802_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	52.7	1.7e-148
WP_022740429.1|942174_942753_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_114549682.1|942749_944165_+	purine permease	NA	Q9KX94	Enterobacteria_phage	29.3	4.3e-23
>prophage 64
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	968766	970059	2908404		Streptococcus_phage(100.0%)	1	NA	NA
WP_114539655.1|968766_970059_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.9	2.0e-152
>prophage 65
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	973926	979564	2908404		Bacillus_phage(50.0%)	4	NA	NA
WP_157011953.1|973926_975723_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.9	1.3e-53
WP_114539675.1|975917_977171_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_173112241.1|977272_977884_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_173112244.1|978088_979564_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.8	2.0e-31
>prophage 66
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	982810	1008923	2908404	tRNA	Tupanvirus(16.67%)	20	NA	NA
WP_173112250.1|982810_984412_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.6	9.7e-64
WP_114539663.1|984784_985369_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016309287.1|985372_985591_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_173112265.1|986100_986523_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_173112268.1|986535_989046_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.6	9.2e-93
WP_114539666.1|989345_989861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173112271.1|989973_991350_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	33.6	3.2e-23
WP_022740387.1|991438_992404_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.8	1.8e-44
WP_114539677.1|992586_993147_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_114539668.1|993285_994698_+	MFS transporter	NA	NA	NA	NA	NA
WP_173112274.1|995169_997071_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.9	4.4e-39
WP_114540585.1|997070_997688_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.1	3.0e-21
WP_173112277.1|998004_998430_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_173112280.1|998433_999219_+	radical SAM protein	NA	S4TZT1	uncultured_phage	38.5	7.2e-28
WP_114540588.1|999239_999929_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1U9WRB5	Streptococcus_virus	52.0	6.0e-55
WP_173115136.1|1000367_1000952_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.1	2.6e-51
WP_173112283.1|1001123_1004465_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1V0SBK0	Catovirus	31.7	6.6e-30
WP_022740376.1|1004513_1006898_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.6	5.4e-10
WP_173112286.1|1007082_1007757_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_173112289.1|1007867_1008923_+	inorganic phosphate transporter	NA	V5LQA0	Emiliania_huxleyi_virus	25.9	1.2e-09
>prophage 67
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1022991	1025406	2908404		Bacillus_phage(100.0%)	1	NA	NA
WP_114548614.1|1022991_1025406_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	40.8	2.0e-129
>prophage 68
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1037366	1039484	2908404		Streptococcus_phage(100.0%)	1	NA	NA
WP_114548610.1|1037366_1039484_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	8.9e-65
>prophage 69
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1050882	1051584	2908404		Planktothrix_phage(100.0%)	1	NA	NA
WP_114539963.1|1050882_1051584_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	7.8e-34
>prophage 70
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1054934	1060392	2908404	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_173112322.1|1054934_1055549_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.1	3.0e-29
WP_173112325.1|1055548_1055923_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_173112328.1|1056915_1058262_+	trigger factor	NA	NA	NA	NA	NA
WP_173112331.1|1058361_1060392_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	37.7	4.0e-46
>prophage 71
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1073012	1074701	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173112363.1|1073012_1074701_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.1	1.0e-18
>prophage 72
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1095621	1110304	2908404		Escherichia_phage(42.86%)	12	NA	NA
WP_157012260.1|1095621_1096197_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	48.0	5.4e-41
WP_157012258.1|1096316_1098047_+	DUF3365 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.1	1.6e-16
WP_173112383.1|1098027_1098744_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	7.7e-29
WP_173112386.1|1099158_1100535_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_157012252.1|1100559_1101273_-	ferric reductase-like transmembrane domain-containing protein	NA	NA	NA	NA	NA
WP_173112389.1|1101644_1104299_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	29.3	1.7e-73
WP_157012248.1|1104309_1104936_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	49.0	4.2e-55
WP_157012246.1|1105170_1105935_+	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_157012245.1|1105962_1106841_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_157012244.1|1106909_1107296_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157012243.1|1107318_1108278_+	SPFH domain-containing protein	NA	A0A2P1EMF1	Moumouvirus	26.1	6.1e-21
WP_173112392.1|1108423_1110304_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	29.0	6.5e-27
>prophage 73
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1117269	1121773	2908404		Clostridioides_phage(33.33%)	5	NA	NA
WP_114539935.1|1117269_1118439_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.0	9.7e-13
WP_114539934.1|1119198_1120401_+	elongation factor Tu	NA	A0A2H4UVR3	Bodo_saltans_virus	24.6	2.0e-13
WP_022740305.1|1120516_1120666_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_173112406.1|1120837_1121239_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_041714608.1|1121242_1121773_+	transcription termination/antitermination protein NusG	NA	A0A068C9G5	Rhizobium_phage	25.3	3.6e-07
>prophage 74
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1127100	1128714	2908404		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_173112418.1|1127100_1128714_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.3	4.7e-143
>prophage 75
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1133529	1133859	2908404		Burkholderia_phage(100.0%)	1	NA	NA
WP_114539927.1|1133529_1133859_+	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	38.0	9.0e-17
>prophage 76
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1137284	1138298	2908404		Brevibacillus_phage(100.0%)	1	NA	NA
WP_173112427.1|1137284_1138298_-	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	25.2	6.6e-26
>prophage 77
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1171728	1173255	2908404		unidentified_phage(100.0%)	1	NA	NA
WP_173112488.1|1171728_1173255_-	HD domain-containing protein	NA	H7BUW3	unidentified_phage	40.5	4.6e-79
>prophage 78
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1180003	1180462	2908404	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_114549764.1|1180003_1180462_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	34.7	1.3e-16
>prophage 79
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1194402	1202259	2908404		Staphylococcus_phage(60.0%)	7	NA	NA
WP_157012980.1|1194402_1196175_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	23.7	2.5e-12
WP_173112500.1|1196874_1198032_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157012968.1|1198040_1198718_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_114540388.1|1198724_1199192_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	56.3	2.1e-43
WP_114540387.1|1199240_1200476_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	1.8e-102
WP_173112503.1|1200490_1201150_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.0	4.9e-38
WP_173115164.1|1201131_1202259_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	35.9	1.0e-43
>prophage 80
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1205823	1211472	2908404		Bacillus_phage(25.0%)	7	NA	NA
WP_114540380.1|1205823_1206912_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	22.6	2.8e-06
WP_157012963.1|1206921_1207335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016309120.1|1207459_1207663_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.5	2.1e-16
WP_157012978.1|1207729_1208626_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_173112512.1|1208737_1209424_+	FAD-dependent thymidylate synthase	NA	A0A125SJ60	Acidianus_tailed_spindle_virus	43.8	4.2e-40
WP_157012961.1|1209439_1210534_+	DUF1385 domain-containing protein	NA	NA	NA	NA	NA
WP_173115170.1|1210749_1211472_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	1.5e-32
>prophage 81
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1219792	1222312	2908404		Indivirus(100.0%)	1	NA	NA
WP_173112536.1|1219792_1222312_+	DNA topoisomerase I	NA	A0A1V0SCS0	Indivirus	24.3	1.3e-25
>prophage 82
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1225703	1231564	2908404		Streptococcus_phage(50.0%)	5	NA	NA
WP_173112542.1|1225703_1226450_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	45.0	1.4e-33
WP_173112545.1|1226442_1227600_+	DNA polymerase III subunit delta	NA	B2ZY37	Ralstonia_phage	26.9	5.7e-05
WP_173112548.1|1227577_1229152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173112551.1|1229167_1230622_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.4	1.5e-100
WP_173112555.1|1230634_1231564_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.9	2.7e-10
>prophage 83
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1247341	1249346	2908404		Cassava_brown_streak_virus(50.0%)	3	NA	NA
WP_173112582.1|1247341_1247968_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A1K0ISQ7	Cassava_brown_streak_virus	30.2	6.6e-08
WP_173112585.1|1248103_1248487_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173115193.1|1248698_1249346_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	42.7	1.1e-21
>prophage 84
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1262188	1266171	2908404		Synechococcus_phage(50.0%)	3	NA	NA
WP_022740185.1|1262188_1262875_+	transaldolase family protein	NA	A0A0E3FJJ0	Synechococcus_phage	46.4	3.4e-42
WP_173112623.1|1262871_1264887_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_173112626.1|1264920_1266171_+	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	25.1	6.5e-07
>prophage 85
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1277932	1281252	2908404		Bacillus_phage(100.0%)	2	NA	NA
WP_161127779.1|1277932_1278607_+	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	35.0	6.6e-14
WP_173112638.1|1278624_1281252_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	28.6	1.7e-49
>prophage 86
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1286378	1286861	2908404		Geobacillus_virus(100.0%)	1	NA	NA
WP_114539997.1|1286378_1286861_+	DUF3990 domain-containing protein	NA	A0A0H3UZB3	Geobacillus_virus	30.8	1.3e-08
>prophage 87
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1290980	1293413	2908404		Streptococcus_phage(100.0%)	2	NA	NA
WP_114540001.1|1290980_1292114_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.0	6.4e-62
WP_173112653.1|1292123_1293413_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.1	7.3e-86
>prophage 88
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1308404	1315542	2908404		Tupanvirus(33.33%)	6	NA	NA
WP_114540012.1|1308404_1309238_+	transketolase	NA	A0A2K9L6P9	Tupanvirus	32.3	1.0e-32
WP_173112662.1|1309248_1310226_+	transketolase family protein	NA	NA	NA	NA	NA
WP_041715194.1|1310425_1311160_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.4	5.7e-35
WP_022740139.1|1311152_1312067_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173112665.1|1312170_1313484_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_173112668.1|1313541_1315542_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.5	1.4e-56
>prophage 89
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1325657	1327073	2908404		uncultured_phage(100.0%)	1	NA	NA
WP_022740128.1|1325657_1327073_+	signal recognition particle protein	NA	D6PHS7	uncultured_phage	30.3	3.3e-07
>prophage 90
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1342473	1345191	2908404		Vibrio_phage(100.0%)	1	NA	NA
WP_161128072.1|1342473_1345191_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	36.0	3.4e-77
>prophage 91
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1362098	1365814	2908404		Bacillus_phage(100.0%)	2	NA	NA
WP_161128069.1|1362098_1363910_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.3	5.5e-39
WP_173115203.1|1364017_1365814_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	5.6e-52
>prophage 92
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1400332	1401601	2908404		Staphylococcus_phage(100.0%)	1	NA	NA
WP_114540531.1|1400332_1401601_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.3	4.6e-117
>prophage 93
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1419598	1426977	2908404		Escherichia_phage(40.0%)	5	NA	NA
WP_173112788.1|1419598_1422226_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	35.8	2.3e-134
WP_173112790.1|1422237_1422855_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	43.8	2.8e-43
WP_173112791.1|1422999_1424808_+	DUF3365 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	31.7	5.2e-21
WP_173112793.1|1424800_1425511_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.3	1.5e-29
WP_114540282.1|1425798_1426977_+	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	38.4	2.4e-43
>prophage 94
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1442351	1456132	2908404	protease,tRNA	Bacillus_virus(28.57%)	11	NA	NA
WP_114540283.1|1442351_1442990_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-50
WP_161127849.1|1442996_1444394_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	50.5	7.6e-113
WP_173112805.1|1444505_1447181_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	1.1e-149
WP_117284824.1|1447248_1447752_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_173112807.1|1447917_1449837_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.2	9.1e-125
WP_173112809.1|1449991_1450318_+	DUF997 family protein	NA	NA	NA	NA	NA
WP_173112810.1|1450310_1451795_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_173115212.1|1451801_1452785_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	41.4	1.7e-58
WP_173112812.1|1452968_1453277_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	50.6	1.5e-18
WP_173112815.1|1453570_1454959_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_173115215.1|1455073_1456132_+	peptide chain release factor 1	NA	A0A1C9EHI2	Mycobacterium_phage	45.8	3.0e-05
>prophage 95
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1462306	1464280	2908404		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_173115218.1|1462306_1464280_+	biosynthetic-type acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.5	2.4e-64
>prophage 96
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1468088	1479444	2908404	tRNA	Salmonella_phage(20.0%)	10	NA	NA
WP_173112845.1|1468088_1468568_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.7	5.3e-42
WP_173112848.1|1468782_1469517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173112851.1|1469540_1469825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173112854.1|1469901_1471125_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_173112857.1|1471239_1473105_+	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	32.1	7.4e-31
WP_114540643.1|1473267_1473810_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.7	6.3e-15
WP_173112860.1|1473811_1474750_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.1	8.3e-07
WP_173112863.1|1474742_1476758_+	rRNA methyltransferase	NA	NA	NA	NA	NA
WP_173112866.1|1476949_1477534_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173112869.1|1477653_1479444_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	29.9	3.6e-59
>prophage 97
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1483897	1489442	2908404		Staphylococcus_phage(50.0%)	5	NA	NA
WP_173112878.1|1483897_1485571_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.5	6.4e-66
WP_114539017.1|1485993_1486707_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_161127867.1|1486902_1487439_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_157011658.1|1487896_1488493_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_022739965.1|1488497_1489442_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	35.2	5.6e-35
>prophage 98
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1492996	1494931	2908404		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_173112890.1|1492996_1494001_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.7	2.1e-11
WP_173115224.1|1494202_1494931_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	3.5e-13
>prophage 99
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1501452	1502784	2908404		Halovirus(100.0%)	1	NA	NA
WP_173115242.1|1501452_1502784_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	2.0e-46
>prophage 100
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1509092	1509659	2908404		Abalone_herpesvirus(100.0%)	1	NA	NA
WP_173112925.1|1509092_1509659_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	39.0	4.1e-25
>prophage 101
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1517753	1519559	2908404		Streptococcus_phage(100.0%)	1	NA	NA
WP_173112944.1|1517753_1519559_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.8	3.2e-23
>prophage 102
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1524278	1528875	2908404		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_114539046.1|1524278_1525427_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.7	5.4e-24
WP_173112952.1|1525438_1526260_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_173112955.1|1526252_1527491_+	MiaB/RimO family radical SAM methylthiotransferase	NA	NA	NA	NA	NA
WP_173112959.1|1527915_1528875_+	PhoH family protein	NA	A0A1L2C8V4	Pseudomonas_phage	45.8	2.3e-44
>prophage 103
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1541188	1543765	2908404		Mycobacterium_phage(100.0%)	1	NA	NA
WP_173112980.1|1541188_1543765_+	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	48.6	2.0e-82
>prophage 104
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1546835	1549310	2908404		Pseudomonas_phage(50.0%)	2	NA	NA
WP_157011620.1|1546835_1548014_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	B5TK85	Pseudomonas_phage	43.9	2.9e-17
WP_022739919.1|1548254_1549310_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	9.1e-111
>prophage 105
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1553042	1553348	2908404		Streptomyces_phage(100.0%)	1	NA	NA
WP_173115254.1|1553042_1553348_+	stage V sporulation protein S	NA	A0A1J0GVV0	Streptomyces_phage	46.4	9.3e-08
>prophage 106
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1558248	1560067	2908404		Faecalibacterium_phage(50.0%)	3	NA	NA
WP_022739910.1|1558248_1558887_-	transcriptional repressor LexA	NA	A0A2K9V3G4	Faecalibacterium_phage	37.4	5.3e-13
WP_114539067.1|1559182_1559629_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_157011607.1|1559632_1560067_+	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	52.1	2.9e-31
>prophage 107
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1563721	1565035	2908404	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_139913199.1|1563721_1565035_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	8.6e-26
>prophage 108
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1576454	1577951	2908404		Erythrobacter_phage(100.0%)	1	NA	NA
WP_173115257.1|1576454_1577951_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	29.8	7.8e-15
>prophage 109
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1591263	1592886	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173113060.1|1591263_1592886_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	23.8	4.8e-10
>prophage 110
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1602894	1605741	2908404	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_114539177.1|1602894_1605741_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.8	3.6e-93
>prophage 111
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1610093	1611323	2908404		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_114539098.1|1610093_1611323_-	UDP-galactopyranose mutase	NA	A0A0F6TGN8	Sinorhizobium_phage	32.7	2.8e-50
>prophage 112
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1618457	1619840	2908404		Gordonia_phage(100.0%)	1	NA	NA
WP_114548403.1|1618457_1619840_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.8	2.5e-31
>prophage 113
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1628446	1633735	2908404	integrase	Bifidobacterium_phage(33.33%)	6	1618447:1618461	1640078:1640092
1618447:1618461	attL	TGCGCGTATCGTCAG	NA	NA	NA	NA
WP_114539109.1|1628446_1629214_+	DUF3800 domain-containing protein	NA	I3NLD4	Bifidobacterium_phage	51.9	1.5e-62
WP_114539110.1|1629217_1629784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114548386.1|1630091_1630559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114539112.1|1630716_1631271_+|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	29.4	4.2e-14
WP_114539113.1|1631522_1631987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173113088.1|1632826_1633735_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	35.7	3.5e-26
1640078:1640092	attR	TGCGCGTATCGTCAG	NA	NA	NA	NA
>prophage 114
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1642479	1644597	2908404		Streptococcus_phage(50.0%)	2	NA	NA
WP_114539182.1|1642479_1643628_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	37.3	8.0e-36
WP_114539183.1|1643640_1644597_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	37.2	9.7e-11
>prophage 115
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1651241	1655611	2908404		Bacillus_virus(50.0%)	3	NA	NA
WP_173113099.1|1651241_1652249_-	DHH family phosphoesterase	NA	G3MA01	Bacillus_virus	26.3	1.4e-15
WP_022739824.1|1652253_1652643_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_173113102.1|1652875_1655611_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	22.5	3.5e-21
>prophage 116
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1660718	1661177	2908404	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_114549764.1|1660718_1661177_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	34.7	1.3e-16
>prophage 117
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1664250	1671277	2908404		Catovirus(66.67%)	4	NA	NA
WP_173113117.1|1664250_1666122_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	34.2	2.6e-76
WP_022739804.1|1666591_1667470_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_173113120.1|1667852_1669478_+	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.7	6.7e-20
WP_173113123.1|1669642_1671277_+	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.9	1.0e-20
>prophage 118
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1678714	1679281	2908404		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173115283.1|1678714_1679281_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	1.5e-27
>prophage 119
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1686827	1699719	2908404		Streptococcus_phage(50.0%)	9	NA	NA
WP_173113150.1|1686827_1688531_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	32.2	1.6e-35
WP_173113153.1|1688717_1689296_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_173113156.1|1689425_1690946_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_173113159.1|1691109_1692687_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.3	2.3e-33
WP_173113162.1|1692771_1693854_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	51.9	1.6e-102
WP_173113165.1|1694234_1694489_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_117284795.1|1694647_1695424_+	N(G),N(G)-dimethylarginine dimethylaminohydrolase	NA	NA	NA	NA	NA
WP_173113168.1|1695533_1695839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173113170.1|1695999_1699719_-	UvrD-helicase domain-containing protein	NA	A0A068EQC7	Bacillus_phage	25.7	8.1e-13
>prophage 120
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1707000	1708368	2908404		Bacillus_phage(100.0%)	1	NA	NA
WP_173113179.1|1707000_1708368_-	DNA repair protein	NA	O64031	Bacillus_phage	27.9	3.5e-38
>prophage 121
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1711741	1717694	2908404		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_173113189.1|1711741_1714660_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	52.4	2.8e-287
WP_173113192.1|1714826_1716146_-	MFS transporter	NA	NA	NA	NA	NA
WP_173115286.1|1716827_1717694_-	tyrosine recombinase	NA	A0A0B5GXV1	Mycobacterium_phage	29.6	4.4e-18
>prophage 122
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1722348	1723296	2908404		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_173113201.1|1722348_1723296_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	34.4	2.7e-13
>prophage 123
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1728657	1729599	2908404		Lactococcus_phage(100.0%)	1	NA	NA
WP_173113204.1|1728657_1729599_-	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	48.7	2.6e-69
>prophage 124
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1740967	1742548	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173113216.1|1740967_1742548_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	29.0	6.0e-42
>prophage 125
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1748370	1753670	2908404		Anguillid_herpesvirus(25.0%)	5	NA	NA
WP_022739733.1|1748370_1748775_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.0	6.1e-23
WP_173113234.1|1748865_1750251_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_114549649.1|1750352_1750886_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.0	1.1e-19
WP_114549653.1|1750985_1752275_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.8	6.0e-32
WP_114549650.1|1752668_1753670_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.9	2.3e-10
>prophage 126
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1757063	1760520	2908404		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	5	NA	NA
WP_114549525.1|1757063_1758581_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.3	3.9e-54
WP_114539740.1|1758880_1759288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114539739.1|1759363_1759720_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_022739722.1|1759750_1759948_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_022739721.1|1759947_1760520_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.1	2.0e-11
>prophage 127
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1765727	1766504	2908404		Planktothrix_phage(100.0%)	1	NA	NA
WP_173113243.1|1765727_1766504_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.8	1.3e-13
>prophage 128
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1772327	1773584	2908404		Pandoravirus(100.0%)	1	NA	NA
WP_114549531.1|1772327_1773584_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	36.3	3.1e-65
>prophage 129
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1781792	1785773	2908404		Escherichia_phage(100.0%)	3	NA	NA
WP_173113261.1|1781792_1782485_-	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	25.4	1.0e-06
WP_114549541.1|1782497_1783121_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_114549542.1|1783124_1785773_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	28.9	9.4e-80
>prophage 130
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1792166	1793039	2908404		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_173113276.1|1792166_1793039_-	ribonuclease III	NA	M1I1B4	Paramecium_bursaria_Chlorella_virus	35.4	7.2e-21
>prophage 131
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1810094	1812653	2908404		Hokovirus(100.0%)	1	NA	NA
WP_173113307.1|1810094_1812653_-	response regulator	NA	A0A1V0SGR3	Hokovirus	24.1	8.4e-09
>prophage 132
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1833478	1842052	2908404		Ectocarpus_siliculosus_virus(33.33%)	7	NA	NA
WP_173113368.1|1833478_1835743_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.1	1.3e-32
WP_161959527.1|1835887_1836868_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_114549693.1|1837056_1837455_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_173113373.1|1837458_1838310_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_114549691.1|1838320_1839145_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	40.6	6.1e-46
WP_173113376.1|1839435_1840263_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_173113380.1|1841260_1842052_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	32.8	6.8e-10
>prophage 133
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1845219	1847412	2908404		Tupanvirus(100.0%)	1	NA	NA
WP_173113393.1|1845219_1847412_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.6	1.2e-67
>prophage 134
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1855583	1856297	2908404	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_173113402.1|1855583_1856297_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	34.9	2.5e-19
>prophage 135
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1872301	1877784	2908404		Bacillus_phage(66.67%)	5	NA	NA
WP_173113431.1|1872301_1872817_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.0	1.7e-14
WP_114539678.1|1873024_1873294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173113434.1|1874217_1875390_-	ammonia-forming cytochrome c nitrite reductase subunit c552	NA	NA	NA	NA	NA
WP_173113437.1|1875610_1877071_+	DUF3365 domain-containing protein	NA	W8CYF6	Bacillus_phage	27.3	1.1e-18
WP_173113440.1|1877100_1877784_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.9	4.9e-41
>prophage 136
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1887658	1890109	2908404		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_173113465.1|1887658_1888855_-	agmatine deiminase family protein	NA	M1I9G6	Paramecium_bursaria_Chlorella_virus	42.5	1.3e-76
WP_173113467.1|1888969_1890109_-	hypothetical protein	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	30.6	1.5e-10
>prophage 137
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1902367	1905826	2908404		Streptomyces_phage(100.0%)	1	NA	NA
WP_173113496.1|1902367_1905826_-	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	37.0	5.5e-213
>prophage 138
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1915250	1922489	2908404		Bacillus_phage(33.33%)	6	NA	NA
WP_114549599.1|1915250_1915709_-	cytidine deaminase	NA	A7KUY9	Bacillus_phage	42.2	4.6e-27
WP_114540222.1|1915879_1916521_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_173115317.1|1916677_1917928_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	2.3e-100
WP_173113513.1|1917949_1918384_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_173113516.1|1918497_1919988_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_022739589.1|1920308_1922489_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	30.4	1.9e-22
>prophage 139
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1951097	1953821	2908404		Planktothrix_phage(50.0%)	3	NA	NA
WP_173113560.1|1951097_1951934_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.2	1.2e-17
WP_114540250.1|1951933_1952494_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_173115323.1|1953056_1953821_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	2.2e-05
>prophage 140
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1960099	1962796	2908404		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173113572.1|1960099_1962796_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.9	1.4e-30
>prophage 141
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1970053	1971199	2908404	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173113590.1|1970053_1971199_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	39.9	4.2e-77
>prophage 142
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1975922	1978646	2908404		Tupanvirus(100.0%)	1	NA	NA
WP_173113605.1|1975922_1978646_-	S8 family serine peptidase	NA	A0A2K9L570	Tupanvirus	33.6	1.5e-11
>prophage 143
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1984439	1991920	2908404		Staphylococcus_phage(33.33%)	5	NA	NA
WP_173113615.1|1984439_1987586_-	glucosaminidase domain-containing protein	NA	A0A1W6JQU5	Staphylococcus_phage	36.9	7.1e-26
WP_114539815.1|1987851_1988865_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	4.4e-78
WP_173113617.1|1988923_1990183_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_114539817.1|1990634_1990982_+	multidrug ABC transporter	NA	NA	NA	NA	NA
WP_173113620.1|1990999_1991920_+	glycosyltransferase family 2 protein	NA	B9UDL7	Salmonella_phage	26.6	5.6e-24
>prophage 144
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	1995735	1996629	2908404		Enterobacteria_phage(100.0%)	1	NA	NA
WP_173113632.1|1995735_1996629_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.3	1.7e-89
>prophage 145
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2000723	2005335	2908404		Pseudomonas_phage(66.67%)	4	NA	NA
WP_173113641.1|2000723_2002250_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	36.7	1.6e-60
WP_114539827.1|2002382_2002637_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_114539828.1|2002629_2003814_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.2	6.4e-20
WP_173113644.1|2003826_2005335_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.8	9.2e-32
>prophage 146
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2011120	2013635	2908404		Pacmanvirus(50.0%)	2	NA	NA
WP_114539832.1|2011120_2012179_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	30.9	1.2e-17
WP_173113659.1|2012282_2013635_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	36.2	2.4e-15
>prophage 147
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2034055	2036402	2908404		Catovirus(50.0%)	2	NA	NA
WP_173113700.1|2034055_2035144_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	9.3e-26
WP_173113703.1|2035175_2036402_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	26.2	7.8e-29
>prophage 148
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2040861	2041212	2908404	transposase	Corynebacterium_phage(100.0%)	1	NA	NA
WP_173113715.1|2040861_2041212_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	37.5	8.7e-10
>prophage 149
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2045702	2047016	2908404	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_139913199.1|2045702_2047016_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	8.6e-26
>prophage 150
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2050423	2051716	2908404	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_173111316.1|2050423_2051716_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
>prophage 151
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2061058	2062272	2908404		Burkholderia_phage(50.0%)	2	NA	NA
WP_173113757.1|2061058_2061985_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	34.4	6.3e-31
WP_114539861.1|2061981_2062272_-	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	48.4	2.0e-15
>prophage 152
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2065284	2084610	2908404		Clostridioides_phage(22.22%)	13	NA	NA
WP_173113766.1|2065284_2066034_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	2.0e-11
WP_173113769.1|2066023_2066851_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_173113772.1|2067072_2067360_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	43.0	4.0e-13
WP_173115338.1|2067352_2067655_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	46.2	2.5e-13
WP_173113775.1|2067871_2070784_-	DEAD/DEAH box helicase family protein	NA	A0A2D2W2K3	Stenotrophomonas_phage	29.4	4.9e-29
WP_173113778.1|2070871_2072017_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_173113781.1|2072033_2074301_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	50.5	3.5e-19
WP_173113784.1|2074623_2075199_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.0	5.1e-15
WP_173113787.1|2075490_2077626_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	38.5	2.0e-112
WP_114539871.1|2078035_2078572_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_173113790.1|2078801_2079824_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_173113793.1|2080023_2082594_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.9	8.1e-36
WP_022739495.1|2082762_2084610_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	39.5	5.0e-112
>prophage 153
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2087983	2089045	2908404	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_114549046.1|2087983_2089045_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.6	2.0e-28
>prophage 154
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2093508	2095152	2908404		Klosneuvirus(100.0%)	1	NA	NA
WP_173113802.1|2093508_2095152_-	polysaccharide deacetylase family protein	NA	A0A1V0SLN0	Klosneuvirus	24.6	1.7e-07
>prophage 155
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2099332	2101084	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173113808.1|2099332_2101084_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	30.3	4.4e-25
>prophage 156
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2111067	2114697	2908404		Moumouvirus(50.0%)	5	NA	NA
WP_173113817.1|2111067_2111997_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	29.7	1.1e-19
WP_173113820.1|2112049_2112478_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173113823.1|2112528_2113428_-	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_173113825.1|2113449_2114100_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_173113828.1|2114142_2114697_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	41.2	4.0e-33
>prophage 157
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2132108	2171302	2908404	lysis,transposase,integrase,tRNA	Escherichia_phage(20.0%)	34	2158997:2159013	2159988:2160004
WP_114540653.1|2132108_2132567_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.3e-17
WP_114540653.1|2132894_2133353_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	4.3e-17
WP_114516453.1|2133563_2134127_-	elongation factor P	NA	NA	NA	NA	NA
WP_114549229.1|2134241_2135762_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_114549228.1|2136019_2138506_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.5	6.2e-142
WP_114516450.1|2138516_2139143_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.3	7.7e-57
WP_114516449.1|2139145_2139739_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.3	2.1e-11
WP_173113858.1|2139850_2140594_+	ferric reductase-like transmembrane domain-containing protein	NA	NA	NA	NA	NA
WP_173113862.1|2140659_2141613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173113865.1|2141794_2142940_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_161127491.1|2143092_2143542_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_173113868.1|2143766_2144882_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_173113871.1|2144863_2145412_-	shikimate kinase	NA	NA	NA	NA	NA
WP_173113874.1|2145413_2146580_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.6	1.8e-43
WP_173113877.1|2146742_2148182_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	36.4	6.4e-83
WP_173111010.1|2148305_2149235_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_114540447.1|2149231_2149864_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_173113880.1|2149894_2151115_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_173113882.1|2151165_2151582_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_173113885.1|2151585_2152734_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.9	1.9e-29
WP_173113887.1|2152878_2154504_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_173113890.1|2154910_2155669_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173111231.1|2155833_2157063_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_114540650.1|2157131_2157857_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	42.1	3.6e-42
WP_114540649.1|2157853_2158069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173113893.1|2158183_2158882_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.7	2.1e-31
2158997:2159013	attL	CCTTCATCAGCGTGAGC	NA	NA	NA	NA
WP_173113896.1|2159050_2159977_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	46.9	1.4e-78
WP_173113899.1|2159973_2160573_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
2159988:2160004	attR	GCTCACGCTGATGAAGG	NA	NA	NA	NA
WP_173113902.1|2160574_2163085_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.2	8.3e-94
WP_161127506.1|2163333_2165970_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.4	1.3e-60
WP_173113905.1|2166036_2167470_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_173113907.1|2167491_2168382_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_173113910.1|2168638_2169952_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	46.0	1.7e-90
WP_173113913.1|2170489_2171302_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	44.9	6.0e-54
>prophage 158
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2181230	2185585	2908404		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_173113929.1|2181230_2182904_-	N-6 DNA methylase	NA	Q96719	Paramecium_bursaria_Chlorella_virus	27.3	1.6e-08
WP_114540300.1|2183031_2183223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173113933.1|2183297_2184065_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_173115350.1|2184076_2184793_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_173113936.1|2184835_2185585_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	9.9e-19
>prophage 159
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2202766	2204818	2908404		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_173115353.1|2202766_2204818_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.6	2.0e-69
>prophage 160
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2211892	2218664	2908404	tRNA	Hokovirus(25.0%)	5	NA	NA
WP_173113972.1|2211892_2213470_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	37.0	2.1e-82
WP_173113975.1|2213670_2216271_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.6	1.8e-38
WP_173113978.1|2216335_2216755_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_173113981.1|2216934_2218161_+	cysteine desulfurase NifS	NA	A0A1X7QGF3	Faustovirus	33.3	5.7e-32
WP_157012584.1|2218211_2218664_+	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	52.0	4.4e-30
>prophage 161
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2236019	2236994	2908404		Moumouvirus(100.0%)	1	NA	NA
WP_157012546.1|2236019_2236994_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	28.2	1.5e-19
>prophage 162
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2241053	2246515	2908404		Cronobacter_phage(33.33%)	3	NA	NA
WP_157012551.1|2241053_2241728_+	4Fe-4S cluster-binding domain-containing protein	NA	K4F9T1	Cronobacter_phage	29.1	2.9e-09
WP_173114008.1|2241732_2243622_+	AAA family ATPase	NA	A0A2L0V0F4	Agrobacterium_phage	34.4	3.5e-36
WP_173114011.1|2243611_2246515_+	protein kinase	NA	A7IWR3	Paramecium_bursaria_Chlorella_virus	27.4	6.8e-07
>prophage 163
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2251057	2254086	2908404		Escherichia_phage(100.0%)	2	NA	NA
WP_173114026.1|2251057_2251726_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	42.6	1.2e-47
WP_157012558.1|2251722_2254086_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	42.4	1.4e-156
>prophage 164
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2260830	2261838	2908404		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_157012563.1|2260830_2261838_-	ornithine carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	27.5	9.6e-17
>prophage 165
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2266257	2274806	2908404		Lactobacillus_phage(66.67%)	7	NA	NA
WP_173115362.1|2266257_2266956_+	LexA family transcriptional regulator	NA	E5DV74	Deep-sea_thermophilic_phage	28.0	1.8e-06
WP_157012567.1|2267125_2267437_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_157012568.1|2267660_2268131_+	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_157012569.1|2268387_2269479_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_157012570.1|2269604_2271245_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.4	7.5e-19
WP_157012571.1|2271405_2273019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157012572.1|2273123_2274806_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	36.6	1.3e-10
>prophage 166
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2280656	2285717	2908404		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173114043.1|2280656_2285717_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	42.5	2.2e-05
>prophage 167
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2298410	2309723	2908404		Moumouvirus(20.0%)	10	NA	NA
WP_173114060.1|2298410_2299427_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	27.5	1.6e-24
WP_173114063.1|2299399_2301259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173114066.1|2301277_2302045_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_114549147.1|2302044_2302899_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.7	3.0e-19
WP_114549148.1|2302895_2303735_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	7.4e-15
WP_114539259.1|2303768_2304377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114549149.1|2304952_2305738_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_114549150.1|2305925_2306996_+	putrescine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	33.5	4.4e-12
WP_157012593.1|2307059_2308535_+	amino acid permease	NA	NA	NA	NA	NA
WP_114549152.1|2308598_2309723_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	45.2	3.7e-94
>prophage 168
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2313700	2318793	2908404		Escherichia_phage(50.0%)	3	NA	NA
WP_173114069.1|2313700_2316157_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.8	3.1e-37
WP_114539267.1|2316420_2317578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114539268.1|2317860_2318793_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	24.4	4.0e-17
>prophage 169
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2325472	2332122	2908404		Pandoravirus(33.33%)	7	NA	NA
WP_173114084.1|2325472_2326891_-	protein kinase	NA	A0A291ATY9	Pandoravirus	40.5	3.9e-16
WP_114539275.1|2326901_2327321_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_114539276.1|2327422_2328142_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_114539277.1|2328251_2329085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114549156.1|2329078_2329819_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.7	5.8e-11
WP_114539345.1|2330198_2330825_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_041714355.1|2331402_2332122_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.7	3.2e-30
>prophage 170
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2350703	2356597	2908404		Bodo_saltans_virus(50.0%)	5	NA	NA
WP_173114117.1|2350703_2352554_+	GNAT family N-acetyltransferase	NA	A0A2H4UV06	Bodo_saltans_virus	28.8	3.2e-50
WP_114548691.1|2352550_2353585_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_114548690.1|2353821_2354175_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_173115365.1|2354204_2354657_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_114548687.1|2354917_2356597_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.6	3.1e-44
>prophage 171
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2368767	2371476	2908404		Hokovirus(50.0%)	2	NA	NA
WP_173114138.1|2368767_2370423_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.8	4.6e-32
WP_117284660.1|2370543_2371476_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	53.2	1.0e-81
>prophage 172
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2391640	2395576	2908404	transposase	Enterobacteria_phage(50.0%)	5	NA	NA
WP_139913199.1|2391640_2392954_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	8.6e-26
WP_117285288.1|2392956_2393769_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_114548668.1|2394215_2394485_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_114548667.1|2394487_2394781_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_173114156.1|2394925_2395576_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	34.4	6.8e-08
>prophage 173
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2411297	2412656	2908404		Burkholderia_virus(100.0%)	1	NA	NA
WP_114548705.1|2411297_2412656_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.3	3.4e-57
>prophage 174
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2427537	2428830	2908404	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_173111316.1|2427537_2428830_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	37.6	2.6e-59
>prophage 175
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2433185	2435906	2908404	integrase	Clostridium_phage(66.67%)	4	2425009:2425024	2443796:2443811
2425009:2425024	attL	CTACGACAAAGATGCC	NA	NA	NA	NA
WP_173114188.1|2433185_2434265_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	42.5	3.8e-72
WP_173114191.1|2434268_2434637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173114194.1|2434638_2435712_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	37.5	6.3e-67
WP_173114197.1|2435708_2435906_-	HTH domain-containing protein	NA	A0A0S2MV91	Bacillus_phage	44.0	6.2e-05
2443796:2443811	attR	CTACGACAAAGATGCC	NA	NA	NA	NA
>prophage 176
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2441354	2443382	2908404		Streptococcus_phage(100.0%)	1	NA	NA
WP_173114206.1|2441354_2443382_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.7	9.4e-88
>prophage 177
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2448291	2451572	2908404		Escherichia_phage(100.0%)	2	NA	NA
WP_114539431.1|2448291_2448873_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	47.6	1.5e-46
WP_114539432.1|2448875_2451572_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	27.7	1.6e-74
>prophage 178
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2460609	2461926	2908404	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_173114222.1|2460609_2461926_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	6.0e-19
>prophage 179
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2470638	2475965	2908404		Escherichia_phage(33.33%)	3	NA	NA
WP_161127590.1|2470638_2473119_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	26.1	6.4e-38
WP_173115380.1|2473433_2474132_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.6	1.3e-28
WP_161127588.1|2474249_2475965_-	DUF3365 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.0	1.5e-17
>prophage 180
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2496328	2497255	2908404		Staphylococcus_phage(100.0%)	1	NA	NA
WP_173114310.1|2496328_2497255_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.5e-13
>prophage 181
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2524004	2524889	2908404		Staphylococcus_phage(100.0%)	1	NA	NA
WP_173114365.1|2524004_2524889_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	7.6e-18
>prophage 182
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2530787	2536625	2908404		Planktothrix_phage(33.33%)	5	NA	NA
WP_022740744.1|2530787_2531471_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	4.9e-33
WP_173114377.1|2531644_2532829_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_173114380.1|2532928_2533600_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_173114383.1|2534034_2535423_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase	NA	A0A1V0S7W6	Shearwaterpox_virus	33.7	4.1e-18
WP_173114386.1|2535707_2536625_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	46.2	2.8e-68
>prophage 183
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2539889	2550660	2908404	tRNA	Ectocarpus_siliculosus_virus(25.0%)	7	NA	NA
WP_173114402.1|2539889_2542640_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	35.1	1.7e-44
WP_173114405.1|2542818_2545392_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.4	7.5e-191
WP_173114408.1|2545753_2545987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022740782.1|2546070_2546655_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_173114411.1|2546959_2547949_-	TDT family transporter	NA	NA	NA	NA	NA
WP_173114414.1|2548159_2549041_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	9.9e-10
WP_117284263.1|2549142_2550660_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.2	3.5e-55
>prophage 184
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2559422	2563320	2908404		Acanthocystis_turfacea_chlorella_virus(50.0%)	3	NA	NA
WP_114540327.1|2559422_2560628_-	agmatine deiminase family protein	NA	A7KA66	Acanthocystis_turfacea_chlorella_virus	40.6	6.6e-81
WP_173114446.1|2560668_2562186_-	amino acid permease	NA	NA	NA	NA	NA
WP_173114449.1|2562249_2563320_-	putrescine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	34.0	6.8e-13
>prophage 185
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2574845	2580901	2908404		Enterobacteria_phage(66.67%)	6	NA	NA
WP_173114470.1|2574845_2575625_-	winged helix-turn-helix domain-containing protein	NA	A0A1V0SGX0	Hokovirus	48.5	3.0e-10
WP_173114473.1|2575780_2576413_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_114540358.1|2576405_2576828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173114476.1|2576880_2578110_-	MFS transporter	NA	NA	NA	NA	NA
WP_173114479.1|2578126_2579473_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	41.9	9.6e-73
WP_173114482.1|2579569_2580901_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.3	6.8e-63
>prophage 186
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2600260	2600563	2908404		Enterobacteria_phage(100.0%)	1	NA	NA
WP_173115389.1|2600260_2600563_-	hypothetical protein	NA	Q9KX94	Enterobacteria_phage	56.5	1.1e-05
>prophage 187
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2608041	2608902	2908404		Pseudomonas_phage(100.0%)	1	NA	NA
WP_173114551.1|2608041_2608902_+	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	29.8	2.1e-12
>prophage 188
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2629121	2630066	2908404		Staphylococcus_phage(100.0%)	1	NA	NA
WP_161128053.1|2629121_2630066_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	1.6e-29
>prophage 189
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2670902	2671649	2908404		Marinitoga_camini_virus(100.0%)	1	NA	NA
WP_173114620.1|2670902_2671649_-	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	37.0	1.3e-05
>prophage 190
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2690547	2698403	2908404	tRNA	uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_173114641.1|2690547_2691843_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	41.6	3.4e-83
WP_022741115.1|2692012_2692207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173114644.1|2692305_2694705_-	protein kinase	NA	A0A2I2L576	Orpheovirus	30.2	1.3e-06
WP_114540126.1|2695087_2695924_+	deoxyribonuclease IV	NA	NA	NA	NA	NA
WP_173114647.1|2696022_2696838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173114650.1|2696945_2698403_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.2	1.5e-34
>prophage 191
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2706875	2715570	2908404		Bacillus_phage(50.0%)	5	NA	NA
WP_173115405.1|2706875_2710718_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.3	2.1e-32
WP_114548582.1|2710878_2711610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114548581.1|2711733_2712615_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.5	9.2e-40
WP_173114667.1|2713221_2714784_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	7.6e-37
WP_173114670.1|2714859_2715570_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.3	2.1e-42
>prophage 192
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2720582	2721932	2908404		Gordonia_phage(100.0%)	1	NA	NA
WP_114540109.1|2720582_2721932_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.1	5.0e-21
>prophage 193
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2752749	2758470	2908404		Salmonella_phage(25.0%)	8	NA	NA
WP_173114719.1|2752749_2753766_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	27.2	2.7e-19
WP_173114722.1|2753762_2754221_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	33.3	1.2e-11
WP_022741206.1|2754394_2754670_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_173114725.1|2754755_2755319_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.1	5.3e-49
WP_114540089.1|2755434_2755914_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_173114740.1|2755929_2757084_-	MFS transporter	NA	NA	NA	NA	NA
WP_114540087.1|2757090_2757789_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_173114743.1|2757909_2758470_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	39.3	1.2e-32
>prophage 194
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2761607	2762393	2908404		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_173114749.1|2761607_2762393_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	40.5	1.3e-50
>prophage 195
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2767156	2769799	2908404		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_173114752.1|2767156_2769799_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.4	5.1e-126
>prophage 196
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2786163	2787588	2908404		Enterobacteria_phage(100.0%)	1	NA	NA
WP_161128466.1|2786163_2787588_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	37.0	2.4e-53
>prophage 197
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2792198	2796943	2908404		Bacillus_phage(33.33%)	4	NA	NA
WP_157012460.1|2792198_2793497_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	45.0	1.4e-12
WP_157012459.1|2793716_2795207_-	DUF2252 family protein	NA	NA	NA	NA	NA
WP_161128117.1|2795206_2795536_-	thioredoxin fold domain-containing protein	NA	A0A2P1EM49	Moumouvirus	35.1	4.5e-08
WP_157012457.1|2795686_2796943_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.4	1.3e-50
>prophage 198
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2815113	2823212	2908404	integrase	uncultured_Caudovirales_phage(33.33%)	6	2814377:2814396	2818119:2818138
2814377:2814396	attL	TTCGAGTAAATGGTCATTTA	NA	NA	NA	NA
WP_173114816.1|2815113_2816082_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.1	2.7e-32
WP_173114818.1|2816144_2816996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173114821.1|2816992_2817496_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_173114824.1|2817461_2818655_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
2818119:2818138	attR	TTCGAGTAAATGGTCATTTA	NA	NA	NA	NA
WP_173114827.1|2818638_2820147_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.4	5.8e-50
WP_173115427.1|2820155_2823212_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.1	2.6e-73
>prophage 199
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2833038	2834428	2908404		Leptospira_phage(50.0%)	2	NA	NA
WP_147270679.1|2833038_2833785_-	SOS response-associated peptidase family protein	NA	S5VY94	Leptospira_phage	31.5	1.9e-06
WP_114549432.1|2834062_2834428_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	43.8	2.2e-19
>prophage 200
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2851279	2852626	2908404		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_173114865.1|2851279_2852626_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	30.4	2.6e-62
>prophage 201
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2860983	2862915	2908404		Lactobacillus_phage(100.0%)	1	NA	NA
WP_173114882.1|2860983_2862915_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.6	3.4e-63
>prophage 202
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2871047	2873301	2908404		Bacillus_phage(50.0%)	2	NA	NA
WP_173114898.1|2871047_2871791_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.0	9.2e-33
WP_114538975.1|2871777_2873301_-	DUF3365 domain-containing protein	NA	A0A1X9VNV7	Mimivirus	27.2	9.4e-08
>prophage 203
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2878473	2881915	2908404		Klebsiella_phage(50.0%)	3	NA	NA
WP_114549351.1|2878473_2880078_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	5.7e-80
WP_114549352.1|2880236_2881049_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_173114902.1|2881045_2881915_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	28.7	1.7e-06
>prophage 204
NZ_AP022829	Adlercreutzia sp. 8CFCBH1	2908404	2894566	2898176	2908404		Wolbachia_phage(50.0%)	3	NA	NA
WP_114538954.1|2894566_2895424_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.5	5.0e-59
WP_114538953.1|2895734_2896751_+	DMT family transporter	NA	NA	NA	NA	NA
WP_173114928.1|2896751_2898176_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	27.3	1.6e-17
