The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049859	Erysipelothrix sp. HDW6A chromosome, complete genome	2043172	742287	777935	2043172	integrase,transposase	Streptococcus_phage(40.0%)	30	753238:753266	782638:782666
WP_166080675.1|742287_743441_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.8	2.8e-36
WP_166080765.1|743621_744881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166080766.1|745068_746925_+	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_166080767.1|747210_747693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166080029.1|747760_747949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166082059.1|748233_748812_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.3	2.1e-24
WP_166080768.1|748941_749991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166080769.1|750108_751734_+	hypothetical protein	NA	NA	NA	NA	NA
753238:753266	attL	TACTGTCCATATTTACAGTATAGTACCAA	NA	NA	NA	NA
WP_166080770.1|753358_753934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166080771.1|754279_754915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166080772.1|755188_758677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166080773.1|759197_759560_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	36.4	3.0e-05
WP_166080774.1|760159_761311_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	24.2	5.6e-13
WP_166080775.1|761600_763163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166080776.1|763304_763508_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	48.1	2.6e-06
WP_166080777.1|763556_763784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166080778.1|763787_764579_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.2	2.4e-23
WP_166080779.1|764727_765450_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_166082060.1|765479_765722_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166080780.1|765722_766082_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	40.2	2.0e-09
WP_166080781.1|766340_766625_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166080782.1|766712_766955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166080783.1|769805_770435_+	hypothetical protein	NA	A0A1X9I5T2	Streptococcus_phage	42.3	9.8e-20
WP_166080784.1|770597_770906_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166080785.1|770934_772014_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_166080786.1|772013_772424_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_166080787.1|772447_773785_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_166080789.1|773777_776039_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_166082061.1|776250_777249_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	48.5	4.8e-53
WP_166080790.1|777212_777935_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	39.3	1.9e-38
782638:782666	attR	TACTGTCCATATTTACAGTATAGTACCAA	NA	NA	NA	NA
>prophage 2
NZ_CP049859	Erysipelothrix sp. HDW6A chromosome, complete genome	2043172	1187984	1196314	2043172		uncultured_Mediterranean_phage(28.57%)	9	NA	NA
WP_166081194.1|1187984_1189430_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.0	7.8e-113
WP_166081195.1|1189506_1190727_+	insulinase family protein	NA	NA	NA	NA	NA
WP_166081196.1|1190719_1191973_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	24.5	4.1e-09
WP_166081198.1|1192039_1192339_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_166081199.1|1192397_1193267_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	54.5	7.1e-93
WP_166081200.1|1193266_1193716_+	dihydrofolate reductase	NA	A0A1S6L278	Vibrio_phage	32.1	8.9e-15
WP_166081201.1|1193721_1195020_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	52.1	6.8e-116
WP_166081202.1|1195038_1195767_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.4	3.8e-07
WP_166081203.1|1195768_1196314_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	4.8e-15
>prophage 3
NZ_CP049859	Erysipelothrix sp. HDW6A chromosome, complete genome	2043172	1541904	1551728	2043172	holin	Erysipelothrix_phage(33.33%)	9	NA	NA
WP_166081534.1|1541904_1543029_-	M23 family metallopeptidase	NA	A0A0A0RNJ7	Bacillus_phage	39.0	2.5e-10
WP_166081535.1|1543205_1543457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166081536.1|1543460_1544453_-	M23 family metallopeptidase	NA	D3W0F3	Lactococcus_phage	42.5	5.7e-06
WP_166081537.1|1544454_1544814_-|holin	phage holin	holin	A0A0H4TEZ1	Erysipelothrix_phage	54.4	6.4e-24
WP_166081538.1|1544810_1545053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166081539.1|1545068_1547150_-	hypothetical protein	NA	A0A2R4A1N8	Microbacterium_phage	30.5	6.3e-39
WP_166081540.1|1547150_1548764_-	hypothetical protein	NA	A0A0H4TFF7	Erysipelothrix_phage	32.5	2.5e-11
WP_166081541.1|1548763_1549132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166081542.1|1549145_1551728_-	tape measure protein	NA	A0A2H4JBH0	uncultured_Caudovirales_phage	33.3	4.3e-29
