The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022843	Halomonas hydrothermalis strain Slthf2	4120823	670831	721700	4120823	integrase,terminase,capsid,head,protease,portal,tRNA,tail	Halomonas_phage(29.27%)	69	685182:685196	700463:700477
WP_172419949.1|670831_672127_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_172419950.1|672212_673328_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_172419951.1|673336_674335_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172419952.1|674374_675109_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_125745623.1|675355_676540_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_172419953.1|676625_677051_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.3e-20
WP_125745625.1|677216_677543_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.3	6.9e-17
WP_172419954.1|677599_678766_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A142BZP5	Faustovirus	28.9	4.6e-31
WP_038481467.1|678797_679265_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_172419955.1|679341_680271_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_172419956.1|680430_681177_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_172419957.1|681319_682114_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_172419958.1|682229_683156_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.8	5.1e-41
WP_172419959.1|683234_685088_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	23.1	6.7e-08
685182:685196	attL	CGGGGTGGCTGGCAC	NA	NA	NA	NA
WP_009722127.1|685223_685550_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.0	3.3e-11
WP_172419960.1|685621_686758_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.7	1.4e-88
WP_172419961.1|686804_687836_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_172419962.1|688100_688958_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	28.3	8.4e-14
WP_172419963.1|688990_689317_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172419964.1|689318_689831_-	hypothetical protein	NA	A0A1J0GUW8	Halomonas_phage	42.0	7.4e-34
WP_172419965.1|691275_691863_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	47.4	1.3e-37
WP_172419966.1|691855_692146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419967.1|692142_693075_-	recombination-associated protein RdgC	NA	A0A1J0GUV6	Halomonas_phage	68.2	3.2e-107
WP_172419968.1|693076_693319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419969.1|693401_693719_-	hypothetical protein	NA	A0A2H4J2C6	uncultured_Caudovirales_phage	39.4	3.0e-09
WP_172419970.1|693729_694050_-	hypothetical protein	NA	A0A1J0GUV9	Halomonas_phage	45.1	1.9e-11
WP_172419971.1|694046_694334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419972.1|694330_694645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419973.1|694641_695073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419974.1|695237_695915_-	hypothetical protein	NA	U5P0T5	Shigella_phage	50.0	5.4e-32
WP_172419975.1|696026_696281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172419976.1|696312_696678_+	HNH endonuclease	NA	H6WG01	Cyanophage	42.2	1.6e-06
WP_172419977.1|696674_697697_+	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	63.8	2.5e-33
WP_172419978.1|697687_698419_+	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	47.5	3.7e-34
WP_172419979.1|698421_698748_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172419980.1|698731_699004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419981.1|698990_699269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419982.1|699621_699933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419983.1|699929_700190_+	hypothetical protein	NA	A0A1J0GUZ5	Halomonas_phage	72.1	1.0e-31
WP_172419984.1|700186_700705_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	46.2	2.7e-23
700463:700477	attR	CGGGGTGGCTGGCAC	NA	NA	NA	NA
WP_172419985.1|700785_701400_+	hypothetical protein	NA	A0A1J0GV17	Halomonas_phage	42.0	1.1e-28
WP_172419986.1|701409_702342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419987.1|702363_702555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172419988.1|702938_703421_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2K9VHF1	Pseudomonas_phage	51.2	2.8e-35
WP_172419989.1|703453_703771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419990.1|703767_704349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419991.1|704345_704522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419992.1|704521_704884_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	45.8	2.3e-21
WP_172419993.1|704991_705453_+|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	56.8	6.9e-31
WP_172419994.1|705456_707169_+|terminase	terminase large subunit	terminase	A0A1J0GUY5	Halomonas_phage	81.3	1.5e-280
WP_172419995.1|707165_708383_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	66.2	2.7e-159
WP_172419996.1|708360_708498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172419997.1|708494_709169_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	72.3	6.1e-84
WP_172419998.1|709158_710361_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	63.5	1.2e-143
WP_172419999.1|710440_710761_+	hypothetical protein	NA	A0A2D1GNQ9	Pseudomonas_phage	59.6	3.1e-06
WP_172420000.1|710782_711109_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	35.1	4.0e-09
WP_172420001.1|711115_711454_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	58.9	1.6e-32
WP_172420002.1|711443_711947_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	39.8	1.9e-26
WP_172420003.1|711950_712313_+	DUF3168 domain-containing protein	NA	A0A1J0GUW9	Halomonas_phage	53.4	2.1e-30
WP_172420004.1|712337_712823_+|tail	phage tail protein	tail	A0A1J0GUZ2	Halomonas_phage	54.4	2.2e-43
WP_172420005.1|712819_713284_+|tail	phage tail assembly chaperone family protein, TAC	tail	Q9MCA4	Pseudomonas_phage	51.3	3.1e-23
WP_172422506.1|713217_713472_+	hypothetical protein	NA	A0A1J0GUY0	Halomonas_phage	48.2	9.7e-19
WP_172420006.1|713640_714132_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.0	9.7e-23
WP_172420007.1|714455_715391_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	72.2	8.3e-31
WP_172420008.1|715520_715931_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	36.6	1.3e-12
WP_172420009.1|715992_718554_+	hypothetical protein	NA	A0A1J0GUY9	Halomonas_phage	33.3	4.0e-35
WP_172420010.1|718553_719048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172420011.1|719106_721206_+	hypothetical protein	NA	A0A0U4B0B2	Pseudomonas_phage	51.6	5.3e-09
WP_172420012.1|721202_721700_+	DUF1833 family protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	44.4	3.7e-30
>prophage 2
NZ_AP022843	Halomonas hydrothermalis strain Slthf2	4120823	1134976	1199001	4120823	integrase,tRNA,protease,transposase	Pseudomonas_phage(21.43%)	59	1176167:1176191	1199160:1199184
WP_125753484.1|1134976_1135300_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.0e-12
WP_172420273.1|1135438_1137715_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	4.2e-169
WP_007111068.1|1137906_1138125_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_172420274.1|1138264_1138999_-	arginyltransferase	NA	NA	NA	NA	NA
WP_172420275.1|1139077_1139830_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_172420276.1|1139948_1143446_+	DNA translocase FtsK 4TM domain-containing protein	NA	G1DAY1	Mycobacterium_virus	50.4	6.6e-89
WP_172420277.1|1143614_1144268_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_172420278.1|1144332_1145667_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.0	1.6e-64
WP_172420279.1|1145921_1146467_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_172420280.1|1146579_1147377_+	glutamate racemase	NA	NA	NA	NA	NA
WP_172420281.1|1147434_1148550_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A2K5B251	Erysipelothrix_phage	28.7	2.4e-13
WP_172420282.1|1148745_1153569_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_172420283.1|1153841_1154855_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_125746591.1|1154927_1155137_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_172420284.1|1155479_1157702_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_172420285.1|1157721_1158057_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_030070186.1|1158142_1158424_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_172420286.1|1158508_1159684_+	4-phosphoerythronate dehydrogenase PdxB	NA	NA	NA	NA	NA
WP_172420287.1|1159779_1160685_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_172420288.1|1160793_1162041_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_172420289.1|1162096_1163050_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_172420290.1|1163169_1163568_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_172420291.1|1164853_1165816_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-19
WP_172420292.1|1165812_1166586_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172420293.1|1166686_1167520_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A1S5R3L8	Pseudomonas_phage	34.1	1.9e-34
WP_125746608.1|1167567_1168128_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_172420294.1|1168133_1168652_+	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172420295.1|1168984_1169335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172420296.1|1170143_1170713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420297.1|1170709_1171831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420298.1|1171827_1173450_-	hypothetical protein	NA	A0A1B0Z1F4	Shewanella_phage	32.3	8.9e-49
WP_172420299.1|1173446_1173671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420300.1|1173667_1173859_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_172420301.1|1173947_1174790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420302.1|1174786_1176022_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	47.8	1.1e-91
1176167:1176191	attL	ACTCCCTCTCCGCCACAGAATATAG	NA	NA	NA	NA
WP_172420303.1|1176349_1176502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172420304.1|1176615_1176837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172422525.1|1177012_1178299_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_172420305.1|1179076_1180114_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_172420306.1|1180552_1181905_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_172420307.1|1182786_1184085_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_172420308.1|1184362_1184791_-	RidA family protein	NA	NA	NA	NA	NA
WP_172420309.1|1184905_1185868_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_172420310.1|1186075_1186705_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_172420311.1|1186802_1187936_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_172420312.1|1188073_1188400_+	asparaginase	NA	NA	NA	NA	NA
WP_172420313.1|1188445_1188667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172420314.1|1189319_1189691_+	RidA family protein	NA	NA	NA	NA	NA
WP_172420315.1|1190025_1190922_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_022519664.1|1191384_1191654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420316.1|1193323_1193614_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.4	1.3e-11
WP_022519766.1|1193665_1193956_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_172420317.1|1194174_1194312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420318.1|1194323_1194935_-	YqaJ viral recombinase family protein	NA	A0A1B0VMB3	Pseudomonas_phage	69.3	5.5e-76
WP_172422526.1|1194993_1195677_-	ERF family protein	NA	Q9MC70	Pseudomonas_phage	58.6	3.0e-62
WP_172420319.1|1195768_1195954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172420320.1|1196070_1196676_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	33.9	1.8e-15
WP_172420321.1|1197065_1197716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172420322.1|1197819_1199001_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KET4	Ralstonia_phage	48.2	3.1e-99
1199160:1199184	attR	ACTCCCTCTCCGCCACAGAATATAG	NA	NA	NA	NA
>prophage 3
NZ_AP022843	Halomonas hydrothermalis strain Slthf2	4120823	1748129	1755554	4120823		Planktothrix_phage(16.67%)	8	NA	NA
WP_172420691.1|1748129_1749173_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	4.7e-35
WP_172420692.1|1749634_1750261_+	riboflavin synthase subunit alpha	NA	A0A1V0SE20	Indivirus	34.9	1.5e-20
WP_172420693.1|1750458_1751757_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	40.6	9.3e-73
WP_172420694.1|1751791_1752337_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	5.3e-30
WP_125747484.1|1752345_1752825_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_172420695.1|1752826_1753510_+	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.1	7.8e-47
WP_038483772.1|1753607_1754237_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_172420696.1|1754324_1755554_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	38.8	1.6e-58
>prophage 4
NZ_AP022843	Halomonas hydrothermalis strain Slthf2	4120823	2565084	2572275	4120823		Escherichia_phage(33.33%)	6	NA	NA
WP_172421228.1|2565084_2566407_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.1	7.2e-81
WP_172421229.1|2566448_2566994_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.6	1.0e-52
WP_172421230.1|2567076_2567973_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	4.1e-104
WP_172421231.1|2568646_2569564_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	9.6e-24
WP_172421232.1|2570220_2571345_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.9	3.4e-95
WP_146945363.1|2571393_2572275_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.3	6.0e-07
>prophage 5
NZ_AP022843	Halomonas hydrothermalis strain Slthf2	4120823	3194084	3241199	4120823	tRNA,transposase	Escherichia_phage(33.33%)	40	NA	NA
WP_172422608.1|3194084_3195254_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	59.9	7.0e-128
WP_172421587.1|3195309_3195738_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	47.1	1.7e-23
WP_172421831.1|3196581_3197331_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_125751203.1|3197508_3198933_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_038477934.1|3198952_3199561_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_172421833.1|3199564_3199786_+	cbb3-type cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_125751209.1|3199782_3200712_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_172421835.1|3200926_3202363_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_125751215.1|3202370_3202895_+	FixH family protein	NA	NA	NA	NA	NA
WP_172421837.1|3202891_3205369_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.4	1.7e-78
WP_172421844.1|3205365_3205584_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_172421846.1|3205580_3206276_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_172421848.1|3206404_3207832_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_125751227.1|3207890_3208643_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_172422609.1|3208629_3209595_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	71.5	5.1e-108
WP_125753775.1|3209661_3210312_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_172421850.1|3210317_3212135_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_038477966.1|3212730_3212991_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_172421852.1|3212997_3214779_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_172421854.1|3214884_3215415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421856.1|3215510_3219458_+	PAS-domain containing protein	NA	A0A2K9L5I4	Tupanvirus	22.4	3.6e-11
WP_125751244.1|3219773_3220436_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_125751247.1|3220709_3222659_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.9	1.1e-88
WP_172421857.1|3222827_3223376_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_172421858.1|3223442_3223871_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	47.8	1.2e-24
WP_172421859.1|3223926_3225096_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	59.4	1.7e-126
WP_125751249.1|3225223_3225898_+	YecA family protein	NA	NA	NA	NA	NA
WP_172421860.1|3225916_3227038_-	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_172421861.1|3227065_3227785_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_172421862.1|3227781_3228486_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	37.7	9.0e-06
WP_125751262.1|3228595_3229249_-	adenylate kinase	NA	NA	NA	NA	NA
WP_172421863.1|3229498_3231547_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_125747015.1|3231605_3234278_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_172421864.1|3234697_3235264_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_172421865.1|3235347_3236202_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_172422610.1|3236207_3236735_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172421866.1|3236880_3237609_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_035565795.1|3237928_3239230_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_172421868.1|3239302_3239731_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_035565795.1|3239897_3241199_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
