The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	13189	74945	2722826	transposase	uncultured_virus(25.0%)	55	NA	NA
WP_173269087.1|13189_14713_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.0	4.1e-88
WP_173269090.1|14733_15090_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.0	5.5e-20
WP_173269093.1|15082_15382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173269095.1|15605_15956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173269097.1|15952_16282_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173269099.1|16299_17853_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.7	1.1e-128
WP_173269102.1|17957_18689_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_173269112.1|18691_20173_-	glucose-6-phosphate dehydrogenase	NA	A0A1D8KHJ5	Synechococcus_phage	40.0	3.3e-82
WP_173269114.1|20175_21633_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	32.2	5.1e-35
WP_173269115.1|22370_22901_+	DUF3455 domain-containing protein	NA	NA	NA	NA	NA
WP_173274192.1|23218_23779_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_173269117.1|23775_24510_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_173274193.1|24745_26077_+	ribonuclease J	NA	NA	NA	NA	NA
WP_173269119.1|26080_26812_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	37.4	4.0e-33
WP_173269121.1|26818_27448_-	DUF429 domain-containing protein	NA	NA	NA	NA	NA
WP_173269123.1|27447_28128_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_173269125.1|28241_29408_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_173274194.1|29502_30147_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_173269127.1|30268_30754_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173274195.1|31035_32688_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_173269129.1|32861_33323_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_173274196.1|33469_34846_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	41.7	3.2e-71
WP_173269131.1|35018_35804_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_173269133.1|35814_36744_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_173269135.1|37228_37828_+	nitroreductase	NA	NA	NA	NA	NA
WP_173269137.1|37942_38284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173269140.1|38309_39953_-	acetolactate synthase large subunit	NA	NA	NA	NA	NA
WP_173269142.1|40111_40735_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_173269144.1|40746_41922_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_173269146.1|41947_43960_-	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_173269148.1|44267_44912_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_173269150.1|45054_45774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173269152.1|46011_48828_-	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	27.8	2.7e-45
WP_173269154.1|49042_49993_+	homoserine kinase	NA	NA	NA	NA	NA
WP_173269156.1|49998_50547_+	Sua5/YciO/YrdC/YwlC family protein	NA	A0A291ATS8	Pandoravirus	31.0	4.7e-10
WP_173269159.1|50664_51501_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_173269161.1|51497_52256_-	DUF4197 domain-containing protein	NA	NA	NA	NA	NA
WP_173269163.1|52414_53356_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_173269165.1|53664_54327_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	9.4e-21
WP_173274197.1|54397_55402_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_173274198.1|55532_57098_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_173269167.1|57117_57486_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_173269169.1|57508_57856_-	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_173269171.1|57870_58140_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_173269173.1|58127_58631_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_173269175.1|58627_60205_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_173269177.1|60201_60600_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_173269179.1|60587_63395_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_173269181.1|64184_67346_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_173269183.1|67569_69771_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	39.4	2.1e-24
WP_173269185.1|70077_70671_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	42.0	2.4e-36
WP_173269187.1|70667_71354_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	61.4	7.3e-77
WP_173269189.1|71421_72583_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	37.3	3.1e-43
WP_173269191.1|72511_73468_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	51.1	2.1e-42
WP_173269099.1|73391_74945_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.7	1.1e-128
>prophage 3
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	700446	709811	2722826		Paramecium_bursaria_Chlorella_virus(33.33%)	8	NA	NA
WP_173270827.1|700446_702375_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	1.4e-120
WP_173270829.1|702404_703616_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.2	9.8e-109
WP_173274229.1|703645_704020_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_173270831.1|704016_705114_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.4	1.0e-35
WP_173270833.1|705178_706183_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	38.2	4.0e-23
WP_173270836.1|706420_707860_+	MOP flippase family protein	NA	NA	NA	NA	NA
WP_173270838.1|707868_708852_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.9	3.1e-12
WP_173270840.1|708890_709811_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.0	7.6e-13
>prophage 4
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	862955	922254	2722826	tRNA,transposase	Leptospira_phage(42.86%)	54	NA	NA
WP_173271114.1|862955_863474_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	41.7	6.4e-09
WP_173271116.1|863727_864303_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_173271118.1|864313_866389_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_173271120.1|866418_866997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271122.1|867472_868390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271124.1|868595_870488_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	33.8	7.6e-100
WP_173271126.1|870707_872117_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.8	7.5e-36
WP_173271128.1|872126_872678_-	heme NO-binding domain-containing protein	NA	NA	NA	NA	NA
WP_173271130.1|873039_873789_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_173271132.1|873793_874354_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_173271134.1|874350_875190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271136.1|875208_876102_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_173271138.1|876113_878696_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.3	3.8e-25
WP_173271140.1|879058_879253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271142.1|879352_880249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271144.1|880368_880608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271146.1|880650_882129_+	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_173271148.1|882153_882810_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_173271150.1|886213_887182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271152.1|887178_888702_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.5	2.4e-88
WP_173271154.1|888722_889079_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.2	9.5e-20
WP_173270778.1|889071_889371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271156.1|889450_889789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271158.1|889769_890390_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	37.6	6.5e-32
WP_173271160.1|890776_891010_-	carbon storage regulator CsrA	NA	I3PUZ0	Vibrio_phage	50.0	1.9e-05
WP_173271162.1|891251_893843_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.6	7.3e-85
WP_173271164.1|893969_894626_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_173271166.1|894657_895716_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.9	1.1e-119
WP_173271168.1|896046_896526_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	50.6	6.7e-29
WP_173271170.1|897169_899779_+	response regulator	NA	NA	NA	NA	NA
WP_173271172.1|899782_900985_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_173271174.1|901011_901260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271176.1|901323_901623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271178.1|901615_901972_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.1	3.0e-18
WP_173271180.1|901992_903519_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.3	1.2e-87
WP_173271182.1|903546_903864_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.6	1.3e-17
WP_173271184.1|903856_904156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271186.1|904439_904736_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173271188.1|904732_905077_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	45.5	1.7e-18
WP_173271190.1|905115_906774_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_173271192.1|906763_907033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271194.1|907130_908357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271196.1|908375_908855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271198.1|909160_910684_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.1	2.2e-89
WP_173271200.1|910704_911055_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.8	9.3e-20
WP_173270778.1|911116_911416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173270780.1|911408_911765_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.6	9.5e-20
WP_173271202.1|911785_913351_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.6	1.7e-89
WP_173269093.1|913410_913710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271204.1|913896_918144_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.7	1.2e-57
WP_173271206.1|919393_919777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271208.1|919791_920532_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	46.9	1.2e-53
WP_173271210.1|921223_921673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271212.1|921954_922254_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	1043468	1159895	2722826	integrase,tRNA,transposase	Leptospira_phage(20.69%)	92	1045367:1045398	1050215:1050246
WP_173271418.1|1043468_1044755_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.7	1.4e-89
WP_173271420.1|1044823_1045162_-	MGMT family protein	NA	M1PFU9	Streptococcus_phage	48.8	2.4e-12
1045367:1045398	attL	ACCCGCTTTCATGGCGGGTTTTTTTATGCCTG	NA	NA	NA	NA
WP_173271422.1|1045555_1046806_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	37.1	9.5e-75
WP_173274249.1|1047298_1048393_+	Fic family protein	NA	NA	NA	NA	NA
WP_173271424.1|1048733_1049717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271426.1|1050443_1051871_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.5	4.2e-26
1050215:1050246	attR	ACCCGCTTTCATGGCGGGTTTTTTTATGCCTG	NA	NA	NA	NA
WP_173271428.1|1051867_1052563_+	response regulator	NA	W8CYM9	Bacillus_phage	36.4	6.6e-33
WP_173271430.1|1052791_1053283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271432.1|1054385_1054973_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_173271434.1|1055051_1056770_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.6	2.0e-06
WP_173271436.1|1057016_1057922_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	33.0	1.1e-08
WP_173271438.1|1058020_1058323_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_173271440.1|1058515_1063732_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.5	1.3e-64
WP_173271442.1|1063724_1064966_+	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	32.4	4.3e-11
WP_173271444.1|1064999_1066373_+	YcjX family protein	NA	NA	NA	NA	NA
WP_173271446.1|1066384_1067290_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_173271448.1|1067608_1069660_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_173271450.1|1069669_1071637_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_173271452.1|1071623_1072736_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173271454.1|1072732_1073767_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173271456.1|1073776_1074811_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_173271458.1|1074843_1075617_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.0e-18
WP_173271460.1|1075638_1076916_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_173271462.1|1076973_1077291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173274250.1|1077317_1078352_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_173271464.1|1078644_1080477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271466.1|1080536_1080935_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_173271468.1|1081513_1082377_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.8	4.9e-30
WP_173271470.1|1082445_1084263_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.7e-35
WP_173271472.1|1084565_1087514_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_173271474.1|1087583_1088189_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_173271476.1|1088190_1089615_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_173271478.1|1089611_1091753_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.2	1.1e-33
WP_173271480.1|1091968_1093816_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_173271482.1|1094187_1098729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271484.1|1099104_1100658_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	48.2	5.6e-125
WP_173271486.1|1100675_1101005_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173271488.1|1101001_1101352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173271490.1|1101806_1112468_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_173274251.1|1112756_1112996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271492.1|1113015_1114581_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.6	2.2e-89
WP_173270780.1|1114601_1114958_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	42.6	9.5e-20
WP_173271494.1|1114950_1115229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173269099.1|1115229_1116783_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.7	1.1e-128
WP_173269097.1|1116800_1117130_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173269095.1|1117126_1117477_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173271496.1|1117702_1119277_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.5	5.5e-128
WP_173271498.1|1119294_1119624_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173271500.1|1119620_1119971_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173271502.1|1120101_1121760_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_173271188.1|1121798_1122143_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	45.5	1.7e-18
WP_173271184.1|1122314_1122614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271504.1|1122606_1122963_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.1e-19
WP_173271506.1|1122983_1124507_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.1	7.8e-87
WP_173271508.1|1124511_1124751_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173271510.1|1124847_1125177_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173271512.1|1125173_1125554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173271514.1|1125638_1127162_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.1	7.8e-87
WP_173271504.1|1127182_1127539_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.5	2.1e-19
WP_173271184.1|1127531_1127831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271188.1|1128002_1128347_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	45.5	1.7e-18
WP_173271516.1|1128385_1130044_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_173271192.1|1130033_1130303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173271518.1|1130289_1130886_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	61.1	8.3e-61
WP_173271520.1|1131715_1132222_-	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_173271522.1|1132384_1133146_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_173271524.1|1133142_1133703_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_173271526.1|1134020_1134305_-	low-complexity protein	NA	NA	NA	NA	NA
WP_173271528.1|1134394_1135678_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_173271530.1|1135801_1137007_-	ribonuclease D	NA	NA	NA	NA	NA
WP_173271531.1|1137148_1138510_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_173271533.1|1138688_1138877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173269095.1|1138927_1139278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173269097.1|1139274_1139604_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173269854.1|1139621_1141196_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.7	8.5e-129
WP_173271535.1|1141207_1141450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271537.1|1141526_1142051_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_173271540.1|1142055_1142949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271542.1|1143291_1145835_+	ATP-dependent helicase HrpB	NA	K7YWK7	Megavirus	26.4	1.5e-29
WP_173271544.1|1145972_1146185_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.3	2.4e-15
WP_173271546.1|1146531_1147812_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	23.1	4.9e-10
WP_173271548.1|1147947_1148589_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_173271550.1|1148667_1149171_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_173271552.1|1149208_1149874_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_173271554.1|1150055_1150556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271556.1|1150716_1151226_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_173271558.1|1151249_1151852_-	SCO family protein	NA	NA	NA	NA	NA
WP_173271560.1|1152277_1153807_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_173271562.1|1153956_1156452_-	AsmA family protein	NA	NA	NA	NA	NA
WP_173271564.1|1156730_1158089_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_173271566.1|1158093_1159302_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_173271574.1|1159388_1159895_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 6
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	1190099	1200495	2722826		Staphylococcus_phage(28.57%)	10	NA	NA
WP_173271630.1|1190099_1191770_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.8	5.4e-41
WP_173271632.1|1191998_1193270_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	9.6e-99
WP_173271635.1|1193585_1194053_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_173274254.1|1194098_1195250_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	9.2e-48
WP_173271637.1|1195394_1196048_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.6	4.6e-20
WP_173271640.1|1196049_1197165_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.5	1.7e-62
WP_173271642.1|1197281_1197743_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.3	3.1e-31
WP_173271644.1|1197742_1198231_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_173271647.1|1198301_1199339_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_173271650.1|1199424_1200495_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A060BHG3	Escherichia_phage	45.8	5.3e-82
>prophage 7
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	1536880	1583607	2722826	protease,tRNA,transposase	Bodo_saltans_virus(11.11%)	42	NA	NA
WP_173272274.1|1536880_1537777_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_173272276.1|1537776_1538142_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_173272278.1|1538232_1540719_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	2.0e-23
WP_173272280.1|1540733_1542221_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_173274275.1|1542339_1542798_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_173272281.1|1542954_1543611_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_173272283.1|1543610_1545458_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_173272285.1|1545613_1547224_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_173272287.1|1547223_1547442_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_173272289.1|1547683_1549633_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	1.1e-96
WP_173272291.1|1549938_1553415_-	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	37.3	5.2e-187
WP_173272293.1|1553616_1554411_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_173272295.1|1554630_1555026_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_173272297.1|1555022_1555373_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_173272299.1|1555403_1557245_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_173272301.1|1557270_1557981_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_173272303.1|1557993_1558296_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_173274276.1|1558341_1558563_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_173272304.1|1559001_1560195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173272306.1|1560311_1562540_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.4	6.3e-162
WP_173272308.1|1562540_1562858_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.9e-11
WP_173272310.1|1562998_1563847_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_173272312.1|1564038_1564605_+	PhnA domain-containing protein	NA	NA	NA	NA	NA
WP_173272314.1|1564750_1565467_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_173272316.1|1565445_1566372_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_173272318.1|1566781_1567189_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_173272320.1|1567300_1569517_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_173272322.1|1569900_1570614_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_173272324.1|1570691_1571819_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_173272326.1|1571902_1572619_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_173272328.1|1572631_1572907_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_173272330.1|1573011_1574910_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_173272332.1|1575003_1575588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173272334.1|1575703_1576063_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.5	4.9e-08
WP_173272336.1|1576164_1576524_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	38.7	9.3e-07
WP_173272338.1|1576520_1576850_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173272340.1|1576867_1578421_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	48.9	1.3e-126
WP_173272342.1|1578554_1579877_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.6	4.9e-69
WP_173272344.1|1579978_1581136_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_173272346.1|1581200_1581386_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_173272349.1|1581508_1582378_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_173272352.1|1582377_1583607_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 8
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	1652913	1676979	2722826	protease,transposase	uncultured_Mediterranean_phage(25.0%)	24	NA	NA
WP_173272466.1|1652913_1654362_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	2.2e-22
WP_173272468.1|1654396_1654957_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_173272469.1|1655125_1656751_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_173274283.1|1656785_1657307_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_173272471.1|1657559_1658645_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_173272473.1|1658844_1661913_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_173272475.1|1661974_1662634_-	acyltransferase	NA	NA	NA	NA	NA
WP_173272477.1|1662642_1663593_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_173272479.1|1663625_1665686_-	glycosyltransferase	NA	A0A0E3G4U3	Synechococcus_phage	31.8	5.9e-05
WP_173272481.1|1665748_1666918_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_173272483.1|1666943_1667294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173272485.1|1667280_1670580_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_173272487.1|1670712_1672266_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.1	2.3e-126
WP_173269097.1|1672283_1672613_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173272489.1|1672609_1672960_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173272491.1|1672990_1673137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173272493.1|1673154_1673484_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173272498.1|1673480_1673654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173271192.1|1673671_1673941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173272500.1|1673930_1675589_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_173271188.1|1675627_1675972_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	45.5	1.7e-18
WP_173272502.1|1675968_1676265_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173272504.1|1676346_1676547_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_173272506.1|1676577_1676979_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	1683378	1692034	2722826	transposase	Enterobacteria_phage(37.5%)	9	NA	NA
WP_173272515.1|1683378_1684563_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.5	3.8e-97
WP_173272517.1|1684555_1685491_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	36.7	3.5e-37
WP_173272519.1|1685543_1685855_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_173272522.1|1685857_1686445_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	3.2e-41
WP_173272524.1|1686546_1687434_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.7e-105
WP_173269187.1|1687756_1688443_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	61.4	7.3e-77
WP_173269189.1|1688510_1689672_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	37.3	3.1e-43
WP_173269191.1|1689600_1690557_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	51.1	2.1e-42
WP_173269099.1|1690480_1692034_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.7	1.1e-128
>prophage 10
NZ_AP021889	Thiomicrorhabdus sp. aks77	2722826	2131232	2184363	2722826	protease,transposase	Pseudomonas_phage(18.18%)	43	NA	NA
WP_173274312.1|2131232_2131688_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.6	1.1e-25
WP_173273397.1|2131692_2132325_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_173273400.1|2132669_2133641_-	EF-P lysine aminoacylase GenX	NA	NA	NA	NA	NA
WP_173273403.1|2133674_2134241_-	elongation factor P	NA	NA	NA	NA	NA
WP_173273406.1|2134342_2135290_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_173273409.1|2135286_2135901_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_173273412.1|2135940_2136399_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173273414.1|2136405_2137845_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_173273416.1|2137841_2138633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173273418.1|2138712_2139390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173273420.1|2139373_2140942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173273422.1|2140943_2142146_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_173273424.1|2142156_2143842_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_173273426.1|2143841_2145773_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_173273428.1|2145791_2147498_-	pilus (MSHA type) biogenesis protein MshL	NA	NA	NA	NA	NA
WP_173273430.1|2147481_2148987_-	AAA family ATPase	NA	A0A0S4L1G1	Pseudomonas_phage	26.6	1.1e-08
WP_173273432.1|2155302_2159085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173273434.1|2159106_2160576_-	ribonuclease G	NA	NA	NA	NA	NA
WP_173273435.1|2160589_2161201_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_173273437.1|2161377_2161800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173273439.1|2161812_2162721_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_173273441.1|2162779_2163742_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_173273443.1|2163756_2165013_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_173273445.1|2165051_2165771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173273447.1|2165764_2166787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173273449.1|2166947_2167718_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_173273451.1|2167704_2168793_-	glycosyltransferase	NA	A0A2P0VNG4	Tetraselmis_virus	30.4	3.6e-09
WP_173273453.1|2168789_2169857_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_173273455.1|2170018_2170693_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_173273457.1|2170695_2172444_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.6	5.8e-46
WP_173273459.1|2172409_2173375_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_173273461.1|2173390_2174821_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A0K0KVL9	Prochlorococcus_phage	36.6	3.2e-18
WP_173273463.1|2174820_2175390_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	31.8	1.3e-10
WP_173273465.1|2175494_2175704_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_173273467.1|2175726_2176656_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_173273469.1|2177305_2178484_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	1.6e-34
WP_173273471.1|2178499_2179405_+	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	25.9	5.4e-19
WP_173273473.1|2179577_2180561_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.4	1.3e-39
WP_173273475.1|2180561_2182136_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.3	6.5e-129
WP_173273477.1|2182221_2182449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173273479.1|2182513_2183675_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	37.7	3.6e-44
WP_173273481.1|2183686_2184016_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_173273483.1|2184012_2184363_-|transposase	transposase	transposase	NA	NA	NA	NA
