The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	913098	925620	4808368	integrase	Enterobacteria_phage(18.18%)	13	909653:909666	921028:921041
909653:909666	attL	GCGCGGGATCGCGT	NA	NA	NA	NA
WP_033144705.1|913098_914151_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	5.9e-118
WP_033144706.1|914455_915559_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	5.9e-60
WP_033144707.1|915570_916824_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.1	2.0e-96
WP_033144708.1|917176_918391_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	4.8e-132
WP_071993571.1|918454_919366_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	27.3	5.1e-17
WP_033144711.1|919485_919686_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.6	2.3e-07
WP_033144712.1|919685_920120_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	53.6	1.8e-28
WP_033144713.1|920133_920976_+	antA/AntB antirepressor family protein	NA	A0A0P0ZG08	Escherichia_phage	48.8	6.7e-24
WP_172421289.1|920968_921688_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	52.4	4.1e-14
921028:921041	attR	GCGCGGGATCGCGT	NA	NA	NA	NA
WP_033144715.1|921684_921897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033144716.1|921893_922520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033144717.1|922529_922871_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	63.3	1.0e-34
WP_033144718.1|922863_925620_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	58.1	1.8e-299
>prophage 2
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	1644011	1699498	4808368	terminase,tRNA,plate,holin	Escherichia_phage(37.04%)	77	NA	NA
WP_072196686.1|1644011_1645112_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	4.9e-99
WP_033145107.1|1645721_1647122_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.3	9.3e-79
WP_033145108.1|1647288_1648491_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	7.6e-45
WP_172421299.1|1648675_1649968_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	86.2	9.8e-224
WP_045328197.1|1650013_1650259_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	67.9	7.2e-27
WP_172421301.1|1650267_1650468_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	86.4	4.0e-28
WP_172421303.1|1650621_1650759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172421305.1|1650881_1651229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023300422.1|1651225_1651444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172421307.1|1651440_1651992_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	60.0	1.5e-56
WP_172421309.1|1651988_1652141_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	42.3	4.8e-05
WP_172421311.1|1652827_1653322_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	86.5	5.0e-51
WP_049015610.1|1653322_1654048_-	recombinase	NA	B8K1D9	Salmonella_phage	64.5	2.9e-84
WP_000122968.1|1654044_1654203_-	hypothetical protein	NA	I6R9C0	Salmonella_phage	52.2	2.2e-05
WP_001303341.1|1654199_1654397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172421313.1|1654405_1655323_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	74.0	1.0e-49
WP_172421315.1|1655392_1655839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049015640.1|1655825_1656080_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	93.8	7.9e-29
WP_172421317.1|1656057_1656564_-	HNH endonuclease	NA	Q5DMP6	Escherichia_phage	41.1	1.9e-26
WP_023330205.1|1656560_1656719_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	92.3	1.1e-20
WP_047642407.1|1656715_1657225_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	98.2	9.5e-90
WP_075202194.1|1657387_1657609_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_172421319.1|1657737_1658079_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	1.7e-55
WP_172421320.1|1658515_1658713_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	84.4	1.2e-21
WP_047345146.1|1658855_1659230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172421321.1|1659226_1659853_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	39.4	2.7e-17
WP_063851391.1|1660228_1661005_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	76.7	2.0e-115
WP_045354765.1|1661089_1661335_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	82.2	1.0e-28
WP_058660818.1|1661373_1661595_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_172421322.1|1661677_1662532_+	replication protein	NA	K7PGT1	Enterobacteria_phage	51.2	2.1e-57
WP_032443146.1|1662516_1663389_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	68.7	1.5e-106
WP_172421323.1|1663385_1663685_+	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	2.8e-17
WP_172421419.1|1663771_1664146_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	76.7	1.9e-31
WP_172421324.1|1664142_1664364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421325.1|1664360_1664795_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	51.6	4.0e-12
WP_172421421.1|1665111_1665735_+	DUF551 domain-containing protein	NA	G5DA83	Enterobacteria_phage	45.0	3.8e-40
WP_172421327.1|1665734_1666595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032180568.1|1666807_1667245_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.9	2.6e-59
WP_172421329.1|1667244_1667415_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	78.6	3.6e-17
WP_054829860.1|1667411_1668080_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	99.5	5.9e-132
WP_000048136.1|1668072_1668357_+	hypothetical protein	NA	G8C7V5	Escherichia_phage	95.7	9.4e-47
WP_032665721.1|1668353_1668713_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.5	9.8e-41
WP_154816981.1|1668709_1668826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421332.1|1668822_1669512_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	2.9e-57
WP_049015580.1|1669814_1670156_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	4.1e-28
WP_139152884.1|1670139_1670583_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	67.8	9.3e-49
WP_075202197.1|1670579_1671131_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	68.3	1.2e-53
WP_172421334.1|1671296_1671821_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	77.0	1.7e-70
WP_172421336.1|1671883_1672963_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	52.7	2.7e-65
WP_049015574.1|1672952_1674224_+	hypothetical protein	NA	A0A0F7L5X3	uncultured_marine_virus	28.1	6.6e-15
WP_047722506.1|1674235_1675657_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	2.3e-88
WP_172421338.1|1675653_1676478_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.3	5.2e-53
WP_049015570.1|1676490_1678095_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_172421340.1|1678110_1678971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045407450.1|1678987_1680019_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	2.3e-74
WP_172421342.1|1680087_1680570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109536369.1|1680566_1680995_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	1.9e-22
WP_023327269.1|1680991_1681426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153428855.1|1681409_1682351_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	7.7e-53
WP_172421344.1|1682355_1683750_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.2	5.9e-65
WP_023327272.1|1683753_1684191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049015625.1|1684193_1684778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421346.1|1684901_1686737_+	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	44.9	1.7e-16
WP_172421347.1|1686739_1687456_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.9	1.0e-28
WP_047721645.1|1687452_1687728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721647.1|1687727_1688747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721648.1|1688743_1689460_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	29.5	5.4e-22
WP_172421349.1|1689456_1689789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421351.1|1689785_1691204_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	42.9	3.5e-49
WP_172421353.1|1691205_1691910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421355.1|1691954_1692833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654156.1|1692846_1693182_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	40.0	8.1e-05
WP_058654155.1|1693291_1693462_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	78.6	8.8e-16
WP_172421423.1|1693571_1694477_+	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	68.5	4.6e-71
WP_172421357.1|1695356_1695749_+	hypothetical protein	NA	A0A077KAY3	Edwardsiella_phage	50.0	5.2e-11
WP_172421359.1|1695978_1696326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033145109.1|1696885_1699498_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	7.0e-19
>prophage 3
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	2163230	2173304	4808368		Oenococcus_phage(16.67%)	9	NA	NA
WP_032657497.1|2163230_2164445_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.2	1.1e-46
WP_033145403.1|2164459_2165479_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.2	7.9e-19
WP_033145404.1|2165552_2166920_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_033145405.1|2167139_2168603_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	5.4e-45
WP_014883679.1|2168646_2168850_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_033145406.1|2169138_2169570_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	37.9	4.4e-19
WP_023311557.1|2169603_2170290_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023311558.1|2170381_2171128_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_033145407.1|2171270_2173304_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	24.8	3.5e-18
>prophage 4
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	2381572	2397862	4808368	transposase,coat	Enterobacteria_phage(100.0%)	18	NA	NA
WP_015979773.1|2381572_2381797_+|coat	major coat protein	coat	D0U160	Enterobacteria_phage	58.1	1.0e-11
WP_060568779.1|2381864_2383286_+	hypothetical protein	NA	A7BJW8	Enterobacteria_phage	38.0	1.6e-30
WP_015979775.1|2383288_2383630_+|coat	minor coat protein	coat	A7BJW9	Enterobacteria_phage	54.5	2.2e-26
WP_015979776.1|2383629_2384691_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	64.9	3.6e-131
WP_000427623.1|2386012_2387017_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_016157964.1|2387924_2388212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016157965.1|2388247_2388403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157956.1|2389006_2389486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157957.1|2389501_2389870_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016157958.1|2389913_2390315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157959.1|2390426_2390618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016157960.1|2390796_2391912_+	replication-associated protein G2P	NA	NA	NA	NA	NA
WP_015979770.1|2391934_2392225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015979773.1|2392417_2392642_+|coat	major coat protein	coat	D0U160	Enterobacteria_phage	58.1	1.0e-11
WP_060568779.1|2392709_2394131_+	hypothetical protein	NA	A7BJW8	Enterobacteria_phage	38.0	1.6e-30
WP_015979775.1|2394133_2394475_+|coat	minor coat protein	coat	A7BJW9	Enterobacteria_phage	54.5	2.2e-26
WP_015979776.1|2394474_2395536_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	64.9	3.6e-131
WP_000427623.1|2396857_2397862_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	3094626	3102476	4808368		Enterobacteria_phage(57.14%)	8	NA	NA
WP_033145963.1|3094626_3095736_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.2	3.1e-45
WP_033145964.1|3095797_3096193_-	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_033145965.1|3096201_3096744_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.3e-49
WP_033145966.1|3096747_3097626_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	2.5e-106
WP_033145967.1|3097675_3098575_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.2	5.1e-30
WP_033145968.1|3098577_3099660_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.8e-99
WP_033145969.1|3100011_3100908_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	1.8e-43
WP_033145970.1|3101084_3102476_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.8	3.7e-19
>prophage 6
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	3636100	3679481	4808368	integrase,tail,plate,holin	Salmonella_phage(44.19%)	57	3637692:3637706	3682007:3682021
WP_008502505.1|3636100_3636583_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_023150243.1|3637307_3637574_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	92.0	3.0e-39
3637692:3637706	attL	AGCCTCATCAACAAT	NA	NA	NA	NA
WP_024176473.1|3637721_3638759_+	acyltransferase	NA	NA	NA	NA	NA
WP_172421439.1|3638799_3639177_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	56.5	4.6e-25
WP_032335219.1|3639206_3640343_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	75.3	1.1e-56
WP_023150239.1|3640324_3641005_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.9	1.1e-109
WP_023150238.1|3641001_3642201_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	90.0	2.7e-196
WP_023150237.1|3642201_3642555_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.0	1.5e-57
WP_023150236.1|3642554_3643307_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	70.5	4.0e-92
WP_023150235.1|3643347_3643764_-	hypothetical protein	NA	A0A0M3ULK2	Salmonella_phage	96.4	3.8e-68
WP_077767381.1|3643785_3644094_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	98.7	5.1e-38
WP_023150233.1|3644129_3645191_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.7	3.3e-161
WP_023150232.1|3645193_3645496_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	95.0	5.7e-50
WP_023150231.1|3645495_3646083_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	90.8	4.6e-88
WP_023150230.1|3646082_3648092_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	94.3	0.0e+00
WP_016247451.1|3648269_3648722_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	80.0	1.1e-62
WP_000257260.1|3648725_3649166_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_023150229.1|3649177_3650323_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.9	2.0e-164
WP_023150228.1|3650326_3650872_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.3	1.3e-47
WP_023150227.1|3650864_3651269_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	1.5e-42
WP_023150226.1|3651268_3651775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150225.1|3651771_3652182_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.9	4.4e-29
WP_023150224.1|3652153_3652564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150223.1|3652610_3653558_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	60.1	1.9e-107
WP_023344731.1|3653569_3654073_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	47.0	6.4e-30
WP_023150221.1|3654084_3655356_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	41.5	4.2e-78
WP_024176471.1|3655617_3656151_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.7	1.2e-47
WP_023150219.1|3656221_3657691_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	56.7	1.1e-157
WP_023150218.1|3657692_3659309_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	80.6	8.1e-268
WP_023150217.1|3659507_3660110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150215.1|3660354_3661359_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1Z2	Lactococcus_phage	24.7	2.6e-06
WP_023150214.1|3661426_3661831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150213.1|3661835_3662021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150212.1|3662020_3662449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150211.1|3662699_3663149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172421380.1|3663978_3664248_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	87.6	2.8e-32
WP_045334173.1|3664255_3664885_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	96.7	2.6e-113
WP_172421382.1|3664884_3665166_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	4.8e-19
WP_054628613.1|3665152_3665539_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	94.5	4.3e-58
WP_172421384.1|3666273_3666720_+	hypothetical protein	NA	U5P096	Shigella_phage	32.8	1.4e-12
WP_172421386.1|3667050_3667866_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	76.8	1.6e-110
WP_172421388.1|3667862_3668174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186531.1|3668175_3670047_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
WP_172421281.1|3670150_3671173_-	hypothetical protein	NA	V5URT9	Shigella_phage	57.7	5.3e-47
WP_023306765.1|3671165_3671375_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024176468.1|3671376_3671601_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
WP_023150198.1|3671713_3672412_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
WP_172421390.1|3672613_3673045_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172421392.1|3673110_3673500_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.8	1.8e-32
WP_172421394.1|3673606_3673831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296234.1|3673823_3674231_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_172421395.1|3674420_3674834_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	66.4	5.2e-46
WP_172421396.1|3674937_3675222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172421397.1|3675375_3676554_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	93.1	5.1e-211
WP_047748626.1|3676600_3677368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047748625.1|3677379_3677718_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	36.9	7.1e-09
WP_033146326.1|3678284_3679481_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.3e-108
3682007:3682021	attR	ATTGTTGATGAGGCT	NA	NA	NA	NA
>prophage 7
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	4076575	4187606	4808368	integrase,tail,tRNA,plate,holin	Erwinia_phage(33.33%)	113	4062762:4062777	4100341:4100356
4062762:4062777	attL	GCCGACGGCACGCTGA	NA	NA	NA	NA
WP_007897923.1|4076575_4077823_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012477419.1|4078436_4079072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033146649.1|4080582_4082058_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_033146650.1|4082088_4083501_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_023333413.1|4083559_4084297_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_029740706.1|4084460_4086719_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	1.7e-85
WP_023309189.1|4086837_4087239_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.6	4.8e-20
WP_033146652.1|4087378_4088044_+	two-component system response regulator QseB	NA	NA	NA	NA	NA
WP_033146653.1|4088034_4089372_+	two-component system sensor histidine kinase QseC	NA	NA	NA	NA	NA
WP_033146654.1|4089477_4090059_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033146655.1|4090090_4090405_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_033146656.1|4090488_4091376_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033146657.1|4091372_4092323_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033146658.1|4092332_4093373_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_033146659.1|4093369_4094353_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_033146660.1|4094349_4095162_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.2e-14
WP_033146661.1|4095548_4097690_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_029740698.1|4097773_4099666_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.2	3.8e-91
WP_008502976.1|4099694_4100276_-	esterase YqiA	NA	NA	NA	NA	NA
WP_024906493.1|4100275_4101103_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
4100341:4100356	attR	TCAGCGTGCCGTCGGC	NA	NA	NA	NA
WP_003862516.1|4101130_4101553_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_023333429.1|4101549_4102182_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.6	4.4e-20
WP_033146662.1|4102386_4103865_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_029740695.1|4104057_4104726_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.0	1.8e-40
WP_029740694.1|4104728_4105889_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	7.7e-87
WP_033146664.1|4105981_4106770_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_033146665.1|4106966_4107740_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_033146666.1|4107772_4108426_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.9	3.5e-44
WP_028014454.1|4108802_4109099_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_033146667.1|4109176_4110607_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	3.3e-39
WP_049015847.1|4110647_4113503_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_033146669.1|4113524_4114826_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_024906484.1|4115055_4115676_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_033147076.1|4115736_4116978_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.4	1.0e-92
WP_033146670.1|4116988_4117810_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_023333447.1|4117916_4118285_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_023309216.1|4118392_4119013_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_049015850.1|4119097_4120504_+	MFS transporter	NA	NA	NA	NA	NA
WP_033146671.1|4120604_4121027_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033146672.1|4121174_4122188_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	38.8	1.4e-55
WP_033146673.1|4122332_4123160_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_006811999.1|4123170_4123473_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_033146674.1|4123483_4123798_+	urease subunit beta	NA	NA	NA	NA	NA
WP_033146675.1|4123790_4125494_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_033146676.1|4125503_4125968_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_032659887.1|4125977_4126517_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_033146677.1|4126516_4127191_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_014071813.1|4127200_4127818_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_033146678.1|4127862_4128876_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	7.4e-110
WP_001144069.1|4129112_4129328_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023333458.1|4129443_4131189_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_023309228.1|4131342_4133190_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_029741755.1|4133292_4133799_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_029741756.1|4134081_4134282_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	79.6	6.3e-21
WP_033146679.1|4134349_4135504_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	62.0	3.3e-130
WP_023309232.1|4135500_4135965_-|tail	phage tail protein	tail	O80317	Escherichia_phage	66.7	6.9e-55
WP_033146680.1|4135976_4138256_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	40.5	5.3e-132
WP_023616176.1|4138248_4138368_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_033146681.1|4138400_4138709_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	65.3	2.6e-26
WP_033146682.1|4138765_4139284_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	1.7e-78
WP_033146683.1|4139295_4140483_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.3	4.7e-188
WP_033146684.1|4140541_4141135_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	75.0	1.4e-79
WP_047174866.1|4141206_4141548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033146686.1|4141534_4141729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033146685.1|4141815_4142415_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	54.3	2.4e-55
WP_049130861.1|4142414_4143464_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	67.1	5.7e-121
WP_029741411.1|4143460_4144069_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	89.1	1.5e-102
WP_033146687.1|4144061_4144970_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	86.4	4.3e-141
WP_033146688.1|4144975_4145326_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	69.8	5.2e-39
WP_033146689.1|4145322_4145964_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	1.0e-88
WP_033146690.1|4146076_4146544_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	61.3	2.6e-49
WP_033146691.1|4146639_4147065_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	64.9	9.2e-38
WP_033146692.1|4147061_4147571_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	81.5	2.1e-73
WP_029741404.1|4147554_4147776_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.0	4.6e-25
WP_023309248.1|4147766_4147970_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	4.0e-23
WP_033146693.1|4148149_4148590_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	75.2	1.4e-52
WP_033146694.1|4148699_4150889_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	73.5	0.0e+00
WP_033146695.1|4150890_4151112_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	76.4	5.5e-26
WP_029741400.1|4151111_4151339_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	9.9e-15
WP_033146696.1|4151407_4151746_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	73.9	5.1e-39
WP_033146697.1|4151973_4152549_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	62.8	4.9e-66
WP_033146698.1|4152831_4154001_+	DNA repair protein	NA	NA	NA	NA	NA
WP_033146699.1|4154001_4154766_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_029741394.1|4154914_4155409_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033146700.1|4155405_4156965_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	8.4e-12
WP_033146701.1|4157302_4158823_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	8.4e-33
WP_033146702.1|4159258_4160638_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.3e-32
WP_033146703.1|4160721_4161324_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033146704.1|4161366_4162053_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_033146705.1|4162065_4162914_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_033146706.1|4162969_4163263_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_033146707.1|4163259_4164147_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_033146708.1|4164158_4165160_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_033146709.1|4165161_4166139_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_033146710.1|4166139_4167171_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_033146711.1|4167167_4168655_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.5e-18
WP_033146712.1|4168870_4169842_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_033146713.1|4169874_4171473_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_033146714.1|4171680_4173702_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_010435862.1|4173822_4174959_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_033146715.1|4175042_4175546_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_033146716.1|4175616_4176615_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_029739669.1|4176865_4177834_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.8	1.5e-35
WP_033146717.1|4178053_4179295_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_033146718.1|4179387_4180875_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_033146719.1|4180892_4182305_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023333537.1|4182780_4184079_+	MFS transporter	NA	NA	NA	NA	NA
WP_033146720.1|4184194_4184971_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_024906405.1|4185315_4185978_+	DedA family protein	NA	NA	NA	NA	NA
WP_033146721.1|4185980_4186364_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_033146722.1|4186506_4186875_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_008503141.1|4186906_4187212_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_023333540.1|4187213_4187606_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 8
NZ_AP022628	Enterobacter asburiae strain A2563	4808368	4631655	4695649	4808368	protease,tRNA,transposase,integrase	Synechococcus_phage(15.38%)	57	4680510:4680569	4694882:4695701
WP_033146922.1|4631655_4632756_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_008501783.1|4632835_4633195_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_008501784.1|4633204_4633843_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_008501785.1|4634039_4635440_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_023309664.1|4635422_4636340_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_033146923.1|4636676_4638050_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_120785294.1|4638128_4638905_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_033146925.1|4638911_4639916_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_008501790.1|4640004_4641156_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_033146926.1|4641427_4644079_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_033146927.1|4644173_4644938_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033146928.1|4645066_4645729_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.6	8.4e-30
WP_033146929.1|4645741_4646845_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_033146930.1|4646928_4649109_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_033146931.1|4649256_4650144_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_033146932.1|4650370_4652803_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_033146933.1|4652805_4653966_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_007369220.1|4654242_4654560_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_003862040.1|4654607_4654820_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_033146934.1|4655020_4657216_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_023309683.1|4657335_4658361_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_033146935.1|4658454_4659450_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_008501802.1|4659544_4660075_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_023309685.1|4660084_4661419_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	29.3	2.4e-44
WP_033146936.1|4661487_4662408_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_032662736.1|4662500_4662986_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_010436935.1|4663571_4663811_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_014885705.1|4664210_4665056_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	8.9e-16
WP_023309688.1|4665077_4666586_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_032662725.1|4666739_4667750_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_033146938.1|4667846_4668593_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000019951.1|4669067_4669340_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_087878313.1|4669462_4670572_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000697966.1|4671381_4672062_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
WP_023165801.1|4672054_4673530_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	6.1e-28
WP_023165800.1|4673780_4674212_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_008786877.1|4674358_4674709_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	2.3e-18
WP_004574636.1|4675972_4677262_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_003821921.1|4677283_4677796_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004364974.1|4677799_4678696_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|4678791_4679199_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_024144532.1|4679378_4679801_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
4680510:4680569	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4680572_4681277_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000124025.1|4681939_4684927_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
WP_000470624.1|4685094_4685730_+	recombinase family protein	NA	NA	NA	NA	NA
WP_009652884.1|4685757_4686594_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000235177.1|4686659_4687058_-	VOC family protein	NA	NA	NA	NA	NA
WP_000842086.1|4687099_4688209_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_001141270.1|4688239_4688515_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_001162012.1|4689220_4689778_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|4690087_4691101_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003159548.1|4691253_4691994_+	subclass B1 metallo-beta-lactamase IMP-1	NA	NA	NA	NA	NA
WP_012695484.1|4692143_4692725_+	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_000679427.1|4692963_4693311_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4693304_4694144_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4694271_4694772_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|4694944_4695649_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4694882:4695701	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
