The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	133178	241952	1960491	capsid,terminase,head,tail,portal,holin,integrase,protease	Streptococcus_phage(77.78%)	135	240672:240693	248288:248309
WP_166042924.1|133178_134453_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2MYF3	Enterococcus_phage	62.7	1.8e-145
WP_107374513.1|134442_134640_-	hypothetical protein	NA	Q938J5	Temperate_phage	55.7	6.8e-12
WP_107374556.1|134636_134828_-	hypothetical protein	NA	B0YL75	Streptococcus_virus	90.5	2.6e-24
WP_166042926.1|134885_135218_-	hypothetical protein	NA	A1EAB4	Streptococcus_phage	42.0	8.8e-20
WP_166042928.1|135240_137919_-	hypothetical protein	NA	A0A1S5SFF9	Streptococcus_phage	37.0	2.3e-89
WP_166042929.1|137992_138232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042930.1|138243_139371_-	hypothetical protein	NA	A0A1B1IN38	Lactococcus_phage	55.8	5.0e-107
WP_166042932.1|139385_141074_-	hypothetical protein	NA	Q2I7P5	Streptococcus_phage	44.6	1.8e-108
WP_166042934.1|141076_142573_-|tail	phage tail family protein	tail	A0A0B5A078	Streptococcus_phage	28.3	1.3e-49
WP_166042935.1|142576_144949_-|tail	phage tail protein	tail	Q77MU4	Lactococcus_phage	49.2	1.6e-110
WP_166042937.1|144938_145319_-	DUF5361 domain-containing protein	NA	Q9F4J4	Streptococcus_phage	56.6	8.8e-32
WP_166042938.1|145333_145588_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	52.3	5.3e-17
WP_166042940.1|145591_146170_-|tail	phage tail protein	tail	Q9F4J6	Streptococcus_phage	63.6	1.1e-57
WP_166042942.1|146181_146517_-	hypothetical protein	NA	A0A1B1IMT0	Lactococcus_phage	59.1	2.3e-28
WP_166042944.1|146513_146753_-	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	67.1	4.0e-22
WP_166042946.1|146745_147084_-	hypothetical protein	NA	Q7Y4I1	Streptococcus_phage	66.1	1.9e-38
WP_166042948.1|147076_147466_-	hypothetical protein	NA	M1NRT5	Streptococcus_phage	77.3	2.6e-47
WP_166042949.1|147487_147628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042951.1|147627_148548_-|capsid	phage major capsid protein	capsid	A0A126GGI3	Streptococcus_phage	80.1	9.3e-136
WP_166042953.1|148552_149008_-	DUF4355 domain-containing protein	NA	A0A126GGH5	Streptococcus_phage	59.0	1.0e-34
WP_166042955.1|149083_150496_-|terminase	terminase	terminase	M1PFG2	Streptococcus_phage	83.1	6.2e-240
WP_166042958.1|150548_150689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042960.1|150748_150955_-	hypothetical protein	NA	Q708N1	Streptococcus_phage	75.4	8.1e-24
WP_166044322.1|150920_151397_-	MafB	NA	Q7Y4I9	Streptococcus_phage	53.2	2.2e-40
WP_166042962.1|152124_153387_-|portal	phage portal protein	portal	A0A126GGJ2	Streptococcus_phage	78.6	1.9e-192
WP_166042964.1|153508_153859_-	HNH endonuclease	NA	A0A1S5SG82	Streptococcus_phage	81.5	4.0e-47
WP_107374543.1|153969_154395_-	DUF1492 domain-containing protein	NA	A0A1X9I5N2	Streptococcus_phage	69.5	1.3e-44
WP_166042966.1|155037_155250_-	hypothetical protein	NA	A0A1S5SEA6	Streptococcus_phage	62.3	7.6e-17
WP_166042968.1|155262_155427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042970.1|155444_155609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042972.1|155610_156003_-	hypothetical protein	NA	A0A2H4JAX8	uncultured_Caudovirales_phage	37.0	1.6e-12
WP_166042974.1|156214_156739_-	DUF1642 domain-containing protein	NA	B3GVZ2	Streptococcus_phage	41.0	1.7e-09
WP_166042976.1|156762_156903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042978.1|156895_157216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042980.1|157196_157376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042982.1|157365_157614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042985.1|157598_158075_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A286QS25	Streptococcus_phage	71.1	4.6e-62
WP_166042987.1|158071_158398_-	hypothetical protein	NA	E8ZD56	Streptococcus_phage	59.8	7.8e-29
WP_166042989.1|158409_158853_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	63.3	2.9e-42
WP_166042990.1|158861_159860_-	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	66.5	7.3e-118
WP_166042992.1|159874_160630_-	phage recombination protein Bet	NA	A0A141E1Z7	Streptococcus_phage	73.4	3.5e-96
WP_094141147.1|160629_160818_-	hypothetical protein	NA	A0A1S5S9Y3	Streptococcus_phage	59.3	1.3e-12
WP_166042993.1|160814_161039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042994.1|161039_161258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042995.1|161260_161443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042996.1|161445_162333_-	DnaD domain protein	NA	J7KBV5	Streptococcus_phage	82.0	1.6e-55
WP_166044324.1|162364_163150_-	DNA methyltransferase	NA	U4KJA1	Streptococcus_phage	80.2	2.3e-119
WP_166042997.1|163160_163337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166042998.1|163338_163650_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	72.8	4.7e-39
WP_166042999.1|163734_164073_-	hypothetical protein	NA	A0A1P8VVU1	Streptococcus_phage	64.4	3.9e-31
WP_166044326.1|164263_164479_-	transcriptional regulator	NA	M1Q1B4	Streptococcus_phage	84.3	6.9e-26
WP_074629780.1|164783_165161_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFC6	Streptococcus_phage	70.2	1.0e-40
WP_166043000.1|165189_165570_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	65.6	1.1e-39
WP_166043002.1|165623_166376_+	hypothetical protein	NA	A0A1X9I5E4	Streptococcus_phage	66.0	9.8e-59
WP_166043003.1|166517_167669_+|integrase	site-specific integrase	integrase	C5IUL7	Streptococcus_phage	53.1	3.7e-105
WP_004232506.1|167756_169055_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	92.6	1.3e-228
WP_074564035.1|169261_169711_+	YueI family protein	NA	W6LLD2	Streptococcus_phage	53.0	6.1e-32
WP_166043004.1|169707_170823_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	61.5	6.3e-94
WP_166043005.1|170967_177594_-	pullulanase	NA	NA	NA	NA	NA
WP_074564039.1|177799_178114_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_039696592.1|178125_178446_-	phosphoribosyl-AMP cyclohydrolase	NA	A0A2H4UVM0	Bodo_saltans_virus	33.0	2.3e-09
WP_074965180.1|178442_179201_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_166043006.1|179204_179924_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	23.4	8.9e-09
WP_006532647.1|179971_180580_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_039696589.1|180652_181237_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_158914202.1|181262_181910_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_158914204.1|181902_183180_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_006532651.1|183176_183824_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_039696586.1|183823_184792_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_158914206.1|184808_185876_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_074564051.1|186327_188052_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_074560621.1|188157_190110_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.4	6.8e-144
WP_166043007.1|190110_190671_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_166043008.1|190823_192035_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_166043009.1|192445_192796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043011.1|192854_193241_-	hypothetical protein	NA	B3GW25	Streptococcus_phage	50.9	2.9e-22
WP_166043013.1|193939_194785_-	peptidoglycan hydrolase	NA	W6LMV8	Streptococcus_phage	72.4	9.5e-119
WP_166043015.1|194781_195108_-|holin	phage holin	holin	A0A286QRN1	Streptococcus_phage	80.6	2.3e-41
WP_166043017.1|195152_195485_-	hypothetical protein	NA	Q56S82	Streptococcus_virus	90.0	1.4e-46
WP_166043019.1|195498_195645_-	hypothetical protein	NA	A0A286QNV5	Streptococcus_phage	91.3	1.2e-16
WP_166043021.1|195670_196042_-	DUF1366 domain-containing protein	NA	A0A286QT32	Streptococcus_phage	49.2	7.8e-25
WP_166043023.1|196054_198145_-	hypothetical protein	NA	M1IR90	Streptococcus_phage	36.2	2.9e-108
WP_166043025.1|198157_199708_-	hypothetical protein	NA	Q94MX2	Streptococcusphage	35.2	1.8e-46
WP_166043027.1|199646_199865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043029.1|199882_201007_-	hypothetical protein	NA	A0A1B1IN38	Lactococcus_phage	53.6	1.3e-107
WP_166043031.1|201033_202785_-	hypothetical protein	NA	Q9MCJ8	Streptococcus_virus	57.8	5.8e-195
WP_166044328.1|202785_204342_-|tail	phage tail protein	tail	A0A1S5PRQ3	Streptococcus_phage	60.8	1.4e-195
WP_166043033.1|204347_208931_-	tape measure protein	NA	A0A286QPN7	Streptococcus_phage	58.1	1.1e-309
WP_166043035.1|209139_209502_-|tail	phage tail protein	tail	F8HGT7	Streptococcus_phage	67.2	4.4e-33
WP_094141002.1|209563_210178_-|tail	phage tail protein	tail	O64291	Streptococcus_virus	71.0	1.3e-77
WP_166043037.1|210194_210569_-	DUF806 family protein	NA	A0A286QQM7	Streptococcus_phage	65.9	4.6e-41
WP_094141000.1|210568_210991_-	HK97 gp10 family phage protein	NA	A0A286QQY0	Streptococcus_phage	72.5	6.1e-50
WP_166043039.1|210990_211344_-|head	phage head closure protein	head	O64288	Streptococcus_virus	68.8	2.8e-40
WP_166043041.1|211336_211654_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286QNI5	Streptococcus_phage	71.4	1.0e-33
WP_166043043.1|211665_212904_-|capsid	phage major capsid protein	capsid	A0A2I6QQY9	Streptococcus_phage	49.0	2.6e-96
WP_094140996.1|212918_213605_-|protease	Clp protease ClpP	protease	A0A2P0VGN2	Streptococcus_phage	63.6	2.0e-74
WP_166043045.1|213591_214764_-|portal	phage portal protein	portal	Q9MCK6	Streptococcus_virus	70.8	3.0e-155
WP_166043047.1|214794_214953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043048.1|214952_215138_-	DUF1056 family protein	NA	A0A2I6QQZ6	Streptococcus_phage	77.0	1.1e-16
WP_166044330.1|215151_217029_-|terminase	terminase large subunit	terminase	A0A286QNL8	Streptococcus_phage	91.2	0.0e+00
WP_166043050.1|217045_217504_-|terminase	phage terminase small subunit P27 family	terminase	A0A286QTA0	Streptococcus_phage	90.8	5.4e-76
WP_166043052.1|217685_218204_-	HNH endonuclease	NA	Q9XJW2	Streptococcus_virus	66.3	7.2e-61
WP_166043054.1|218458_218863_-	DUF1492 domain-containing protein	NA	A0A2I6QQS5	Streptococcus_phage	57.9	6.9e-35
WP_166043055.1|219199_219607_-	hypothetical protein	NA	Q9AZN1	Lactococcus_phage	58.8	6.5e-33
WP_166043057.1|219596_219758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043059.1|219754_220303_-	DUF1642 domain-containing protein	NA	A0A286QMN0	Streptococcus_phage	28.4	9.2e-06
WP_166043061.1|220332_220767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043062.1|220750_221005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166044332.1|221310_222600_-	helicase	NA	A0A1S5SB13	Streptococcus_phage	82.8	8.3e-207
WP_166043064.1|222641_223460_-	DNA primase	NA	B3GVY7	Streptococcus_phage	78.4	2.0e-121
WP_166043065.1|223488_224016_-	hypothetical protein	NA	X2L082	Streptococcus_phage	70.3	3.5e-63
WP_166043066.1|224035_224794_-	AAA family ATPase	NA	B3GVY5	Streptococcus_phage	83.3	1.2e-112
WP_166043067.1|225985_226519_-	endonuclease	NA	B3GVX7	Streptococcus_phage	48.9	8.8e-38
WP_166043068.1|226496_226967_-	hypothetical protein	NA	A0A141E0U8	Streptococcus_phage	74.7	1.8e-63
WP_166043069.1|226967_227450_-	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	68.1	3.1e-50
WP_166043070.1|227584_227920_-	hypothetical protein	NA	A0A1X9I5N1	Streptococcus_phage	51.0	3.1e-20
WP_166043071.1|227973_228174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043072.1|228175_228445_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166043074.1|228665_228836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043076.1|229008_229239_-	DUF739 family protein	NA	O34036	Streptococcus_phage	81.1	1.8e-27
WP_166043078.1|229413_229806_+	helix-turn-helix domain-containing protein	NA	O34035	Streptococcus_phage	73.6	9.4e-45
WP_166043080.1|229792_230179_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	48.0	1.3e-27
WP_166043082.1|230200_230632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166043084.1|230799_231867_+|integrase	site-specific integrase	integrase	A0A1X9I680	Streptococcus_phage	58.8	1.2e-115
WP_166043086.1|232076_232424_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_166043088.1|232570_233791_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.3	4.3e-96
WP_166043091.1|233804_234092_-	chorismate mutase	NA	NA	NA	NA	NA
WP_166043093.1|234126_234834_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_039696579.1|234918_236304_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_006532664.1|236389_236833_-	flavodoxin	NA	NA	NA	NA	NA
WP_166043095.1|236874_237894_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_039696576.1|238016_239168_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_166043097.1|239347_240289_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_021142736.1|240447_240693_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
240672:240693	attL	AAAATACGGTTTCACAAAATAA	NA	NA	NA	NA
WP_009853866.1|240794_241952_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	30.6	9.2e-40
WP_009853866.1|240794_241952_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	30.6	9.2e-40
248288:248309	attR	AAAATACGGTTTCACAAAATAA	NA	NA	NA	NA
>prophage 2
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	407370	417222	1960491		Streptococcus_phage(75.0%)	12	NA	NA
WP_039696452.1|407370_408462_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	82.0	4.6e-174
WP_074626291.1|408596_409226_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_039696436.1|409339_409681_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_039696435.1|409761_410997_-	ammonium transporter	NA	NA	NA	NA	NA
WP_166043239.1|411352_412219_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	76.4	2.1e-121
WP_039696433.1|412228_412549_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.3	2.6e-29
WP_074602650.1|412541_413342_-	signal peptidase II	NA	NA	NA	NA	NA
WP_166043241.1|413338_414214_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	1.2e-71
WP_166043243.1|414232_414859_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	65.6	1.8e-69
WP_166043244.1|414951_415611_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	64.2	4.4e-71
WP_024343676.1|415747_416458_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.2	4.4e-16
WP_039696427.1|416457_417222_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	7.2e-17
>prophage 3
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	610486	705176	1960491	transposase,bacteriocin,tRNA,protease	Bacillus_phage(26.67%)	90	NA	NA
WP_039696260.1|610486_611497_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.2	1.8e-60
WP_074602918.1|611493_611946_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_080728286.1|611929_612622_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_074564447.1|612810_613041_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_039696257.1|613042_614725_+	ribonuclease J	NA	NA	NA	NA	NA
WP_166043376.1|614825_615488_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_039696251.1|615675_617115_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_166043378.1|617116_621634_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_074560916.1|621824_623171_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_015695674.1|623217_623589_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	34.1	2.4e-05
WP_039696246.1|623670_624216_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_074602933.1|624349_625546_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_039696243.1|625730_626744_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_020917479.1|626951_629030_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.8	4.8e-63
WP_004233289.1|629231_629702_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003066537.1|629723_630137_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_039696241.1|630382_631198_-	pur operon repressor	NA	NA	NA	NA	NA
WP_052071092.1|631770_632010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166043380.1|632110_633049_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_006531897.1|633038_634313_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_166043382.1|634314_634947_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_006531895.1|634939_635602_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006531894.1|635608_636481_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_052071091.1|636799_637534_-	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	27.2	2.8e-18
WP_166044344.1|638194_639541_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_166044346.1|639567_640938_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_166043384.1|640942_642328_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_074626913.1|642676_642970_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_158914537.1|642997_643303_-|bacteriocin	bacteriocin immunity protein	bacteriocin	Q9AZK7	Lactococcus_phage	41.3	3.3e-05
WP_039696228.1|643315_643465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158914538.1|643727_643880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166043386.1|643902_645228_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_166043387.1|645232_645964_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_074626894.1|646731_647421_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_159428313.1|647485_647638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159428314.1|647651_647792_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_074626895.1|647814_648423_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_159428316.1|648397_648562_-|bacteriocin	lactococcin G-beta/enterocin 1071B family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_107374736.1|648564_648720_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_074626896.1|648959_651107_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.5	3.0e-44
WP_166043389.1|651116_652499_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_166043391.1|652524_652704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166043393.1|653043_653718_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_166043395.1|653750_654440_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_166043397.1|654433_654616_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_074564489.1|654985_655858_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_166043399.1|655946_656471_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_074603284.1|656467_657037_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_074602974.1|657029_657800_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_166043401.1|657964_659530_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.4	1.0e-17
WP_158914547.1|659670_660876_+	MFS transporter	NA	NA	NA	NA	NA
WP_166043403.1|660999_662271_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_004233312.1|662292_663915_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_166043405.1|664073_664955_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166043407.1|665008_666274_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_015695707.1|666266_666506_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_166043409.1|666538_667801_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	29.2	2.1e-21
WP_158914551.1|667797_669336_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.1	3.6e-39
WP_020917506.1|669351_669474_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_166044348.1|669483_670644_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	2.4e-19
WP_157629414.1|670637_671327_-	response regulator	NA	W8CYM9	Bacillus_phage	35.0	2.0e-29
WP_166043411.1|671649_672444_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074564517.1|672602_673244_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_166043413.1|673271_674717_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_074560955.1|674741_675587_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_074564520.1|675586_676531_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_074482397.1|676690_678058_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166043415.1|678437_681137_+	cellobiose phosphorylase	NA	NA	NA	NA	NA
WP_166043418.1|681157_683569_+	N,N'-diacetylchitobiose phosphorylase	NA	NA	NA	NA	NA
WP_074560960.1|683948_684662_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_015695712.1|685052_685226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074482394.1|685374_685584_-	CsbD family protein	NA	NA	NA	NA	NA
WP_002885866.1|685714_685849_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_158914565.1|686040_686442_-	DUF3021 family protein	NA	NA	NA	NA	NA
WP_158914567.1|686452_686908_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166043420.1|686921_687761_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166043422.1|687762_688614_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	5.4e-21
WP_074560965.1|688735_689743_-	protein jag	NA	NA	NA	NA	NA
WP_039696185.1|689755_690571_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_006531772.1|690554_690914_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_166043424.1|691054_692449_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_166043426.1|692798_693989_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_166043428.1|694187_695117_-	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	24.6	1.7e-07
WP_015695757.1|695109_696177_-	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	26.1	2.0e-09
WP_015695758.1|696185_697112_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_134775673.1|697111_698611_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166043430.1|698671_700645_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166043432.1|700916_702083_-	MFS transporter	NA	NA	NA	NA	NA
WP_166043261.1|702288_703640_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.8	1.4e-66
WP_074626856.1|703718_705176_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	844209	852424	1960491		Staphylococcus_phage(33.33%)	9	NA	NA
WP_166043567.1|844209_844875_-	transglycosylase SLT domain-containing protein	NA	Q4Z8Z7	Staphylococcus_phage	73.6	1.4e-21
WP_039696098.1|845127_845730_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	47.3	9.1e-23
WP_039696097.1|845868_846666_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_166043569.1|846658_847501_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	2.3e-16
WP_039696095.1|847476_848316_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	29.6	2.2e-14
WP_039696094.1|848312_848867_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_166043571.1|848879_849824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039696092.1|849889_851179_-	insulinase family protein	NA	A0A0G2Y5U8	Acanthamoeba_polyphaga_mimivirus	32.1	6.5e-18
WP_166043573.1|851179_852424_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	43.7	4.2e-91
>prophage 5
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	1101542	1121975	1960491	integrase	Streptococcus_phage(94.74%)	22	1093213:1093227	1127204:1127218
1093213:1093227	attL	ATTATGAAACAATCA	NA	NA	NA	NA
WP_039697537.1|1101542_1102157_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.8	2.5e-12
WP_039697538.1|1102223_1102868_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158914814.1|1102959_1104123_+	MFS transporter	NA	NA	NA	NA	NA
WP_000420682.1|1104451_1104766_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|1104781_1105168_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_166043687.1|1105196_1106582_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	99.8	3.2e-265
WP_000398284.1|1106760_1107966_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_001009056.1|1108008_1108230_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000342539.1|1108346_1108844_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_000506270.1|1108818_1109325_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000331160.1|1109308_1111756_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000804748.1|1111758_1113936_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_000769868.1|1113932_1114934_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_001224319.1|1114930_1115863_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	100.0	1.1e-171
WP_001791010.1|1116107_1116224_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_166043689.1|1116239_1118159_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	96.9	0.0e+00
WP_000336323.1|1118277_1118445_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_001227347.1|1118504_1118858_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000804885.1|1119362_1119785_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_000857133.1|1119781_1120012_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000814511.1|1120472_1120676_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_001291561.1|1120757_1121975_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
1127204:1127218	attR	ATTATGAAACAATCA	NA	NA	NA	NA
>prophage 6
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	1451185	1459200	1960491		Staphylococcus_phage(42.86%)	8	NA	NA
WP_166043894.1|1451185_1452241_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.3	7.1e-39
WP_166043896.1|1452240_1452843_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.3	6.3e-32
WP_166043898.1|1452843_1454022_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.8	2.4e-104
WP_166043900.1|1454033_1454495_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	56.7	7.9e-43
WP_166043902.1|1454557_1455124_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_166043903.1|1455390_1456356_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	1.5e-128
WP_166043905.1|1456742_1458902_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.3	8.0e-263
WP_014334480.1|1458972_1459200_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.9	1.3e-11
>prophage 7
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	1679319	1687833	1960491		Streptococcus_phage(16.67%)	9	NA	NA
WP_157628956.1|1679319_1679529_-	hypothetical protein	NA	Q7Y4M2	Streptococcus_phage	87.0	3.6e-27
WP_039696960.1|1679990_1680572_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	55.4	1.3e-50
WP_074482165.1|1680608_1681688_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_166044071.1|1681687_1682518_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_074625803.1|1682510_1683110_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	30.6	2.5e-17
WP_074868785.1|1683191_1684442_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	53.5	7.3e-99
WP_039696955.1|1684483_1685461_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_074601803.1|1685460_1686063_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	44.5	4.1e-23
WP_166044073.1|1686108_1687833_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	20.9	5.6e-09
>prophage 8
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	1726679	1735330	1960491		Streptococcus_phage(71.43%)	7	NA	NA
WP_074563632.1|1726679_1727366_+	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	48.3	1.1e-56
WP_074563634.1|1727367_1727571_+	hypothetical protein	NA	D0R0A4	Streptococcus_phage	52.3	6.4e-13
WP_166044125.1|1727571_1728987_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	73.0	1.7e-200
WP_166044127.1|1728988_1729348_+	hypothetical protein	NA	E4ZFJ1	Streptococcus_phage	48.7	1.8e-18
WP_166044129.1|1729676_1730354_+	methylase	NA	A0A2H4YF91	Aeromonas_phage	34.0	1.1e-08
WP_166044130.1|1730358_1734768_+	DEAD/DEAH box helicase family protein	NA	A0A1V0SEE0	Indivirus	22.1	2.6e-18
WP_039698258.1|1734910_1735330_+	DUF4065 domain-containing protein	NA	A7J2B6	Streptococcus_phage	29.9	6.8e-09
>prophage 9
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	1810487	1819010	1960491		Bacillus_virus(33.33%)	8	NA	NA
WP_157629042.1|1810487_1811408_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.1	9.6e-32
WP_004231769.1|1811483_1811735_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_039696862.1|1811819_1813148_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	36.8	2.5e-09
WP_074563738.1|1813137_1813812_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	2.2e-25
WP_157629043.1|1813978_1816522_-	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	24.9	5.1e-67
WP_039696860.1|1816752_1817406_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_039696859.1|1817436_1818195_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	2.2e-18
WP_166044200.1|1818206_1819010_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	1.4e-15
>prophage 10
NZ_CP046919	Streptococcus sp. CNU G2 chromosome, complete genome	1960491	1935326	1947752	1960491	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_166044310.1|1935326_1935737_-	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	40.7	9.9e-13
WP_093814675.1|1935733_1936243_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_074626687.1|1936399_1937749_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_039696754.1|1937984_1938482_+	membrane protein	NA	NA	NA	NA	NA
WP_074626685.1|1938518_1939010_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	62.3	7.4e-47
WP_074626684.1|1939158_1939872_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	46.1	3.4e-61
WP_074626682.1|1939864_1940311_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	56.3	6.9e-44
WP_074626680.1|1940310_1940961_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.5	1.2e-60
WP_166044312.1|1941127_1942897_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	7.5e-57
WP_166044314.1|1942899_1944639_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.9e-37
WP_074626674.1|1944681_1946550_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.2	1.1e-66
WP_074626672.1|1946546_1947752_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.0	2.1e-42
