The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049980	Leclercia adecarboxylata strain 707804 chromosome, complete genome	4773926	1610825	1616298	4773926	integrase,lysis	uncultured_Caudovirales_phage(50.0%)	7	1602433:1602447	1626259:1626273
1602433:1602447	attL	CCGGTCAGCACAGCG	NA	NA	NA	NA
WP_165717728.1|1610825_1612061_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.2	6.3e-111
WP_164540218.1|1612062_1612281_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	57.7	4.6e-17
WP_165717729.1|1613056_1613413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165717730.1|1614308_1614536_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	56.0	4.0e-16
WP_165717731.1|1614546_1615044_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	75.2	3.3e-71
WP_165717732.1|1615033_1615486_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	57.7	4.1e-36
WP_165717733.1|1615701_1616298_+	Rha family transcriptional regulator	NA	Q9B021	Phage_GMSE-1	65.0	8.7e-18
1626259:1626273	attR	CCGGTCAGCACAGCG	NA	NA	NA	NA
>prophage 2
NZ_CP049980	Leclercia adecarboxylata strain 707804 chromosome, complete genome	4773926	1740101	1749578	4773926		uncultured_virus(16.67%)	9	NA	NA
WP_032617958.1|1740101_1740428_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.4e-22
WP_032617959.1|1740538_1741753_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	2.8e-47
WP_165717784.1|1741814_1743149_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_165717785.1|1743408_1744872_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.7e-43
WP_165717786.1|1744916_1745120_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	61.2	2.0e-14
WP_155166742.1|1745383_1745815_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	36.6	7.0e-17
WP_032618024.1|1745855_1746542_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618025.1|1746633_1747380_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_165717787.1|1747532_1749578_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.3	6.5e-20
>prophage 3
NZ_CP049980	Leclercia adecarboxylata strain 707804 chromosome, complete genome	4773926	2367543	2448160	4773926	portal,terminase,tail,capsid,protease,tRNA,integrase,holin,head	Enterobacteria_phage(29.63%)	98	2402946:2402973	2445947:2445974
WP_148569339.1|2367543_2368239_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_165718010.1|2368305_2370216_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	2.7e-89
WP_032611486.1|2370343_2370688_+	RidA family protein	NA	NA	NA	NA	NA
WP_032611488.1|2370693_2370879_-	YoaH family protein	NA	NA	NA	NA	NA
WP_165718011.1|2370940_2372293_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	33.7	2.5e-44
WP_032611493.1|2372296_2372875_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_165718012.1|2373058_2374423_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_165718013.1|2374587_2376180_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032611501.1|2376180_2377740_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	7.3e-40
WP_032611503.1|2378202_2379177_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_032611504.1|2379223_2380021_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_032611505.1|2380033_2380885_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_165718014.1|2380942_2381401_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_165718618.1|2381791_2382355_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_032611509.1|2382351_2383167_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_165718015.1|2383233_2384952_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2385169_2385379_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_032611517.1|2385419_2385536_-	YobF family protein	NA	NA	NA	NA	NA
WP_165718016.1|2386062_2387052_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032611519.1|2387071_2387362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032611520.1|2387435_2387579_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_032611522.1|2387736_2387976_+	membrane protein	NA	NA	NA	NA	NA
WP_032611524.1|2388029_2388821_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_032611528.1|2388999_2390373_+	MFS transporter	NA	NA	NA	NA	NA
WP_032611530.1|2390420_2391302_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_165718017.1|2391495_2393544_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.0	4.9e-84
WP_032611533.1|2393563_2394250_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_059307646.1|2394347_2394845_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_059307645.1|2394976_2396260_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_032611541.1|2396228_2398862_+	PqiB family protein	NA	NA	NA	NA	NA
WP_165718018.1|2398897_2400382_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_032611546.1|2400485_2400725_+	YebV family protein	NA	NA	NA	NA	NA
WP_032611549.1|2400828_2401020_+	YebW family protein	NA	NA	NA	NA	NA
WP_077227054.1|2401020_2401665_-	protein-serine/threonine phosphatase	NA	S4TNS0	Salmonella_phage	46.8	1.4e-58
WP_165718019.1|2401843_2402791_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2402946:2402973	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_165718020.1|2403138_2403456_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	3.1e-22
WP_165718021.1|2403455_2403695_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	69.2	7.0e-27
WP_165718619.1|2403786_2404071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718022.1|2404113_2406015_-	hypothetical protein	NA	A0A1B1W279	Salmonella_phage	38.4	1.9e-21
WP_165718023.1|2406072_2409159_-	kinase	NA	A0A286S259	Klebsiella_phage	53.3	9.0e-300
WP_165718024.1|2409155_2409536_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	53.2	3.8e-35
WP_165718025.1|2409545_2410034_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	69.2	1.7e-56
WP_165718026.1|2410030_2410501_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.6	9.2e-47
WP_165718027.1|2410505_2414000_-	tape measure protein	NA	A0A2H4JHR1	uncultured_Caudovirales_phage	73.9	1.8e-203
WP_165718028.1|2414049_2414382_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	91.8	3.3e-51
WP_165718029.1|2414436_2414715_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	89.1	4.2e-39
WP_165718030.1|2414723_2415110_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	95.3	3.0e-64
WP_164529874.1|2415144_2415849_-|tail	phage tail protein	tail	Q9MCS7	Enterobacteria_phage	83.8	8.2e-108
WP_165718031.1|2415908_2416238_-	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	50.9	3.2e-22
WP_150870727.1|2416234_2416684_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	85.9	5.0e-66
WP_032617627.1|2416680_2417022_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	47.1	1.1e-06
WP_032617626.1|2417018_2417345_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	51.9	9.6e-27
WP_032617625.1|2417354_2417540_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	62.3	8.4e-12
WP_165718032.1|2417592_2418813_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	91.6	1.9e-205
WP_139564923.1|2418822_2419671_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	74.2	5.2e-109
WP_165718033.1|2419682_2420987_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.6	4.4e-216
WP_151585261.1|2420986_2422717_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	81.3	1.1e-289
WP_165718034.1|2422716_2423214_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	2.2e-62
WP_032617619.1|2423406_2423607_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	1.7e-10
WP_165718035.1|2423603_2423954_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	78.1	1.5e-49
WP_142489717.1|2424063_2424339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114675523.1|2424335_2424689_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.8	2.6e-14
WP_165718036.1|2424796_2424976_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	79.5	7.8e-15
WP_165718037.1|2424932_2425205_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	64.3	1.2e-17
WP_165718038.1|2425201_2425744_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	69.5	4.6e-74
WP_165718039.1|2425740_2426019_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_165718040.1|2426015_2426414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718041.1|2426966_2427656_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	5.3e-67
WP_165718042.1|2427652_2427775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718043.1|2427771_2427960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718044.1|2427956_2428319_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.3	3.0e-53
WP_165718045.1|2428315_2428606_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	7.4e-47
WP_032612101.1|2428608_2428809_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	54.5	3.3e-14
WP_165718046.1|2428813_2429413_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	88.3	5.9e-99
WP_165718047.1|2430221_2432087_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.2	6.6e-197
WP_165718048.1|2432083_2432341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718049.1|2432340_2432679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718050.1|2432675_2433158_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	35.8	1.3e-11
WP_165718051.1|2433150_2433414_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	65.0	1.6e-24
WP_165718052.1|2433427_2434180_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	79.6	1.9e-110
WP_165718620.1|2434176_2435100_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	74.1	2.0e-122
WP_165718053.1|2435181_2435751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568772.1|2435762_2435981_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_165718621.1|2436083_2436470_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	75.4	1.4e-45
WP_165718054.1|2436596_2437826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165718055.1|2438099_2438468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718056.1|2438482_2438644_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	68.0	4.6e-14
WP_165718057.1|2438784_2442093_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	52.5	3.6e-262
WP_165718058.1|2442104_2443220_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	89.8	1.4e-186
WP_165718059.1|2443254_2443599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165718060.1|2443591_2444254_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	46.0	7.4e-42
WP_165718061.1|2444240_2444480_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	84.4	1.0e-30
WP_165718062.1|2444544_2444817_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	7.2e-28
WP_165718063.1|2444785_2445871_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	66.8	2.9e-144
WP_165718622.1|2446192_2446534_-	YebY family protein	NA	NA	NA	NA	NA
2445947:2445974	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_165718064.1|2446545_2447418_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_059307641.1|2447419_2447794_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_032611906.1|2447929_2448160_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	66.2	5.3e-16
>prophage 4
NZ_CP049980	Leclercia adecarboxylata strain 707804 chromosome, complete genome	4773926	2616805	2628060	4773926		Escherichia_phage(25.0%)	10	NA	NA
WP_165718097.1|2616805_2617816_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	37.8	1.6e-43
WP_165718098.1|2617852_2619217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718099.1|2619209_2620334_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	29.0	1.1e-26
WP_165718100.1|2620335_2621424_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.9	4.0e-29
WP_165718101.1|2621433_2622207_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_165718102.1|2622311_2623190_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.4e-109
WP_117385317.1|2623242_2624142_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	2.6e-29
WP_155167059.1|2624141_2625227_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	51.2	1.1e-98
WP_032612377.1|2625599_2626496_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.5	1.4e-43
WP_165718103.1|2626674_2628060_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.4	4.8e-19
>prophage 5
NZ_CP049980	Leclercia adecarboxylata strain 707804 chromosome, complete genome	4773926	3075100	3161071	4773926	portal,terminase,tail,capsid,protease,tRNA,plate,transposase,holin,head	Shigella_phage(36.54%)	94	NA	NA
WP_032613191.1|3075100_3075838_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_032613193.1|3075970_3077293_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	1.9e-44
WP_032613195.1|3077349_3077733_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	68.9	7.5e-31
WP_165718190.1|3078046_3078736_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.4	1.8e-54
WP_117385216.1|3078840_3079941_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_059307384.1|3080147_3080567_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	1.6e-13
WP_165718191.1|3080639_3081338_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_077226738.1|3081373_3084037_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_032613208.1|3084147_3085503_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_165718631.1|3085546_3085870_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_165718192.1|3085866_3087174_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.0e-43
WP_059307380.1|3087326_3087782_-	DUF4385 domain-containing protein	NA	A0A0C5AAP9	Cyanophage	48.7	1.7e-34
WP_077227872.1|3093361_3095935_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.8	9.3e-125
WP_165718193.1|3096064_3096796_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_059307378.1|3096792_3097773_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_032613235.1|3097903_3098641_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_032613238.1|3098912_3099254_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_165718194.1|3099520_3100681_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_165718195.1|3100677_3101550_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_032613244.1|3101610_3102732_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_032613246.1|3102742_3103813_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	2.0e-89
WP_032613248.1|3104027_3104402_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_077227867.1|3104492_3105086_+	YfiR family protein	NA	NA	NA	NA	NA
WP_117386769.1|3105078_3106299_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_077227866.1|3106312_3106795_+	OmpA family protein	NA	NA	NA	NA	NA
WP_165718196.1|3106799_3108167_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_077227873.1|3108229_3108550_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3108749_3109097_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_032613261.1|3109138_3109906_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_059307374.1|3109936_3110470_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_022649067.1|3110488_3110737_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_032613265.1|3111052_3112414_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_163604565.1|3112505_3113372_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032613269.1|3113390_3114677_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_032613272.1|3114730_3115324_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077227861.1|3115445_3116324_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_032613276.1|3116409_3118071_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_032613277.1|3118222_3118564_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_165718197.1|3118660_3118948_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071886427.1|3118937_3119414_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_014071418.1|3119531_3120014_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	2.0e-28
WP_165718632.1|3120949_3121876_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	44.6	4.4e-69
WP_165718198.1|3122025_3123750_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_165718199.1|3124990_3125422_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	35.0	2.8e-18
WP_165718200.1|3125981_3126563_-	YmfQ family protein	NA	O22003	Shigella_phage	78.2	8.3e-90
WP_165718201.1|3126553_3127612_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	78.1	4.9e-165
WP_156263509.1|3127604_3128024_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	79.9	1.4e-59
WP_165718202.1|3128026_3128569_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	72.8	1.4e-70
WP_165718203.1|3128568_3129639_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	83.3	7.2e-172
WP_165718204.1|3129641_3129926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718205.1|3129925_3131503_-	LamG domain-containing protein	NA	A0A0E3M194	Enterobacteria_phage	30.4	5.9e-29
WP_165718206.1|3131511_3132933_-	DNA circularization protein	NA	M1FPN5	Enterobacteria_phage	67.9	3.8e-168
WP_165718207.1|3132981_3133398_-	PH domain-containing protein	NA	A0A249Y2R5	Serratia_phage	40.9	2.5e-19
WP_165718208.1|3133466_3135242_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	55.0	1.8e-114
WP_165718209.1|3135359_3135647_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	60.7	1.3e-22
WP_165718210.1|3135646_3136003_-|tail	phage tail protein	tail	U5P076	Shigella_phage	88.1	2.8e-56
WP_165718211.1|3136002_3137499_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	75.3	1.2e-212
WP_165718212.1|3137495_3137678_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.1	3.5e-10
WP_165718213.1|3137686_3138247_-	hypothetical protein	NA	S5FM61	Shigella_phage	81.7	8.3e-87
WP_165718214.1|3138243_3138750_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	81.0	1.2e-73
WP_165718215.1|3138724_3139138_-|head	phage head closure protein	head	U5P0R0	Shigella_phage	66.4	1.4e-46
WP_165718216.1|3139134_3139458_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	63.2	2.3e-33
WP_165718217.1|3139531_3140749_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	76.0	1.4e-171
WP_165718218.1|3140758_3141358_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.5	2.1e-88
WP_165718219.1|3141350_3142577_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	91.4	2.7e-223
WP_165718220.1|3142566_3142728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718221.1|3142724_3144458_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	94.0	0.0e+00
WP_165718222.1|3144454_3144949_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	91.5	2.4e-82
WP_165718223.1|3145079_3145430_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	77.6	7.8e-51
WP_165718224.1|3145483_3145726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165718225.1|3145728_3146631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165718226.1|3146733_3147057_-	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	78.2	1.4e-38
WP_165718227.1|3147273_3147888_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.3	8.0e-91
WP_165718228.1|3147890_3148157_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_165718229.1|3148153_3148534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718230.1|3148762_3149584_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	44.6	2.0e-57
WP_165718231.1|3149601_3150591_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	3.2e-134
WP_165718232.1|3150598_3151396_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	75.5	1.3e-112
WP_165718233.1|3151482_3151866_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	84.7	6.8e-56
WP_165718633.1|3151862_3152141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165718234.1|3152121_3153000_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.6	3.3e-122
WP_165718235.1|3152996_3153758_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	60.7	3.8e-66
WP_165718236.1|3153672_3153930_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.2	6.0e-16
WP_165718237.1|3154093_3154648_-	DNA-binding protein	NA	S5FXP0	Shigella_phage	63.0	4.1e-62
WP_103826518.1|3154692_3154893_-	transcriptional regulator	NA	U5P445	Shigella_phage	83.1	1.8e-23
WP_103826553.1|3154981_3155656_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.9	6.6e-115
WP_165718238.1|3156159_3156531_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	73.2	3.0e-45
WP_165718239.1|3156559_3157384_+	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	67.5	1.8e-101
WP_165718240.1|3157515_3158052_+	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	70.2	1.8e-67
WP_165718241.1|3158042_3158546_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	68.6	7.9e-12
WP_151585527.1|3158547_3158751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165718242.1|3158754_3159105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165718243.1|3159101_3159674_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	9.1e-65
WP_165718244.1|3159880_3161071_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.9	3.3e-149
>prophage 6
NZ_CP049980	Leclercia adecarboxylata strain 707804 chromosome, complete genome	4773926	3256146	3263595	4773926		Mycobacterium_phage(33.33%)	7	NA	NA
WP_071886424.1|3256146_3256407_+	glutaredoxin-like protein NrdH	NA	A0A222ZNS6	Mycobacterium_phage	42.9	1.1e-06
WP_032613493.1|3256403_3256814_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.9	1.3e-17
WP_077226179.1|3256786_3258931_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.3	1.7e-196
WP_165718273.1|3258940_3259900_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.9	1.8e-134
WP_148569504.1|3259980_3260601_+	LysE family transporter	NA	NA	NA	NA	NA
WP_032613504.1|3260791_3261004_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_148569505.1|3261447_3263595_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	2.3e-28
