The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049957	Bordetella trematum strain E202 chromosome, complete genome	4457823	370673	394825	4457823	transposase,integrase	Bacillus_phage(40.0%)	23	370377:370429	388746:388798
370377:370429	attL	GCAGTTGCAAACCCTCACTGATCCGCATGCCCGTTCCATACAGAAGCTGGGCG	NA	NA	NA	NA
WP_001747814.1|370673_372206_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001470697.1|372432_373086_-|integrase	site-specific integrase	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_001083725.1|373230_373728_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|373884_374130_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|374135_374927_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_044067521.1|375015_376365_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	26.3	3.6e-19
WP_000679427.1|377037_377385_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|377378_378218_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_158387812.1|378689_380210_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069953510.1|381375_382179_+	subclass B1 metallo-beta-lactamase AFM-1	NA	NA	NA	NA	NA
WP_069953511.1|382182_382548_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_079859790.1|382552_383113_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_079859792.1|383361_384639_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_069953514.1|385079_385523_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003464967.1|385524_386064_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_069953515.1|386204_386909_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069953516.1|386905_387874_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_069953517.1|387968_388253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000946487.1|389306_390158_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
388746:388798	attR	GCAGTTGCAAACCCTCACTGATCCGCATGCCCGTTCCATACAGAAGCTGGGCG	NA	NA	NA	NA
WP_165720290.1|390285_390471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|390504_391209_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000130000.1|393528_393834_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|394060_394825_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP049957	Bordetella trematum strain E202 chromosome, complete genome	4457823	1668661	1700119	4457823	transposase,integrase	Salmonella_phage(30.0%)	37	1680719:1680734	1702941:1702956
WP_165720957.1|1668661_1669864_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	54.8	2.5e-120
WP_001179606.1|1670011_1670233_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001162384.1|1670237_1671065_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000743064.1|1671051_1671933_+	replication protein C	NA	NA	NA	NA	NA
WP_000024442.1|1672965_1673154_+	stabilization protein	NA	NA	NA	NA	NA
WP_000836966.1|1673294_1674074_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000718002.1|1674086_1674323_+	entry exclusion lipoprotein TrbK	NA	NA	NA	NA	NA
WP_001405816.1|1674333_1675761_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_000213809.1|1675765_1676014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211355.1|1676077_1676302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057729319.1|1676338_1676542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272375.1|1676656_1677724_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000140066.1|1677720_1678227_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	3.0e-27
WP_001239389.1|1678223_1678991_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.3	1.4e-76
WP_000447876.1|1678987_1679320_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000935451.1|1679497_1681213_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1680719:1680734	attL	CCGATCCTCCGGCGCA	NA	NA	NA	NA
WP_001381192.1|1681215_1682208_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000376623.1|1682176_1682677_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000946487.1|1682804_1683656_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001470697.1|1683757_1684411_+|integrase	site-specific integrase	integrase	A0A2I7SAK5	Vibrio_phage	58.1	1.1e-21
WP_001747814.1|1684637_1686170_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001253717.1|1686261_1687053_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001257840.1|1687073_1688249_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_000163574.1|1688352_1688979_+	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001747812.1|1688975_1689158_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214125.1|1689185_1690400_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_000259026.1|1690616_1691588_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000679427.1|1691581_1691929_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|1692092_1692884_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001256773.1|1692976_1694236_-	chloramphenicol efflux MFS transporter CmlA6	NA	S4TR35	Salmonella_phage	31.7	2.8e-26
WP_023622803.1|1694490_1695045_-	aminoglycoside N-acetyltransferase AAC(6')-IIa	NA	NA	NA	NA	NA
WP_165720489.1|1695127_1695367_-	DfrB family trimethoprim-resistant dihydrofolate reductase	NA	A0A0F6R7A8	Sinorhizobium_phage	68.6	1.7e-12
WP_000845048.1|1695630_1696644_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001366550.1|1696926_1697664_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|1697660_1697885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1698341_1699112_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025517404.1|1699108_1700119_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	2.0e-78
1702941:1702956	attR	TGCGCCGGAGGATCGG	NA	NA	NA	NA
