The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	843064	915715	5255498	protease,integrase,tRNA,transposase	Staphylococcus_phage(33.33%)	57	854223:854240	914490:914507
WP_096928816.1|843064_844292_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|844792_846883_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001296383.1|847744_847987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|848277_848637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|848640_848856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|853636_854788_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
854223:854240	attL	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_001034083.1|855384_859272_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_011076574.1|859521_859665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973516.1|860215_862417_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|862498_863776_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|863772_865515_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|865514_866462_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|866462_868187_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|868322_869516_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|870233_870662_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|870701_871262_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|871303_871564_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|873397_873511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006213.1|875378_875612_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_001774069.1|878103_878655_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000147017.1|880337_881381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218869.1|881636_882902_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000234526.1|883280_883988_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839781.1|884380_886516_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001296363.1|886564_887821_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|888022_889102_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|889166_889442_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001296362.1|889469_890522_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|890682_891402_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107566.1|891401_891728_+	YggL family protein	NA	NA	NA	NA	NA
WP_001296361.1|891750_891891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000984796.1|891911_892631_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394132.1|892806_893853_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745240.1|893969_894977_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000378955.1|895032_896334_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000577034.1|896333_896837_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000783999.1|896881_897868_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000239963.1|898182_899319_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174754.1|899311_899905_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277229.1|899912_900203_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|900199_900766_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|900783_901488_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001296360.1|901505_902486_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|902600_903017_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000126441.1|903016_903652_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593274.1|903688_904639_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|904651_905383_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|905462_906170_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296359.1|906264_906762_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|906838_908233_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|908668_909823_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001331575.1|910126_910342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|910477_910609_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|910617_912594_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758881.1|912739_913471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105562.1|913606_914527_+	agmatinase	NA	NA	NA	NA	NA
914490:914507	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
WP_001296354.1|914956_915715_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	1164984	1172124	5255498		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|1164984_1165623_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|1165619_1166882_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|1166878_1167787_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|1167982_1168750_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1168800_1169457_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|1169562_1172124_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	1240183	1327962	5255498	lysis,tRNA,tail,portal,protease,terminase	Enterobacteria_phage(33.93%)	92	NA	NA
WP_029700790.1|1240183_1241356_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	5.1e-147
WP_001331174.1|1241316_1241523_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|1241582_1241798_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001222408.1|1241794_1242157_-	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	2.0e-65
WP_000008249.1|1242147_1242684_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_029700792.1|1242812_1243637_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	1.0e-149
WP_000135682.1|1243702_1244065_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|1244533_1244968_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|1244939_1245146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450737.1|1245393_1246020_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|1246117_1246318_+	cell division protein	NA	NA	NA	NA	NA
WP_001250269.1|1247083_1247263_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|1247252_1248194_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_142965904.1|1248190_1248685_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	5.6e-87
WP_001355692.1|1248684_1249338_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_000210155.1|1249334_1249661_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000767113.1|1249657_1250047_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_029700795.1|1250066_1250864_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.6e-150
WP_001360050.1|1250871_1251861_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_029700797.1|1251878_1252220_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	1.6e-56
WP_001531322.1|1252232_1252781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|1252767_1253694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029700800.1|1253958_1254162_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_029700801.1|1254312_1255365_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	1.4e-207
WP_000839596.1|1255432_1255648_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|1255647_1256145_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_029700804.1|1256141_1256609_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	97.4	6.1e-75
WP_001139681.1|1256596_1256749_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_000373425.1|1257424_1257919_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934127.1|1257918_1260021_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_001072975.1|1260017_1260230_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_029700806.1|1260229_1261738_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.6	6.6e-288
WP_001136591.1|1261682_1263710_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.8	0.0e+00
WP_001097050.1|1263796_1264120_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283144.1|1264112_1264388_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_029700808.1|1264399_1264978_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.6e-101
WP_001079398.1|1264974_1265376_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|1265387_1266131_+	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|1266191_1266578_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161009.1|1266586_1266916_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_029700810.1|1266887_1269953_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447247.1|1269952_1270282_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|1270291_1270990_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_064735486.1|1270994_1271738_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.3e-147
WP_050550752.1|1271674_1272283_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	8.1e-104
WP_029700815.1|1272343_1275841_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.5	0.0e+00
WP_029700816.1|1275911_1276511_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.5	4.5e-107
WP_072059871.1|1276575_1279647_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	2.8e-67
WP_029701022.1|1279646_1280231_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	6.6e-103
WP_000355482.1|1280300_1281074_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072095179.1|1281510_1282914_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_012602456.1|1282948_1284163_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_000162574.1|1284968_1285451_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|1285582_1286059_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1286048_1286339_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1286400_1286742_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880939.1|1286890_1288552_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1288637_1289516_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1289638_1290232_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1290285_1291572_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189256.1|1291592_1292459_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1292550_1293912_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1294048_1294297_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1294315_1294864_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|1294894_1295662_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1295703_1296051_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589791.1|1296127_1296610_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969008.1|1296625_1297852_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|1297841_1298360_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|1298506_1298872_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1299081_1300152_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225212.1|1300162_1301284_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200140.1|1301326_1302487_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1302585_1302633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1302736_1303078_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1303347_1304085_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079111.1|1304219_1305200_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040156.1|1305196_1305928_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1306057_1308631_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852119.1|1314418_1315717_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001467872.1|1315713_1316037_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001312028.1|1316082_1317438_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082935.1|1317551_1320212_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001296305.1|1320243_1320942_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1321010_1321430_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|1321636_1322674_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1322721_1323411_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|1323715_1324099_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189207.1|1324154_1324742_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001296304.1|1324844_1325726_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1325758_1327093_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|1327224_1327962_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	1709565	1773574	5255498	protease,transposase	Escherichia_phage(30.77%)	59	NA	NA
WP_000849214.1|1709565_1710054_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686738.1|1710461_1710956_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557384.1|1710945_1711209_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778067.1|1711205_1713692_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_112032056.1|1713698_1714394_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013499.1|1714380_1715244_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835174.1|1715240_1715690_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|1715699_1716302_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|1716320_1716938_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971730.1|1716934_1717597_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001296242.1|1717638_1718376_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|1718372_1718582_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|1718578_1719058_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982445.1|1719054_1720998_+	cytochrome c-type biogenesis heme lyase CcmF	NA	NA	NA	NA	NA
WP_000824439.1|1720994_1721552_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211575.1|1721548_1722601_+	cytochrome c-type biogenesis thiol:disulfide oxidoreductase CcmH	NA	NA	NA	NA	NA
WP_001113641.1|1722635_1723283_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000256203.1|1724807_1726568_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135664.1|1726587_1726815_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050789.1|1726996_1728004_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494186.1|1728142_1728427_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578064.1|1728551_1730312_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
WP_001234850.1|1730461_1731157_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213379.1|1731184_1732375_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_000202798.1|1732708_1733053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194884.1|1733056_1734646_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
WP_000088892.1|1734647_1735673_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000501604.1|1735672_1736767_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001554206.1|1736767_1738582_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000470587.1|1738663_1740220_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000241011.1|1740400_1740967_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296239.1|1741378_1742092_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198798.1|1742130_1743117_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296238.1|1743234_1744701_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
WP_001136827.1|1744923_1745496_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_001296237.1|1745650_1745905_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000552003.1|1745901_1747083_-	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_000487246.1|1747450_1748581_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000091263.1|1748580_1749519_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000854422.1|1749535_1751227_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001207098.1|1751682_1752624_+	pseudouridine kinase	NA	NA	NA	NA	NA
WP_001293146.1|1752611_1753550_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_000353897.1|1753643_1754894_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000658608.1|1754960_1755659_-	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_000415422.1|1755788_1756730_+	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000999817.1|1756997_1758086_-	sugar kinase	NA	NA	NA	NA	NA
WP_000873880.1|1758089_1758947_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
WP_000182056.1|1759020_1760070_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000548294.1|1760168_1761050_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112032052.1|1761254_1762724_+	lysine-specific permease	NA	NA	NA	NA	NA
WP_001067855.1|1764722_1765427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|1765570_1766125_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|1766255_1767086_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|1767717_1768422_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|1768528_1769389_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_165696372.1|1769401_1769944_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_165587319.1|1770035_1771191_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.6	3.8e-17
WP_001067855.1|1771137_1771842_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|1772869_1773574_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	1788439	1797884	5255498		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|1788439_1789576_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|1789572_1791576_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1791700_1792162_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1792202_1792673_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1792719_1793439_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1793435_1795121_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|1795342_1796074_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|1796133_1796241_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|1796221_1796953_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|1796957_1797884_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 6
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	1909343	1915646	5255498		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|1909343_1910738_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|1910912_1911806_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|1912178_1913264_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|1913263_1914163_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|1914220_1915099_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|1915103_1915646_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 7
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	1938793	1975091	5255498	transposase	Stx2-converting_phage(21.43%)	40	NA	NA
WP_001531805.1|1938793_1939252_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|1939362_1940790_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|1940998_1942165_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|1942283_1942757_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|1942954_1944013_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1944184_1944514_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|1944614_1944797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1945285_1945399_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1945411_1945606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|1945602_1945977_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|1946065_1946434_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|1946449_1947094_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1947112_1947334_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1947396_1947873_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1947888_1948362_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1948455_1948701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1948700_1949519_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1949739_1950150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1950598_1951345_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1951359_1952901_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|1953015_1953429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|1953564_1954635_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|1954631_1955537_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|1955533_1957918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|1958135_1958570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|1958998_1961164_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|1961174_1962164_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|1962182_1963241_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|1963237_1964005_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|1964058_1964316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|1964690_1966304_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1966334_1966685_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1966681_1967107_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001296206.1|1967386_1968532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|1969731_1969911_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|1970056_1971079_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|1971078_1971771_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000813432.1|1972796_1973399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|1973492_1973771_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|1973894_1975091_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	2041980	2118889	5255498	integrase,lysis,head,holin,tail,transposase,portal,protease,plate,capsid,terminase	Shigella_phage(33.33%)	97	2023782:2023797	2053811:2053826
2023782:2023797	attL	ATCAGTCGTGAAGAGG	NA	NA	NA	NA
WP_000060157.1|2041980_2043243_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_001311896.1|2043580_2044378_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021562665.1|2044613_2045639_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_021562666.1|2045638_2045842_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_021562667.1|2045900_2048375_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	58.2	2.7e-57
WP_021562668.1|2048454_2048658_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|2048654_2048843_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935598.1|2048853_2049708_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	2.1e-65
WP_021562669.1|2050246_2050621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021562670.1|2050632_2050785_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000787428.1|2050992_2051400_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|2051476_2051704_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|2051687_2052239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021562672.1|2052210_2053251_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	5.1e-90
WP_001309414.1|2053162_2053705_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_042091266.1|2053738_2054509_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.8	1.8e-87
2053811:2053826	attR	ATCAGTCGTGAAGAGG	NA	NA	NA	NA
WP_001141099.1|2054524_2054917_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|2054913_2055210_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209471.1|2055206_2055668_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	3.8e-37
WP_000403778.1|2055645_2056002_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_029701087.1|2056095_2056278_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	3.1e-27
WP_000753058.1|2056270_2056447_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001289994.1|2056443_2056959_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_001336454.1|2057040_2057259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2057517_2057673_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980988.1|2057889_2058141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405664.1|2058207_2058486_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_078175510.1|2058487_2059480_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	80.6	2.3e-156
WP_021562675.1|2059494_2060073_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	6.2e-45
WP_021562676.1|2060212_2061604_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001120503.1|2061700_2062036_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	5.7e-59
WP_001166530.1|2062039_2062516_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	97.4	8.6e-85
WP_000092300.1|2062512_2062980_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	84.5	1.8e-66
WP_071813842.1|2063349_2063694_+	DUF2441 domain-containing protein	NA	I6PCV9	Cronobacter_phage	47.3	5.9e-27
WP_001566776.1|2063765_2064116_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_001566775.1|2064241_2064736_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	97.6	1.6e-86
WP_064760988.1|2064969_2066466_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	4.1e-290
WP_001566773.1|2066462_2066624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001566771.1|2066613_2067840_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	95.3	3.0e-230
WP_000999828.1|2067832_2068432_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_001566770.1|2068446_2069664_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	2.2e-161
WP_000924830.1|2069741_2070065_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
WP_001566769.1|2070061_2070472_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	92.6	2.2e-68
WP_000224835.1|2070446_2070953_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_001566768.1|2070949_2071510_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	97.8	9.8e-104
WP_000497751.1|2071518_2071689_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001566767.1|2071672_2073169_+|tail	phage tail sheath protein	tail	S5FKL0	Shigella_phage	98.8	7.5e-276
WP_000090998.1|2073168_2073525_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571713.1|2073521_2073845_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_001566766.1|2073929_2075831_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
WP_001566765.1|2075895_2076384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001566763.1|2076440_2077814_+|tail	phage tail/DNA circulation protein	tail	U5P4I0	Shigella_phage	97.3	1.5e-243
WP_001566762.1|2077810_2078890_+	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	7.7e-206
WP_021562678.1|2078889_2079438_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000424732.1|2079437_2079863_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001566759.1|2079849_2080908_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	2.5e-201
WP_001566758.1|2080898_2081483_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	4.6e-112
WP_021562679.1|2081486_2083862_+|tail	tail fiber domain-containing protein	tail	O22004	Shigella_phage	71.8	1.1e-47
WP_001007778.1|2085321_2085972_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_099156434.1|2086232_2087580_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001240063.1|2087664_2088300_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740067.1|2088300_2089305_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|2089413_2089827_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|2089959_2090631_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826711.1|2090630_2091989_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218217.1|2092096_2092948_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824383.1|2093540_2094656_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_001330593.1|2095221_2095587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296176.1|2095626_2096322_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001157265.1|2096388_2097807_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|2097787_2098258_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212226.1|2098246_2099167_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2099339_2100257_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2100335_2100518_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001531784.1|2100688_2102383_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491527.1|2102379_2103195_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2103490_2103718_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|2103826_2104069_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103992.1|2104112_2104736_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983988.1|2105025_2105811_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2105819_2106089_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253318.1|2106098_2106836_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001313947.1|2106835_2107201_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282103.1|2107203_2107617_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2107613_2108618_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2108622_2109087_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620069.1|2109191_2110319_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2110315_2110759_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213308.1|2110777_2112151_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282677.1|2112150_2112837_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2112829_2113825_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994425.1|2113817_2115476_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274299.1|2115690_2116005_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|2116348_2116681_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001310919.1|2116849_2117401_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879824.1|2117410_2118208_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001347174.1|2118364_2118889_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 9
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	2137133	2270686	5255498	integrase,lysis,head,tRNA,holin,tail,portal,plate,capsid,terminase	Enterobacteria_phage(36.46%)	157	2166792:2166809	2276885:2276902
WP_001531780.1|2137133_2138150_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2138118_2138382_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2138591_2138774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078175506.1|2138773_2139343_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2139339_2141556_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2141586_2141907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2142917_2143331_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2143429_2143660_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2143718_2144195_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2144234_2144459_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2144455_2145211_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|2145200_2146616_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2146654_2147065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2147066_2147303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2147299_2147611_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2147607_2147832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2148513_2149302_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2149476_2150400_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|2151587_2152286_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|2152748_2153354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2153363_2153852_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|2154250_2154484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2154727_2155369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2155520_2155700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2155777_2156374_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2156370_2156664_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2156663_2157335_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2157447_2157831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2157830_2158103_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2158102_2158582_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2158589_2158784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2158843_2159089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2159457_2160024_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2160010_2161873_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2161872_2162106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2162102_2163677_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2163676_2164984_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2164983_2165313_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2165371_2166406_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2166440_2166860_+	DNA-packaging protein	NA	NA	NA	NA	NA
2166792:2166809	attL	CGTGAAATTGTTGTTGAT	NA	NA	NA	NA
WP_001531773.1|2166856_2167237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2167268_2167949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2167945_2168482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|2168462_2169365_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|2169367_2169709_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2169705_2170626_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2170628_2171255_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|2171247_2172432_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2172431_2172821_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2172817_2174320_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2174337_2174850_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|2174862_2175144_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2175252_2176893_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2176928_2177318_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2177479_2177704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|2178918_2179338_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|2179809_2180475_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000797555.1|2180525_2181737_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2181927_2182167_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2182204_2182702_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2182873_2183197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2183460_2183547_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2183661_2183913_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2183990_2184494_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2185288_2186278_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|2186347_2187862_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|2187876_2188863_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|2189029_2189830_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|2189804_2191229_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|2191235_2191664_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2192443_2192794_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2192796_2193375_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2193501_2194389_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2194385_2195312_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|2195316_2197281_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2197301_2197805_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|2197949_2199611_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|2199901_2200762_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2200764_2201814_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2201828_2202218_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|2202228_2202873_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|2203061_2204210_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|2204202_2206281_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|2206280_2206673_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|2206725_2208459_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|2208674_2209241_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2209254_2210001_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|2210388_2211489_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|2211513_2213943_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|2213978_2214950_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2214946_2215690_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2215730_2216126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042040108.1|2216178_2216949_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362005.1|2216930_2218244_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_000528718.1|2218299_2218536_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2218544_2218691_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2218694_2218937_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_021519728.1|2219021_2219366_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.2	1.4e-57
WP_021519727.1|2219362_2219530_-	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	80.8	3.6e-14
WP_000224227.1|2219540_2219804_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_021519726.1|2219805_2220216_-	hypothetical protein	NA	C6ZR27	Salmonella_phage	49.6	2.7e-18
WP_021519725.1|2220217_2221033_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	96.4	1.3e-141
WP_021519724.1|2221019_2221334_-	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_000179800.1|2221287_2221605_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001199104.1|2221853_2222435_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_021519723.1|2222440_2222623_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	2.9e-09
WP_021519722.1|2222817_2223024_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	95.6	2.0e-30
WP_000608402.1|2223311_2223815_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	95.5	1.2e-63
WP_000838344.1|2223918_2224575_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_001090259.1|2224910_2225618_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	86.0	9.1e-107
WP_029700954.1|2225726_2226389_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	84.9	4.7e-97
WP_029700955.1|2226385_2227237_+	hypothetical protein	NA	Q8HA97	Salmonella_phage	68.9	1.9e-103
WP_000626792.1|2227233_2227428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|2227424_2227649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092417.1|2227941_2228928_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	1.7e-55
WP_000988266.1|2228938_2229838_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_029700958.1|2229834_2231235_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	93.9	3.0e-250
WP_001520742.1|2231231_2231489_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	4.4e-35
WP_001205451.1|2231488_2231857_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	2.2e-56
WP_001025378.1|2231920_2232961_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.9	9.3e-100
WP_000052342.1|2232929_2233619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209290.1|2233621_2234779_-	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.4	2.3e-59
WP_000917767.1|2235032_2235230_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000284510.1|2237413_2237629_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193280.1|2237633_2237984_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_016248004.1|2238047_2238581_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	2.5e-101
WP_001082546.1|2238879_2239347_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|2239697_2239838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2239970_2240156_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102145.1|2240543_2241092_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_094083981.1|2241021_2242992_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.1e-262
WP_000259002.1|2242975_2243182_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_029701046.1|2243178_2244771_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253935.1|2244760_2246266_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256835.1|2246302_2246650_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522601.1|2246707_2247736_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000201501.1|2247787_2248171_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001402971.1|2248163_2248517_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	9.6e-41
WP_001575631.1|2248531_2249107_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_000683079.1|2249103_2249499_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2249506_2250259_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|2250272_2250704_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|2250730_2251144_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_023909007.1|2251124_2253698_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000847298.1|2253694_2254024_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_033561175.1|2254023_2254722_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	6.4e-129
WP_000194723.1|2254732_2255476_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122997661.1|2255421_2256054_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.3	1.5e-100
WP_134163207.1|2257525_2259871_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	98.6	0.0e+00
WP_001228314.1|2259938_2260538_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_106493736.1|2260688_2263715_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_000631346.1|2263711_2264614_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.9	4.0e-99
WP_029701058.1|2264622_2265207_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_029701056.1|2265319_2266690_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000545005.1|2266667_2267219_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000891625.1|2268037_2268604_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2268913_2270686_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
2276885:2276902	attR	ATCAACAACAATTTCACG	NA	NA	NA	NA
>prophage 10
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	2767591	2837308	5255498	integrase,head,holin,tail,transposase,portal,protease,capsid,terminase	Stx2-converting_phage(24.56%)	79	2796479:2796493	2838272:2838286
WP_000422062.1|2767591_2768641_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|2768860_2769619_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|2769615_2770206_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2770262_2770571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622024.1|2770580_2771603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|2771772_2772648_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|2772860_2774756_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2774783_2775404_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|2775400_2776282_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2776419_2776464_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|2776555_2778118_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|2778117_2779713_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|2779716_2781075_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|2781086_2782280_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|2782279_2783086_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|2783461_2783737_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2783733_2784291_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000251936.1|2784417_2784588_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|2784702_2784972_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2785028_2785697_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|2785895_2786078_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_022645053.1|2786305_2787091_+	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_000972097.1|2787092_2787626_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|2787656_2788184_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_071550361.1|2788199_2791106_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001016257.1|2791567_2792314_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2792328_2793870_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|2794512_2797986_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
2796479:2796493	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|2798328_2798961_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|2798906_2799650_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|2799660_2800359_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|2800358_2800700_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|2800692_2803935_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|2803982_2804192_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2804287_2804662_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2804676_2805393_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2805459_2805804_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2805800_2806247_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2806243_2806594_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2806603_2806930_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|2806926_2809512_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2809457_2809679_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|2809723_2811661_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|2811724_2813386_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|2813382_2813946_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|2814236_2814602_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|2814643_2814844_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|2815042_2815258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2815343_2815529_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|2815750_2815837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2816391_2816925_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|2817030_2817303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2817268_2817613_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2817617_2817833_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|2817983_2819837_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|2820097_2820433_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|2820713_2820845_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|2821646_2822696_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|2822847_2823045_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|2823271_2824093_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|2824089_2824470_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|2824470_2825526_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2825527_2825800_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2825967_2826180_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2826360_2827026_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2827200_2827626_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2827641_2828412_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2828433_2829180_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|2829186_2830149_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|2830171_2830597_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2830593_2830809_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|2830858_2831575_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|2831847_2832003_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|2832162_2832381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|2832946_2833135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|2833131_2833323_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|2833415_2835887_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|2835951_2836200_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2836177_2837308_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2838272:2838286	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 11
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	2975269	3023518	5255498	integrase,lysis,head,tRNA,holin,tail,transposase,portal,capsid,terminase	Enterobacteria_phage(54.72%)	61	2994053:2994067	3025187:3025201
WP_000654172.1|2975269_2975548_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|2975544_2977566_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|2977624_2981107_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|2981167_2981770_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|2981706_2982450_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|2982454_2983153_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|2983152_2983482_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|2983478_2986040_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|2986032_2986467_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|2986448_2986871_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|2986886_2987627_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|2987634_2988030_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|2988026_2988605_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|2988616_2988970_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|2988981_2989380_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|2989421_2990447_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|2990502_2990835_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|2990844_2992164_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|2992144_2993746_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|2993742_2993949_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|2993945_2995871_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
2994053:2994067	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|2995845_2996391_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|2996954_2997137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2997343_2997670_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2998150_2998444_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2998534_2998717_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|2998933_2999410_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|2999396_2999702_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|3000023_3000713_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|3000709_3000850_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|3000846_3001209_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|3001205_3001496_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|3001488_3001659_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|3001658_3002114_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|3002110_3002212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029700859.1|3002561_3003593_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000080195.1|3003619_3005233_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3005263_3005614_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3005610_3006036_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_022645049.1|3006181_3010447_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|3010696_3011398_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|3011394_3012324_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|3012410_3012950_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|3013019_3013250_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3013354_3014044_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3014639_3014846_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|3014921_3015218_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|3015223_3016009_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3016005_3016686_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|3016682_3016865_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|3016837_3017029_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|3017039_3017321_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|3017419_3017641_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|3017640_3017967_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|3017950_3018190_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|3018329_3018566_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|3018555_3019698_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|3019811_3021062_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|3021233_3021887_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3021896_3022358_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|3022411_3023518_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3025187:3025201	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 12
NZ_CP049085	Escherichia coli strain p4A chromosome, complete genome	5255498	3220626	3345149	5255498	integrase,head,tRNA,holin,tail,transposase,portal,protease,plate,capsid,terminase	Enterobacteria_phage(41.67%)	142	3288014:3288033	3327184:3327203
WP_001295930.1|3220626_3221412_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3221547_3222327_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|3222303_3223197_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|3223350_3224097_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|3224093_3224276_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|3224327_3225560_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|3225596_3226583_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3226579_3228328_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|3228364_3230629_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3230834_3231119_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3231278_3232952_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3233062_3233746_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|3233918_3234701_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|3234844_3235234_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|3235205_3235655_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|3235656_3235863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|3235852_3236083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|3236079_3236763_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|3236759_3236975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|3236989_3237286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|3237295_3237568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3237856_3238387_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|3238414_3238684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|3238686_3239853_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|3239863_3241633_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|3241648_3241966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|3241965_3242886_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|3242896_3243205_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|3243257_3243446_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|3243539_3243896_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|3244012_3244777_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|3244967_3245183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|3245181_3245586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|3245561_3246290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|3246420_3246771_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|3246773_3247514_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|3247497_3248148_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|3248144_3248471_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|3248470_3248782_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|3248781_3249327_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_001295924.1|3249386_3250919_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000090684.1|3250918_3252415_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|3252395_3253217_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|3253219_3253678_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|3253892_3255008_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|3255022_3255976_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|3255985_3256324_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|3256325_3256772_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|3256771_3257236_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|3257232_3257487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|3257476_3258904_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_162832341.1|3258900_3259425_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000110114.1|3259427_3259709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|3259806_3260142_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|3260065_3260224_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|3260299_3263251_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|3263250_3264135_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|3264131_3264347_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|3264334_3265489_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|3265485_3266082_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|3266136_3266484_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|3266474_3267578_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|3267570_3268149_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001554039.1|3268151_3269432_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	43.8	7.8e-40
WP_000072165.1|3269438_3270053_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001486917.1|3270052_3270535_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_064767240.1|3270575_3271016_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|3271075_3271648_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|3271903_3273187_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|3273257_3274346_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|3274544_3275237_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|3275366_3277127_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|3277532_3278390_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3278444_3280727_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3280918_3281659_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|3281755_3282904_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3283217_3283844_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|3283879_3284743_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3284744_3285362_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3285372_3287817_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
3288014:3288033	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023739.1|3288116_3289109_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|3289178_3289520_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|3289624_3290146_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|3290150_3290573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|3290579_3290771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|3290908_3291259_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_112034479.1|3291269_3291455_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.5	8.1e-15
WP_000514277.1|3292336_3292579_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|3292575_3292689_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|3292782_3293193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3293216_3293420_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|3293416_3293683_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|3293679_3293979_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_023142408.1|3293990_3294608_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000599382.1|3294604_3294970_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|3294976_3297799_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|3297875_3298835_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|3298839_3299154_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|3299237_3300080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|3300119_3300617_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000236495.1|3301340_3301865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|3301879_3302926_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|3302925_3304677_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|3304831_3305668_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|3305691_3306744_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|3306789_3307590_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|3307691_3308186_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|3308185_3308386_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|3308388_3308712_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|3308708_3309101_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|3309097_3309493_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|3309631_3311509_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|3311532_3312000_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|3311992_3312628_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|3312624_3313206_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|3313202_3313553_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|3313556_3314453_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|3314445_3314976_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001554335.1|3317212_3317740_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|3317768_3318302_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_000905061.1|3318806_3319406_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|3319434_3319923_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|3319935_3322743_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|3322729_3322885_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|3322893_3323268_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|3323323_3323836_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|3323835_3325020_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|3325177_3326287_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|3326327_3326588_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|3326779_3326920_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|3327225_3328518_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
3327184:3327203	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067797.1|3328608_3329952_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3329962_3330574_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|3330732_3334839_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3334973_3335468_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|3336011_3336977_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|3337099_3338866_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|3338866_3340588_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001241674.1|3340629_3341334_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3341618_3341837_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3342521_3344798_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3344828_3345149_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
