The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	1018684	1031867	4764184		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1018684_1019446_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1019439_1020066_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1020205_1021345_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1021407_1022400_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1022493_1023858_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1023946_1024723_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1024727_1025366_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1025362_1026625_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1026621_1027530_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1027725_1028493_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1028543_1029200_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1029305_1031867_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	1387501	1449576	4764184	integrase,protease,terminase,portal,head,capsid,transposase,tail,holin	Klebsiella_phage(21.57%)	69	1381660:1381675	1423372:1423387
1381660:1381675	attL	GATACAGCGGCAGCAC	NA	NA	NA	NA
WP_023149820.1|1387501_1388677_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	1.9e-202
WP_023149821.1|1388713_1390030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071788171.1|1390065_1390326_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.1	1.4e-12
WP_165696033.1|1390261_1390783_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	61.6	8.4e-33
WP_024176405.1|1390775_1390976_-	hypothetical protein	NA	A0A1U8QWK2	Salmonella_phage	55.0	2.7e-08
WP_023149824.1|1390972_1391212_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	84.8	4.7e-31
WP_000158002.1|1391204_1391408_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
WP_023149825.1|1391404_1392190_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_023149826.1|1392189_1392489_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	3.2e-13
WP_019705289.1|1392877_1393522_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_024176406.1|1393616_1393826_+	cell division protein	NA	NA	NA	NA	NA
WP_165696034.1|1393971_1394283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149828.1|1394353_1394821_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.8	7.4e-65
WP_001208720.1|1395058_1395238_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_024176409.1|1395227_1396181_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	3.7e-103
WP_061363443.1|1396177_1396987_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.6e-110
WP_023149832.1|1397011_1397992_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
WP_023149833.1|1398010_1398355_+	antitermination protein Q lambdoid prophage DLP12	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	3.0e-55
WP_023149834.1|1398391_1398853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149835.1|1398852_1399170_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_023149836.1|1399166_1400267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|1401013_1401313_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_023149837.1|1401309_1401849_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	9.7e-101
WP_004190674.1|1401845_1402190_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_023149838.1|1402186_1402462_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	73.6	1.5e-09
WP_024176412.1|1402969_1403170_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	2.9e-18
WP_024176425.1|1403913_1404135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177166.1|1404360_1404606_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_004177164.1|1404661_1405003_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
WP_004177162.1|1405185_1405650_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_023149918.1|1405603_1407346_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.0	6.9e-140
WP_023149917.1|1407345_1408653_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	3.5e-213
WP_019705411.1|1408666_1409521_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.4	2.7e-137
WP_023149916.1|1409531_1410749_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	90.8	1.8e-203
WP_165696035.1|1410791_1411034_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	68.1	1.6e-10
WP_023149914.1|1411033_1411360_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
WP_023149913.1|1411371_1411710_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	9.2e-41
WP_019705270.1|1411706_1412156_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|1412152_1412500_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_024176424.1|1412556_1413261_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	3.3e-80
WP_023149911.1|1413291_1413696_+|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_023149910.1|1413698_1414004_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	8.1e-28
WP_016530182.1|1414076_1414310_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_023149909.1|1414370_1417757_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	3.0e-304
WP_004884312.1|1417778_1418252_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_004864228.1|1418238_1418715_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_023149908.1|1418727_1419108_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	78.6	3.3e-55
WP_023149907.1|1419104_1422182_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_165696036.1|1422258_1425186_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	62.8	1.5e-38
1423372:1423387	attR	GTGCTGCCGCTGTATC	NA	NA	NA	NA
WP_165696037.1|1425232_1426132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1427955_1428660_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000019444.1|1429033_1430014_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.0e-185
WP_000609089.1|1430861_1431755_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	3.3e-45
WP_000154260.1|1432199_1433216_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.6	9.1e-84
WP_001048111.1|1433249_1435466_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000665069.1|1435462_1436242_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000018742.1|1436248_1437001_+	O89/0101/0162 family O-antigen ABC transporter ATP-binding protein Wzt	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	1.1e-12
WP_001581568.1|1437066_1438098_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000684771.1|1438107_1439262_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000440491.1|1439309_1440500_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044067175.1|1440503_1442585_+	glycosyltransferase	NA	A0A2K9L4U1	Tupanvirus	27.7	2.5e-19
WP_000654804.1|1442802_1443771_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_001333498.1|1444369_1444627_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_000217395.1|1444797_1445289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000262446.1|1445374_1445737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1445821_1446526_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001130654.1|1446663_1447782_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|1448234_1448387_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|1448463_1449576_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	1728262	1796987	4764184	integrase,protease,terminase,portal,head,capsid,tail,plate,lysis	Salmonella_phage(68.0%)	80	1725324:1725337	1749170:1749183
1725324:1725337	attL	CACCACTTCGCTGT	NA	NA	NA	NA
WP_000290952.1|1728262_1729294_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	9.5e-105
WP_000900883.1|1729482_1729674_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001346406.1|1729689_1730259_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|1730404_1730608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1730672_1731182_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_063082202.1|1731189_1731486_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_063082203.1|1731603_1731945_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	8.7e-55
WP_063082204.1|1732012_1732246_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000752619.1|1732245_1732473_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_021570731.1|1732469_1733327_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.3e-160
WP_064770591.1|1733323_1735738_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001154431.1|1735891_1736080_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1736090_1736324_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_021542067.1|1736829_1737948_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_064770590.1|1738203_1739877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032248696.1|1739908_1740937_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.5	6.9e-172
WP_001098431.1|1740936_1742703_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216257.1|1742845_1743679_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_064770589.1|1743695_1744754_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_064770588.1|1744757_1745408_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	9.6e-111
WP_000673520.1|1745503_1745968_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|1745967_1746171_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1746174_1746390_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069895.1|1746370_1746883_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	4.4e-87
WP_064770587.1|1746884_1747262_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	5.1e-16
WP_064770586.1|1747258_1747687_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	72.3	2.3e-44
WP_069970521.1|1747782_1748214_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_064770584.1|1748206_1748653_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.3e-62
WP_000993775.1|1748721_1749300_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
1749170:1749183	attR	ACAGCGAAGTGGTG	NA	NA	NA	NA
WP_000177590.1|1749296_1749656_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_023211146.1|1749642_1750551_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	5.0e-142
WP_001086824.1|1750543_1751149_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_064770583.1|1751145_1752630_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	3.0e-152
WP_001340317.1|1752632_1752866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032248699.1|1752846_1753257_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	4.9e-20
WP_044077513.1|1753259_1753766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064770565.1|1753796_1754363_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	4.9e-87
WP_001420861.1|1754505_1755678_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001207660.1|1755687_1756203_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281010.1|1756257_1756560_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.7e-38
WP_000763311.1|1756574_1756694_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_064770564.1|1756686_1759764_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000980413.1|1759760_1760246_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011797.1|1760242_1761343_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000972392.1|1761433_1761652_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	4.4e-20
WP_001024876.1|1761887_1763573_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1763842_1764220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|1764249_1764507_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1764666_1764954_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1764937_1765660_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1765720_1766623_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1766710_1767187_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1767537_1768650_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1768744_1769878_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|1769887_1770841_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1770837_1771683_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1771742_1772231_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1772271_1773399_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_001352074.1|1773597_1774329_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1774619_1775288_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1775287_1776004_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1776010_1776742_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1776759_1777488_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1777705_1778221_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1778346_1778670_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1778666_1779497_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1779493_1780507_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1780605_1782036_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566366.1|1782046_1783048_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|1783084_1784803_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178676.1|1784935_1785904_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1785915_1787568_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1787711_1788611_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1789105_1789801_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599825.1|1790226_1791885_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001340333.1|1791881_1792832_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|1792988_1794104_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188144.1|1794100_1796047_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1796119_1796344_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1796666_1796987_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 4
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	2844880	2942271	4764184	integrase,protease,terminase,portal,head,transposase,capsid,tail,holin	Klebsiella_phage(34.55%)	108	2879772:2879831	2912877:2912941
WP_015674555.1|2844880_2845405_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879825.1|2845561_2846359_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|2846368_2846920_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_005098738.1|2847088_2847361_-	EmrE family multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_165696029.1|2847388_2848616_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_001301376.1|2849099_2849414_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994473.1|2849628_2851287_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2851279_2852275_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282706.1|2852267_2852954_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2852953_2854327_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2854345_2854789_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620097.1|2854785_2855913_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2856017_2856482_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_044067262.1|2856486_2857530_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2857526_2857940_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001059114.1|2857942_2858308_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2858307_2859045_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2859054_2859324_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983976.1|2859332_2860118_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_071527558.1|2861074_2861317_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2861425_2861653_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949118.1|2861950_2862766_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001581829.1|2862801_2864457_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	39.2	2.7e-16
WP_000009307.1|2864627_2864810_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2864888_2865806_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212247.1|2865978_2866899_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786003.1|2866887_2867358_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
WP_001157281.1|2867338_2868757_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.8	9.4e-103
WP_000365560.1|2868823_2869519_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.4e-06
WP_072146742.1|2869558_2869924_-	permease	NA	NA	NA	NA	NA
WP_000824371.1|2870491_2871550_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.1	3.3e-92
WP_001581832.1|2872141_2872993_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826783.1|2873100_2874459_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001340597.1|2874458_2875130_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000920132.1|2875262_2875676_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740078.1|2875783_2876788_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240088.1|2876788_2877424_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007765.1|2877680_2878331_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079084.1|2878673_2879204_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
2879772:2879831	attL	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAG	NA	NA	NA	NA
WP_044067271.1|2880106_2880433_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	4.3e-27
WP_023149922.1|2880435_2880675_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	3.4e-21
WP_001067855.1|2881228_2881933_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_044067351.1|2882350_2885419_-	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
WP_017880229.1|2885415_2885796_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_044067353.1|2885805_2886288_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	6.3e-83
WP_044067354.1|2886274_2886754_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	8.6e-93
WP_000019444.1|2887499_2888480_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.0e-185
WP_165696041.1|2888476_2888905_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	97.4	8.6e-60
WP_000115125.1|2888948_2889440_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_044067365.1|2889496_2889862_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	1.0e-61
WP_004216814.1|2889858_2890398_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_040213580.1|2890390_2890723_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.0e-56
WP_004143899.1|2890724_2890922_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|2890982_2891309_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|2891256_2891499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040174769.1|2891535_2892699_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	2.7e-212
WP_004216821.1|2892710_2893391_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_044067370.1|2893396_2894674_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.8	1.4e-246
WP_004143904.1|2894676_2896209_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|2896218_2896653_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_044067371.1|2896775_2896985_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	65.2	3.4e-17
WP_044067372.1|2896997_2897288_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	95.8	3.4e-52
WP_042950192.1|2897344_2897566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044067374.1|2897632_2897878_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	6.7e-33
WP_014837649.1|2898013_2898190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044067377.1|2898173_2898653_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	1.4e-58
WP_044067379.1|2898636_2898981_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	65.1	5.9e-35
WP_040186320.1|2899235_2899715_+	hypothetical protein	NA	F1C594	Cronobacter_phage	55.6	2.2e-40
WP_040186317.1|2899797_2900376_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	3.2e-49
WP_040186316.1|2900389_2901370_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	5.4e-134
WP_023317574.1|2901382_2901760_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
WP_072021077.1|2901769_2902474_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	59.2	8.5e-89
WP_044067381.1|2902470_2903385_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_023317571.1|2903341_2903554_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_000230161.1|2903791_2904253_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_016530206.1|2904278_2904476_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|2904580_2905228_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_044067386.1|2905675_2906593_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	8.9e-46
WP_044067387.1|2906682_2906982_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	2.1e-12
WP_044067388.1|2906981_2907767_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	7.6e-62
WP_044067390.1|2907894_2908239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040027457.1|2908231_2908714_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.6	9.4e-71
WP_044067392.1|2908710_2908980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067393.1|2908976_2909630_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	47.1	1.4e-40
WP_044067394.1|2909630_2910011_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	93.6	3.9e-64
WP_157839020.1|2910007_2911237_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	43.0	4.0e-49
WP_004184757.1|2911544_2911772_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_004184758.1|2911773_2912766_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_001302302.1|2913061_2913859_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2912877:2912941	attR	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACCGG	NA	NA	NA	NA
WP_000378546.1|2917510_2918827_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060228.1|2918928_2920383_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|2920725_2921442_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011022.1|2923833_2924784_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|2924885_2925803_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986345.1|2926259_2927195_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193803.1|2927256_2928336_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001333892.1|2928347_2929091_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973199.1|2929087_2929633_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000881502.1|2930556_2931489_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000656349.1|2931491_2932526_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_001221632.1|2934841_2935252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270979.1|2936415_2936808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|2937067_2937637_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001447094.1|2938381_2938558_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000840364.1|2938858_2939125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329787.1|2939193_2939472_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813456.1|2939566_2940169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333339.1|2940735_2942271_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
>prophage 5
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	2964197	2972078	4764184	transposase	Escherichia_phage(42.86%)	7	NA	NA
WP_096058022.1|2964197_2965178_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.2e-184
WP_044067410.1|2965650_2966817_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	1.2e-111
WP_004175260.1|2966996_2967551_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175259.1|2967565_2968456_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|2968487_2969357_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_023149889.1|2969383_2970448_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	7.5e-105
WP_023149888.1|2970671_2972078_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	2.8e-38
>prophage 6
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	3067659	3077877	4764184	transposase	Enterobacteria_phage(75.0%)	11	NA	NA
WP_001292769.1|3067659_3068796_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001446943.1|3068792_3070793_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_103758571.1|3070946_3071644_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
WP_000741419.1|3071685_3072156_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	3.6e-75
WP_000950409.1|3072195_3072666_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|3072712_3073432_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3073428_3075114_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3075335_3076067_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3076126_3076234_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3076214_3076946_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569356.1|3076950_3077877_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 7
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	3559516	3684317	4764184	integrase,lysis,terminase,portal,transposase,capsid,head,tail,holin	Enterobacteria_phage(34.43%)	117	3612530:3612544	3680415:3680461
WP_113708090.1|3559516_3560745_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.2e-177
WP_001333670.1|3561075_3561891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692754.1|3562133_3563183_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
WP_000023635.1|3564251_3564857_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013892.1|3565114_3565612_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001084399.1|3565703_3566636_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301264.1|3566677_3567766_-	DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL	NA	NA	NA	NA	NA
WP_120795374.1|3568260_3568335_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|3568640_3570674_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3570802_3571390_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3571403_3572876_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3572889_3574560_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3574772_3575441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3575683_3576379_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3576371_3577799_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3577809_3578529_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3579055_3579910_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3580135_3581461_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3581569_3581806_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3581817_3582411_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3583000_3583852_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020221.1|3583991_3588248_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3589363_3589465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3589828_3590092_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3590091_3590232_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3590266_3590494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000654804.1|3592634_3593603_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_000730972.1|3593776_3594364_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3594421_3595090_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3595115_3597641_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3597630_3599274_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3599242_3599953_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3600265_3600595_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3600842_3601457_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3601874_3602564_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3602560_3603517_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3603513_3605712_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3605721_3606678_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3606656_3607067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032739138.1|3607740_3609276_+	recombinase family protein	NA	NA	NA	NA	NA
WP_032673146.1|3609276_3610149_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044067310.1|3610157_3611030_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044067311.1|3611033_3612638_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
3612530:3612544	attL	CCTCATCTATGTTGA	NA	NA	NA	NA
WP_001415597.1|3612658_3613291_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
3612530:3612544	attL	CCTCATCTATGTTGA	NA	NA	NA	NA
WP_012134292.1|3613287_3614400_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_044067315.1|3614392_3615781_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.4	2.4e-50
WP_023279391.1|3615780_3616053_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_044067317.1|3616737_3617250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157695.1|3617721_3618816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067131.1|3618808_3620053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279388.1|3620236_3620674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067136.1|3620642_3621914_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_044067138.1|3622218_3622884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067140.1|3622941_3623355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052044.1|3623452_3623851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077779991.1|3625165_3626260_-	conserved DNA-binding protein	NA	NA	NA	NA	NA
WP_044067885.1|3626256_3627570_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032739159.1|3627571_3628777_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001075424.1|3629157_3629364_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001412615.1|3629454_3630312_-	hypothetical protein	NA	NA	NA	NA	NA
3629373:3629387	attR	CCTCATCTATGTTGA	NA	NA	NA	NA
WP_001412614.1|3630460_3631675_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.4	3.8e-129
3629373:3629387	attR	CCTCATCTATGTTGA	NA	NA	NA	NA
WP_001619161.1|3632643_3633489_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
WP_001041461.1|3633481_3633880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|3634257_3635420_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000834404.1|3636736_3638626_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001185479.1|3639228_3640260_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.3	1.2e-11
WP_165696045.1|3644413_3645955_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	3.1e-293
WP_000612626.1|3646003_3646351_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|3646347_3646752_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_061363450.1|3647248_3650647_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
WP_122991788.1|3650707_3651310_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_061363449.1|3651246_3651990_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	2.6e-144
WP_000459458.1|3652625_3653060_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479155.1|3653041_3653464_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_001446995.1|3653479_3654220_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	2.1e-130
WP_000683105.1|3654227_3654623_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975085.1|3654619_3655198_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	5.9e-80
WP_000753001.1|3655209_3655563_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_000158886.1|3655574_3655970_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.2e-52
WP_000063273.1|3656011_3657037_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_001380322.1|3657092_3657425_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000123280.1|3657434_3658754_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_096058034.1|3658734_3660336_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.0e-307
WP_000198149.1|3660332_3660539_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027290.1|3660535_3662461_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453576.1|3662435_3662981_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001663509.1|3663369_3663603_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3663659_3664070_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3664420_3664573_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001446997.1|3664560_3664998_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_001197767.1|3664994_3665471_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.5	1.9e-84
WP_001120502.1|3665474_3665810_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_021548833.1|3665886_3666939_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.3	6.3e-205
WP_000917724.1|3667089_3667293_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001446998.1|3667561_3668503_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|3668524_3668974_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|3669009_3669378_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001571227.1|3669392_3670382_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	9.5e-195
WP_001061412.1|3670389_3671187_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.5e-150
WP_061363473.1|3671206_3671596_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	1.3e-67
WP_000210148.1|3671592_3671919_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_001573323.1|3671918_3672413_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000104985.1|3672409_3673366_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	96.5	7.6e-149
WP_001250269.1|3673355_3673535_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515847.1|3673710_3674262_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
WP_000205494.1|3674299_3674500_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3674597_3675224_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000559916.1|3675451_3675967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3676436_3676799_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_096058035.1|3676864_3677689_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_000008200.1|3677816_3678353_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3678343_3678706_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3678705_3679011_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_000051887.1|3679237_3680401_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3680605_3681859_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3681870_3682974_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3683261_3684317_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 8
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	3694451	3753710	4764184	tRNA,transposase,plate	uncultured_Caudovirales_phage(20.0%)	49	NA	NA
WP_000006255.1|3694451_3694949_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3695124_3695874_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3696083_3696344_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3696346_3696625_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3696780_3697521_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3697491_3698259_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3698464_3699043_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3699282_3701727_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3701769_3702243_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3702396_3703167_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3703207_3704344_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3704774_3705167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|3705144_3709377_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_000103354.1|3709452_3711594_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3711803_3712322_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3713016_3713517_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3713551_3713776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3713826_3715302_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3715308_3715722_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3715725_3717576_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3717539_3718622_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113719.1|3718646_3719927_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3719923_3720448_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246442.1|3720450_3721782_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3721786_3722548_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3722556_3725322_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3725318_3726062_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3726066_3727479_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3727587_3731022_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3731032_3732385_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3732408_3732891_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3732934_3733849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236645.1|3733858_3734338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3734474_3735260_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3735796_3736528_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3736592_3737060_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3737056_3737779_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3737812_3738568_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3738639_3739998_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3740045_3740669_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3740672_3741473_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3741713_3742628_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3742624_3743428_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3749188_3749764_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3749951_3750983_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3750975_3751629_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3751668_3752484_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3752601_3753006_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3753002_3753710_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP049081	Escherichia coli strain p10A chromosome, complete genome	4764184	4091123	4166171	4764184	integrase,transposase,tRNA,protease	Enterobacteria_phage(21.05%)	58	4120381:4120397	4140478:4140494
WP_001254928.1|4091123_4092275_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001293435.1|4093331_4095329_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001446913.1|4095391_4096669_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|4096916_4097573_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126123275.1|4097753_4097864_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001390361.1|4097972_4098254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001387298.1|4098980_4099079_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|4099080_4099863_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4100168_4101089_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|4101116_4102433_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|4102444_4103458_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000422741.1|4104774_4105200_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4105196_4105547_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|4105577_4107191_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_001446914.1|4107801_4108041_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|4108251_4109508_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|4109520_4109808_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|4109823_4110267_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416153.1|4110537_4111569_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_001375333.1|4112919_4113354_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001352291.1|4114262_4114589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228394.1|4114798_4115143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981734.1|4115497_4116847_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102863.1|4116867_4117785_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_001041752.1|4117796_4118993_-	CoA transferase	NA	NA	NA	NA	NA
WP_000018562.1|4119229_4121143_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
4120381:4120397	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_000255944.1|4122176_4123199_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4123198_4123978_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001254928.1|4125168_4126320_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_000772679.1|4130532_4131798_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
WP_001352285.1|4132241_4133261_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
WP_001295681.1|4135052_4136135_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584107.1|4136134_4137235_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4137501_4139013_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4139366_4139810_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|4139809_4142665_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
4140478:4140494	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_000079655.1|4142720_4143917_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059412.1|4144109_4144613_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4144658_4145075_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4145236_4146241_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_044067673.1|4146296_4147595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326836.1|4148790_4149243_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|4149387_4149981_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500689.1|4150051_4150765_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4150895_4151291_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4151571_4151706_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4151709_4152645_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4152657_4153119_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4153191_4153578_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471885.1|4153783_4156480_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.6	8.2e-47
WP_001387276.1|4156620_4156674_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|4156858_4157806_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|4157924_4159346_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001301172.1|4159395_4161051_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|4161444_4163583_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|4163740_4164205_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|4164249_4164636_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4164818_4166171_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP049082	Escherichia coli strain p10A plasmid p10A_p1, complete sequence	143163	1262	59789	143163	protease,bacteriocin,integrase,transposase	Escherichia_phage(36.84%)	59	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|2123_2312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001332050.1|6255_6645_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7424_7583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|7766_8979_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_001259759.1|10160_10364_-|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014640552.1|10341_10578_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|11041_11323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|11680_12208_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|12451_13267_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|13316_13670_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|13847_14639_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|14635_15325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|15368_15719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000952217.1|16272_17361_+	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000698737.1|17362_19588_+	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000963206.1|19637_20537_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000111771.1|20526_20817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|21112_21343_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|21339_21756_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350638.1|21917_24056_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000608644.1|24580_25843_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|26098_26974_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|27020_27353_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001089727.1|27530_28610_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|28714_29038_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071819239.1|29198_29681_+	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.9e-40
WP_001067855.1|29571_30276_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|31913_32156_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|32187_32838_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_077248803.1|32943_34143_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|34174_35059_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|35196_35589_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|37223_37928_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|38467_39283_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|39433_40138_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|40244_40949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|41021_41261_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|41406_42270_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|42307_42553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|43021_43813_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|43815_44091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|44992_45325_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|45494_46286_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001456218.1|46374_47217_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_072042932.1|47417_47651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|47681_49175_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|49286_49592_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|49619_50834_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|51050_51935_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|52536_53241_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067834.1|55664_56369_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_165587319.1|56314_57471_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	30.6	1.3e-17
WP_002063889.1|57562_58105_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|58117_58978_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067834.1|59084_59789_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
