The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	824327	879903	5294134	transposase,integrase,protease	Stx2-converting_phage(38.46%)	37	877889:877903	886481:886495
WP_000422741.1|824327_824753_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|824749_825100_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|825130_826744_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000997995.1|826902_828441_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|829568_829919_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|829915_830341_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|830712_830850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|831001_831919_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|831952_832828_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|832876_834349_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|834352_835183_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|835228_835939_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|835951_837061_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|837122_838046_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|838081_838816_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|838915_839902_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|840053_841281_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|841781_843872_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001296383.1|844733_844976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|845266_845626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|845629_845845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|850625_851777_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|852373_856261_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_011076574.1|856510_856654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973516.1|857204_859406_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|859487_860765_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|860761_862504_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|862503_863451_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|863451_865176_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|865311_866505_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|867222_867651_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|867690_868251_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|868292_868553_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|870386_870500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006213.1|872367_872601_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_000147017.1|877338_878382_-	hypothetical protein	NA	NA	NA	NA	NA
877889:877903	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|878637_879903_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|878637_879903_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
886481:886495	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 2
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	1161985	1169125	5294134		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|1161985_1162624_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|1162620_1163883_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|1163879_1164788_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|1164983_1165751_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1165801_1166458_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|1166563_1169125_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	1238617	1326398	5294134	tRNA,portal,lysis,terminase,tail,protease	Enterobacteria_phage(33.93%)	92	NA	NA
WP_029700790.1|1238617_1239790_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	5.1e-147
WP_001331174.1|1239750_1239957_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|1240016_1240232_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001222408.1|1240228_1240591_-	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	2.0e-65
WP_000008249.1|1240581_1241118_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_029700792.1|1241246_1242071_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	1.0e-149
WP_000135682.1|1242136_1242499_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|1242967_1243402_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|1243373_1243580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450737.1|1243827_1244454_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|1244551_1244752_+	cell division protein	NA	NA	NA	NA	NA
WP_001250269.1|1245517_1245697_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|1245686_1246628_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_021576994.1|1246624_1247119_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	2.5e-87
WP_001355692.1|1247118_1247772_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_000210155.1|1247768_1248095_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000767113.1|1248091_1248481_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_029700795.1|1248500_1249298_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.6e-150
WP_001360050.1|1249305_1250295_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_029700797.1|1250312_1250654_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	1.6e-56
WP_001531322.1|1250666_1251215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|1251201_1252128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029700800.1|1252392_1252596_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_029700801.1|1252746_1253799_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	1.4e-207
WP_000839596.1|1253866_1254082_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|1254081_1254579_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_029700804.1|1254575_1255043_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	97.4	6.1e-75
WP_001139681.1|1255030_1255183_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_000373425.1|1255858_1256353_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934127.1|1256352_1258455_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.4	0.0e+00
WP_001072975.1|1258451_1258664_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_029700806.1|1258663_1260172_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.6	6.6e-288
WP_001136591.1|1260116_1262144_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.8	0.0e+00
WP_001097050.1|1262230_1262554_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283144.1|1262546_1262822_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_029700808.1|1262833_1263412_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.6e-101
WP_001079398.1|1263408_1263810_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211099.1|1263821_1264565_+	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001440689.1|1264625_1265012_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161009.1|1265020_1265350_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_029700810.1|1265321_1268387_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447247.1|1268386_1268716_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|1268725_1269424_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_064735486.1|1269428_1270172_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.3e-147
WP_050550752.1|1270108_1270717_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	8.1e-104
WP_029700815.1|1270777_1274275_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.5	0.0e+00
WP_029700816.1|1274345_1274945_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.5	4.5e-107
WP_072059871.1|1275009_1278081_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	2.8e-67
WP_029701022.1|1278080_1278665_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	6.6e-103
WP_000355482.1|1278734_1279508_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072095179.1|1279944_1281348_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_012602456.1|1281382_1282597_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_000162574.1|1283402_1283885_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|1284016_1284493_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1284482_1284773_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1284834_1285176_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880939.1|1285324_1286986_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1287071_1287950_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1288072_1288666_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1288719_1290006_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189256.1|1290026_1290893_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1290984_1292346_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1292482_1292731_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1292749_1293298_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|1293328_1294096_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1294137_1294485_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589791.1|1294561_1295044_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969008.1|1295059_1296286_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|1296275_1296794_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|1296940_1297306_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1297515_1298586_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225212.1|1298596_1299718_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200140.1|1299760_1300921_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1301019_1301067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1301170_1301512_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1301781_1302519_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079111.1|1302653_1303634_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040156.1|1303630_1304362_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1304491_1307065_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852119.1|1312854_1314153_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001467872.1|1314149_1314473_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001312028.1|1314518_1315874_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082935.1|1315987_1318648_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001296305.1|1318679_1319378_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1319446_1319866_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|1320072_1321110_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1321157_1321847_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|1322151_1322535_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189207.1|1322590_1323178_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001296304.1|1323280_1324162_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1324194_1325529_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|1325660_1326398_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	1777167	1820099	5294134	transposase,lysis	Enterobacteria_phage(46.15%)	32	NA	NA
WP_000968208.1|1777167_1777863_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|1777859_1778258_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000691708.1|1780611_1780695_-	protein YohP	NA	NA	NA	NA	NA
WP_122984437.1|1780828_1782355_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079537.1|1782407_1783169_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000365433.1|1783298_1783877_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1784046_1784634_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001319943.1|1784807_1785740_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097409.1|1785778_1787494_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871487.1|1787689_1789987_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131267.1|1790176_1791094_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221815.1|1791100_1792258_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569347.1|1792250_1793177_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783109.1|1793181_1793913_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1793893_1794001_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1794060_1794792_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1795013_1796699_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1796695_1797415_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1797461_1797932_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1797972_1798434_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1798558_1800562_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1800558_1801695_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001294398.1|1801687_1803967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296229.1|1803977_1805066_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000356760.1|1806144_1809777_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|1812575_1813280_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050011420.1|1813270_1813633_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
WP_000239590.1|1813888_1814764_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|1814810_1815143_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|1816560_1817265_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|1818292_1818997_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165587319.1|1818942_1820099_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.6	3.8e-17
>prophage 5
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	1908830	1915133	5294134		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|1908830_1910225_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|1910399_1911293_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|1911665_1912751_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|1912750_1913650_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|1913707_1914586_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|1914590_1915133_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 6
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	1938280	2014421	5294134	head,integrase,coat,tail,portal,holin,transposase,lysis,terminase,protease	Enterobacteria_phage(44.78%)	97	1933228:1933243	1996165:1996180
1933228:1933243	attL	CCCAGGCTTCATCAAC	NA	NA	NA	NA
WP_001531805.1|1938280_1938739_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_001576845.1|1938849_1940274_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_029700882.1|1940455_1941634_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	98.5	2.4e-229
WP_000132739.1|1941614_1941806_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_029700883.1|1941885_1942230_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	3.8e-58
WP_001277766.1|1942330_1942510_-	Eag protein	NA	K7PL40	Enterobacteria_phage	96.6	2.8e-28
WP_029700885.1|1942606_1943404_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	65.6	8.3e-48
WP_029700887.1|1943542_1943734_-	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	92.1	3.6e-26
WP_029700889.1|1943726_1944323_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	78.3	9.5e-73
WP_050011452.1|1944309_1944687_-	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	61.6	4.8e-22
WP_001111298.1|1944861_1945155_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_001535902.1|1945178_1945766_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
WP_000536247.1|1945762_1946443_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
WP_000613347.1|1946451_1946640_-	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
WP_000372936.1|1946636_1946750_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.3	7.8e-13
WP_001198861.1|1946718_1946883_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_029700895.1|1947073_1947544_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	5.3e-87
WP_128357223.1|1947547_1947799_-	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	95.2	4.4e-40
WP_029700898.1|1947838_1948462_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	95.7	5.8e-105
WP_072190279.1|1948473_1948854_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.1e-53
WP_104460248.1|1949134_1949830_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	3.7e-129
WP_000067728.1|1949905_1950121_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_000536663.1|1950237_1950519_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
WP_000166207.1|1950553_1950700_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_029700901.1|1950692_1951553_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.3	9.6e-159
WP_029700902.1|1951660_1953541_+	DNA replication protein	NA	K7PK08	Enterobacteria_phage	99.8	0.0e+00
WP_000736913.1|1953618_1954059_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254220.1|1954055_1954232_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_029700904.1|1954234_1954600_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	94.8	3.3e-60
WP_029700905.1|1954592_1954772_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.3e-25
WP_000237096.1|1954761_1955154_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	36.1	5.9e-15
WP_021571394.1|1955146_1955758_+	recombination protein NinG	NA	A0A088CQ20	Enterobacteria_phage	99.5	6.0e-99
WP_000144614.1|1955754_1955961_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_029700907.1|1955938_1956610_+	serine/threonine protein phosphatase	NA	K7PJY0	Enterobacterial_phage	99.1	5.0e-131
WP_029700909.1|1956600_1957119_+	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	98.3	4.5e-95
WP_000783734.1|1957583_1957907_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_029700910.1|1958364_1958802_+|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	99.3	1.0e-71
WP_004015017.1|1959004_1959547_+	phage regulatory, Rha family protein	NA	A0A088CBJ5	Shigella_phage	91.7	3.1e-91
WP_000807788.1|1959774_1960017_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|1960019_1960460_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_029700916.1|1960456_1961872_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	98.9	1.6e-275
WP_029700917.1|1961873_1964072_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_000372575.1|1964162_1965056_+	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
WP_029700919.1|1965074_1966328_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.3	7.7e-234
WP_001389518.1|1966369_1966558_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1966538_1967000_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_029700923.1|1967009_1968428_+	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.6	4.2e-276
WP_029700925.1|1968427_1969129_+|tail	tail protein	tail	A5VW68	Enterobacteria_phage	96.1	6.2e-116
WP_029700927.1|1969128_1969584_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	7.4e-86
WP_000964872.1|1969586_1970279_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
WP_029700929.1|1970289_1971564_+	phage DNA ejection protein	NA	E7C9U5	Salmonella_phage	61.0	3.4e-128
WP_029700931.1|1971563_1973672_+	hypothetical protein	NA	Q9AYY9	Salmonella_phage	84.1	1.2e-284
WP_000467047.1|1973696_1974119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001263856.1|1974246_1974795_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_000749484.1|1974785_1975505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029700933.1|1975554_1975809_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	88.6	2.0e-32
WP_001555391.1|1975899_1976058_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	92.3	9.3e-20
WP_000868958.1|1976054_1976279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029700934.1|1976341_1977244_+	antirepressor	NA	Q0H8C7	Salmonella_phage	97.7	2.5e-170
WP_001296209.1|1980328_1981495_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|1981613_1982087_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|1982284_1983343_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1983514_1983844_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|1983944_1984127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1984615_1984729_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1984741_1984936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165696580.1|1984932_1985307_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|1985395_1985764_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|1985779_1986424_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1986442_1986664_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1986726_1987203_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1987218_1987692_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1987785_1988031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1988030_1988849_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1989069_1989480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1989928_1990675_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1990689_1992231_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|1992345_1992759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|1992894_1993965_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|1993961_1994867_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|1994863_1997248_-	hypothetical protein	NA	NA	NA	NA	NA
1996165:1996180	attR	CCCAGGCTTCATCAAC	NA	NA	NA	NA
WP_001069649.1|1997465_1997900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|1998328_2000494_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|2000504_2001494_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|2001512_2002571_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|2002567_2003335_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|2003388_2003646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|2004020_2005634_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2005664_2006015_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2006011_2006437_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001296206.1|2006716_2007862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|2009061_2009241_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|2009386_2010409_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|2010408_2011101_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000813432.1|2012126_2012729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|2012822_2013101_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|2013224_2014421_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	2136372	2275661	5294134	tRNA,head,integrase,tail,portal,capsid,holin,plate,transposase,lysis,terminase	Enterobacteria_phage(35.71%)	164	2166031:2166048	2276124:2276141
WP_001531780.1|2136372_2137389_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2137357_2137621_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2137830_2138013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|2138012_2138582_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2138578_2140795_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2140825_2141146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2142156_2142570_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2142668_2142899_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2142957_2143434_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2143473_2143698_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2143694_2144450_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|2144439_2145855_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2145893_2146304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2146305_2146542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2146538_2146850_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2146846_2147071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2147752_2148541_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2148715_2149639_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|2150826_2151525_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|2151987_2152593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2152602_2153091_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|2153489_2153723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2153966_2154608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2154759_2154939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2155016_2155613_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2155609_2155903_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2155902_2156574_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2156686_2157070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2157069_2157342_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2157341_2157821_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2157828_2158023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2158082_2158328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2158696_2159263_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2159249_2161112_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2161111_2161345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2161341_2162916_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2162915_2164223_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2164222_2164552_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2164610_2165645_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2165679_2166099_+	DNA-packaging protein	NA	NA	NA	NA	NA
2166031:2166048	attL	CGTGAAATTGTTGTTGAT	NA	NA	NA	NA
WP_001531773.1|2166095_2166476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2166507_2167188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2167184_2167721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|2167701_2168604_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|2168606_2168948_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2168944_2169865_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2169867_2170494_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|2170486_2171671_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2171670_2172060_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2172056_2173559_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2173576_2174089_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|2174101_2174383_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2174491_2176132_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2176167_2176557_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2176718_2176943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|2178157_2178577_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|2179048_2179714_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000797555.1|2179764_2180976_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2181166_2181406_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2181443_2181941_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2182112_2182436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2182699_2182786_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2182900_2183152_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2183229_2183733_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2184527_2185517_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|2185586_2187101_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|2187115_2188102_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|2188268_2189069_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|2189043_2190468_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|2190474_2190903_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2191682_2192033_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2192035_2192614_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2192740_2193628_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2193624_2194551_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|2194555_2196520_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2196540_2197044_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|2197188_2198850_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|2199140_2200001_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2200003_2201053_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2201067_2201457_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|2201467_2202112_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|2202300_2203449_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|2203441_2205520_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|2205519_2205912_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|2205964_2207698_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|2207913_2208480_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2208493_2209240_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|2209627_2210728_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|2210752_2213182_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|2213217_2214189_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2214185_2214929_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2214969_2215365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042040108.1|2215417_2216188_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362005.1|2216169_2217483_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_000528718.1|2217538_2217775_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2217783_2217930_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2217933_2218176_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_021519728.1|2218260_2218605_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.2	1.4e-57
WP_021519727.1|2218601_2218769_-	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	80.8	3.6e-14
WP_000224227.1|2218779_2219043_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_021519726.1|2219044_2219455_-	hypothetical protein	NA	C6ZR27	Salmonella_phage	49.6	2.7e-18
WP_021519725.1|2219456_2220272_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	96.4	1.3e-141
WP_021519724.1|2220258_2220573_-	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_000179800.1|2220526_2220844_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001199104.1|2221092_2221674_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	65.1	1.9e-70
WP_021519723.1|2221679_2221862_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	2.9e-09
WP_021519722.1|2222056_2222263_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	95.6	2.0e-30
WP_000608402.1|2222550_2223054_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	95.5	1.2e-63
WP_000838344.1|2223157_2223814_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_001090259.1|2224149_2224857_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	86.0	9.1e-107
WP_029700954.1|2224965_2225628_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	84.9	4.7e-97
WP_029700955.1|2225624_2226476_+	hypothetical protein	NA	Q8HA97	Salmonella_phage	68.9	1.9e-103
WP_000626792.1|2226472_2226667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|2226663_2226888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092417.1|2227180_2228167_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	1.7e-55
WP_000988266.1|2228177_2229077_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_029700958.1|2229073_2230474_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	93.9	3.0e-250
WP_001520742.1|2230470_2230728_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	4.4e-35
WP_001205451.1|2230727_2231096_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	2.2e-56
WP_001025378.1|2231159_2232200_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	50.9	9.3e-100
WP_000052342.1|2232168_2232858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209290.1|2232860_2234018_-	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	37.4	2.3e-59
WP_000917767.1|2234271_2234469_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000193280.1|2236873_2237224_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_016248004.1|2237287_2237821_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	2.5e-101
WP_000459345.1|2237980_2238118_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082546.1|2238119_2238587_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|2238937_2239078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2239210_2239396_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102145.1|2239783_2240332_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_094083981.1|2240261_2242232_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.1e-262
WP_000259002.1|2242215_2242422_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_029701046.1|2242418_2244011_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253935.1|2244000_2245506_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256835.1|2245542_2245890_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522601.1|2245947_2246976_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
WP_000201501.1|2247027_2247411_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001402971.1|2247403_2247757_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	9.6e-41
WP_001575631.1|2247771_2248347_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.1e-49
WP_000683079.1|2248343_2248739_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2248746_2249499_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|2249512_2249944_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|2249970_2250384_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_023909007.1|2250364_2252938_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.3	0.0e+00
WP_000847298.1|2252934_2253264_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_033561175.1|2253263_2253962_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	6.4e-129
WP_000194723.1|2253972_2254716_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122997661.1|2254661_2255294_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	94.3	1.5e-100
WP_134163207.1|2256764_2259110_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	98.6	0.0e+00
WP_106493736.1|2259928_2262955_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_000631346.1|2262951_2263854_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.9	4.0e-99
WP_029701058.1|2263862_2264447_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_029701056.1|2264559_2265930_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000545005.1|2265907_2266459_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000891625.1|2267277_2267844_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2268153_2269926_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|2269918_2270371_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2270399_2271140_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2271174_2271696_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|2271697_2272300_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|2272370_2272436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2272574_2273186_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|2273194_2274205_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_165696581.1|2274314_2275661_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
2276124:2276141	attR	ATCAACAACAATTTCACG	NA	NA	NA	NA
>prophage 8
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	2409371	2458067	5294134	tRNA,integrase,capsid,plate,transposase,tail	Burkholderia_virus(35.71%)	64	2408732:2408748	2460700:2460716
2408732:2408748	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_001144199.1|2409371_2411300_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
WP_001700733.1|2411303_2411846_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2411942_2412140_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2412192_2412549_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2412671_2412716_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2412999_2413983_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672320.1|2413997_2416385_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2416389_2416689_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956533.1|2416789_2417770_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|2417832_2418384_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029460.1|2418383_2419133_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209785.1|2419210_2419675_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001296111.1|2419922_2420636_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000904922.1|2420739_2421312_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_001427100.1|2421383_2421896_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	47.9	1.3e-33
WP_000072166.1|2421895_2422510_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_024240575.1|2422516_2422990_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	51.8	1.8e-34
WP_077883632.1|2423000_2424995_-	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.4	2.7e-39
WP_000138756.1|2424997_2425576_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219102.1|2425568_2426672_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000859111.1|2426662_2427010_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001404342.1|2427064_2427661_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	3.2e-36
WP_001545521.1|2427657_2428812_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	1.2e-84
WP_032142594.1|2428799_2429015_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	55.7	3.5e-17
WP_000458386.1|2429011_2429896_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_001202894.1|2433184_2433343_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|2433266_2433602_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|2433699_2433981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|2433983_2434508_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_012602372.1|2435922_2436177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|2436173_2436638_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|2436637_2437084_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|2437085_2437424_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|2437433_2438387_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|2438401_2439517_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135513.1|2439731_2440190_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117560.1|2440192_2441014_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_001546013.1|2440994_2442491_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.2	4.8e-166
WP_001409862.1|2442490_2444023_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	4.8e-185
WP_000124060.1|2444082_2444628_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|2444627_2444939_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|2444938_2445265_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264664.1|2445261_2445912_-	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_001104440.1|2445895_2446636_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|2446638_2446989_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000149906.1|2447119_2447596_+	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_001330012.1|2447633_2448221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031883.1|2448305_2449292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259268.1|2449288_2449750_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000200153.1|2449800_2449989_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_000049025.1|2450041_2450350_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000533821.1|2450360_2451275_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_001545516.1|2451278_2453048_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	2.4e-228
WP_000960679.1|2453058_2454225_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|2454227_2454497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|2454524_2455055_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_001381531.1|2455343_2455616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299260.1|2455625_2455922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763553.1|2455936_2456152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|2456148_2456832_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|2456828_2457059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|2457048_2457255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|2457256_2457706_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|2457677_2458067_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
2460700:2460716	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
>prophage 9
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	2804404	2831256	5294134	transposase,tail,protease	Escherichia_phage(25.0%)	28	NA	NA
WP_000422062.1|2804404_2805454_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|2805673_2806432_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|2806428_2807019_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2807075_2807384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622024.1|2807393_2808416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|2808585_2809461_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|2809673_2811569_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2811596_2812217_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|2812213_2813095_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2813232_2813277_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|2813368_2814931_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|2814930_2816526_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|2816529_2817888_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|2817899_2819093_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|2819092_2819899_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|2820274_2820550_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2820546_2821104_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000251936.1|2821230_2821401_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937495.1|2821515_2821785_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2821841_2822510_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|2822708_2822891_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|2823016_2823985_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001164137.1|2824000_2824528_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|2824558_2825092_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|2825093_2827919_-|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|2828380_2829127_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2829141_2830683_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001554091.1|2830797_2831256_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	89.0	9.5e-65
>prophage 10
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	2835140	2874121	5294134	head,integrase,portal,capsid,holin,terminase,tail	Stx2-converting_phage(32.5%)	50	2833290:2833304	2875085:2875099
2833290:2833304	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|2835140_2835773_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_001296027.1|2836473_2837172_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|2837171_2837513_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|2837505_2840748_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|2840795_2841005_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2841100_2841475_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2841489_2842206_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2842272_2842617_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2842613_2843060_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2843056_2843407_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2843416_2843743_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|2843739_2846325_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2846270_2846492_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|2846536_2848474_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|2848537_2850199_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|2850195_2850759_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|2851049_2851415_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|2851456_2851657_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|2851855_2852071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2852156_2852342_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|2852563_2852650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2853204_2853738_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|2853843_2854116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2854081_2854426_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2854430_2854646_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|2854796_2856650_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|2856910_2857246_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|2857526_2857658_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|2858459_2859509_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|2859660_2859858_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|2860084_2860906_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|2860902_2861283_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|2861283_2862339_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2862340_2862613_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2862780_2862993_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2863173_2863839_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2864013_2864439_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2864454_2865225_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2865246_2865993_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|2865999_2866962_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|2866984_2867410_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2867406_2867622_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|2867671_2868388_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|2868660_2868816_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|2868975_2869194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|2869759_2869948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|2869944_2870136_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|2870228_2872700_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|2872764_2873013_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2872990_2874121_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2875085:2875099	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 11
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	3012082	3060331	5294134	head,tRNA,integrase,portal,capsid,holin,transposase,lysis,terminase,tail	Enterobacteria_phage(54.72%)	61	3030866:3030880	3062000:3062014
WP_000654172.1|3012082_3012361_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|3012357_3014379_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|3014437_3017920_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|3017980_3018583_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|3018519_3019263_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|3019267_3019966_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|3019965_3020295_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|3020291_3022853_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|3022845_3023280_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|3023261_3023684_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|3023699_3024440_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|3024447_3024843_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|3024839_3025418_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|3025429_3025783_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|3025794_3026193_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|3026234_3027260_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|3027315_3027648_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|3027657_3028977_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|3028957_3030559_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|3030555_3030762_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|3030758_3032684_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
3030866:3030880	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|3032658_3033204_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|3033767_3033950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3034156_3034483_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|3034963_3035257_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|3035347_3035530_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|3035746_3036223_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|3036209_3036515_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|3036836_3037526_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|3037522_3037663_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|3037659_3038022_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|3038018_3038309_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|3038301_3038472_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|3038471_3038927_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|3038923_3039025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029700859.1|3039374_3040406_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000080195.1|3040432_3042046_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3042076_3042427_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3042423_3042849_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_022645049.1|3042994_3047260_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|3047509_3048211_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|3048207_3049137_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|3049223_3049763_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|3049832_3050063_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3050167_3050857_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3051452_3051659_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|3051734_3052031_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|3052036_3052822_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3052818_3053499_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|3053495_3053678_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|3053650_3053842_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|3053852_3054134_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|3054232_3054454_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|3054453_3054780_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|3054763_3055003_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|3055142_3055379_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|3055368_3056511_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|3056624_3057875_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|3058046_3058700_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3058709_3059171_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|3059224_3060331_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3062000:3062014	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 12
NZ_CP049077	Escherichia coli strain p11A chromosome, complete genome	5294134	3242948	3381445	5294134	tRNA,head,integrase,portal,capsid,transposase,plate,holin,terminase,tail,protease	Enterobacteria_phage(41.67%)	148	3324820:3324839	3363480:3363499
WP_000117888.1|3242948_3244349_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_000462681.1|3246216_3247407_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109456.1|3247456_3248104_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3248130_3248679_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925990.1|3248859_3250707_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572714.1|3250967_3255428_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295931.1|3255427_3256132_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288856.1|3256112_3257435_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295930.1|3257431_3258217_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3258352_3259132_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|3259108_3260002_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|3260155_3260902_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|3260898_3261081_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|3261132_3262365_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|3262401_3263388_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3263384_3265133_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|3265169_3267434_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3267639_3267924_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3268083_3269757_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3269867_3270551_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|3270723_3271506_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|3271648_3272038_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|3272009_3272459_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|3272460_3272667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|3272656_3272887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|3273565_3273781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|3273795_3274092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|3274101_3274374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3274662_3275193_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|3275220_3275490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|3275492_3276659_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|3276669_3278439_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|3278454_3278772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|3278771_3279692_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|3279702_3280011_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|3280063_3280252_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|3280345_3280702_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|3280818_3281583_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|3281773_3281989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|3281987_3282392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|3282367_3283096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|3283226_3283577_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|3283579_3284320_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|3284303_3284954_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|3284950_3285277_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|3285276_3285588_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|3285587_3286133_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000090684.1|3287723_3289220_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|3289200_3290022_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|3290024_3290483_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000537457.1|3292792_3293131_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|3293132_3293579_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|3293578_3294043_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|3294039_3294294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|3294283_3295711_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_162832341.1|3295707_3296232_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000110114.1|3296234_3296516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|3296613_3296949_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|3296872_3297031_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|3297105_3300057_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|3300056_3300941_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|3300937_3301153_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|3301140_3302295_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|3302291_3302888_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|3302942_3303290_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|3303280_3304384_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|3304376_3304955_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_023363137.1|3304957_3306205_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_023142129.1|3306215_3306677_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|3306683_3307298_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_063269479.1|3307297_3307822_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000904922.1|3307881_3308454_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|3308709_3309993_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|3310063_3311152_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|3311350_3312043_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|3312172_3313933_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|3314338_3315196_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3315250_3317533_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3317724_3318465_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|3318561_3319710_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3320023_3320650_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|3320685_3321549_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3321550_3322168_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3322178_3324623_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
3324820:3324839	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023739.1|3324922_3325915_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|3325984_3326326_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|3326430_3326952_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|3326956_3327379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|3327385_3327577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|3327714_3328065_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|3328075_3328354_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|3328365_3328608_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|3328604_3328718_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|3328811_3329222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3329245_3329449_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|3329445_3329712_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|3329708_3330008_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_023142408.1|3330019_3330637_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000599382.1|3330633_3330999_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000123489.1|3331005_3333828_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|3333904_3334864_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|3334868_3335183_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|3335266_3336109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|3336148_3336646_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000236495.1|3337369_3337894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|3337908_3338955_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|3338954_3340706_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|3340860_3341697_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|3341720_3342773_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|3342818_3343619_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|3343720_3344215_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|3344214_3344415_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|3344417_3344741_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|3344737_3345130_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|3345126_3345522_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|3345660_3347538_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|3347561_3348029_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|3348021_3348657_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|3348653_3349235_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|3349231_3349582_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|3349585_3350482_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|3350474_3351005_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_021538277.1|3351007_3352993_+|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000972134.1|3352995_3353529_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|3353557_3354085_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_023363133.1|3354086_3354872_-	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_000905061.1|3355102_3355702_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|3355730_3356219_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|3356231_3359039_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|3359025_3359181_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|3359189_3359564_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|3359619_3360132_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|3360131_3361316_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|3361473_3362583_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|3362623_3362884_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|3363075_3363216_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|3363521_3364814_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
3363480:3363499	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067797.1|3364904_3366248_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3366258_3366870_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|3367028_3371135_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3371269_3371764_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|3372307_3373273_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|3373395_3375162_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|3375162_3376884_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001241674.1|3376925_3377630_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3377914_3378133_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3378817_3381094_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3381124_3381445_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 1
NZ_CP049079	Escherichia coli strain p11A plasmid p11A_p2, complete sequence	180963	46243	90265	180963	protease,transposase	Stx2-converting_phage(36.36%)	40	NA	NA
WP_001298859.1|46243_47785_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000850424.1|48402_49134_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_013362805.1|51569_56690_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_023149624.1|56709_57456_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	3.2e-09
WP_000139363.1|57510_58071_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_005012601.1|58204_58417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077779935.1|58717_58885_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	7.8e-09
WP_001339397.1|58861_59539_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|59538_59886_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_023149734.1|59905_61477_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_072142979.1|62180_62414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|62657_62807_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083833.1|63090_63348_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_032336874.1|63583_63658_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000410951.1|65417_66638_+	arginine deiminase	NA	NA	NA	NA	NA
WP_000440183.1|66648_67560_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000154545.1|67644_68649_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000514417.1|68696_70100_+	YfcC family protein	NA	NA	NA	NA	NA
WP_001496175.1|70180_70660_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000080227.1|71016_71238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624725.1|71268_71619_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_059330006.1|71615_71978_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_032152936.1|72816_73395_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000005489.1|73807_74161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156883.1|74632_75655_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000083821.1|76059_76317_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|76551_76626_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032152935.1|76618_77476_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001333237.1|78176_78317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000616807.1|78414_79068_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|79160_79418_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|79350_79752_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|79888_82786_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|82880_83486_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|84262_84655_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|84792_85677_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|85708_86908_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|87013_87664_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|87695_87938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|89560_90265_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP049079	Escherichia coli strain p11A plasmid p11A_p2, complete sequence	180963	93603	161556	180963	integrase,transposase	Escherichia_phage(34.62%)	53	89498:89557	159059:159880
89498:89557	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001389365.1|93603_94368_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|94594_94900_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|94910_96116_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|96271_96475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|96602_97442_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|97435_97783_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|97988_98777_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|98907_99381_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|99538_100552_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|100931_101636_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_165587319.1|101581_102738_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	30.6	1.3e-17
WP_002063889.1|102829_103372_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|104352_105057_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|105688_106519_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|106649_107204_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|107347_108052_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001216963.1|108699_108807_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|108866_109598_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|109819_111505_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|111501_112221_+	two-component system response regulator BtsR	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	5.1e-12
WP_001295430.1|112267_112738_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|112778_113240_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|113364_115368_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001294398.1|116494_118774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296229.1|118784_119873_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|127380_128085_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050011420.1|128075_128438_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
WP_000239590.1|128693_129569_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|129615_129948_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|131365_132070_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|133097_133802_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000888080.1|134019_134358_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|134387_134717_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000039982.1|134930_136037_+	alkene reductase	NA	NA	NA	NA	NA
WP_001194013.1|136102_136804_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_032152933.1|136869_137643_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000872613.1|137828_139052_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000090196.1|139182_140055_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000734115.1|140296_141049_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001336919.1|142424_142994_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_001189123.1|143559_145068_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001020413.1|147333_148509_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|148577_150839_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|151007_151784_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|151791_152667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|155136_155472_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|155600_155948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194541.1|155967_156537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|156533_156794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165696595.1|158047_158317_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-42
WP_001067855.1|158350_159055_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024193849.1|159079_159454_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_000255956.1|160533_161556_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
159059:159880	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCCATCAGGGACAAAGATCTGGCTGGTCGCTGGCATCACCGATATGAGAAACGGCTTCAACGGCCTGGCGGCAAAGGTGCAGACGACGCTGAAAGACGATCCGATGTCAGGTCACGTTTTTATCTTCCGTGGGCGTAATGGCAGTCAGGTAAAGCTCCTCTGGTCTACCGGCGATGGACTGTGTCTGCTGACCAAACGGCTGGAGCGCGGCCGCTTCGCCTGGCCGTCAGCCCGGGATGGCAAAGTGTTCCTCACACCGGCACAGCTGGCGATGCTCCTTGAAGGTATCGACTGGCGGCAGCCTAAAAGACTGCTTACGTCCCTGACTATGTTGTAAGCCTCTTTATCCTGGTCGACGCTGAATGAGCCTGGTAATATACCCGGTATGAGCAGCTCACTTCCTGACGATATCAATGCACTGAAACGTCTCCTTGCCGAACAGGAGGCGCTGAACCGTGCCCTGCTGGAAAAGCTGAACGAGCGTGAACGCGAAATAGACCATCTGCAGGCGCAGCTGGATAAACTCCGCCGGATGAACTTCGGCAGTCGTTCCGAAAAAGTCTCCCGCCGTATCGCACAAATGGAAGCCGATCTGAACCGGCTTCAGAAAGAGAGCGATAGAGAGCGATACGCTGACTGGTAGGGTGTATGACCCGGCAGTACAGCGTCCGTTGCGTCAGACCCGCACCCGTAAGCCGTTCCCTGAATCACTACCCCGTGACGAAAAGCGGCTGTTGCCTGCGGCGCCGTGCTGCCCGAACTG	NA	NA	NA	NA
