The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049905	Diaphorobacter sp. HDW4B chromosome, complete genome	5453503	720085	778213	5453503	tRNA,terminase,transposase,capsid,integrase	Shigella_phage(11.11%)	56	733636:733660	778288:778312
WP_166066795.1|720085_721126_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.5	3.1e-95
WP_166066796.1|721768_722215_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_166066797.1|722520_723222_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_166066798.1|723472_723739_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_166070769.1|723834_724815_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_166066799.1|724803_725541_-	response regulator	NA	NA	NA	NA	NA
WP_166066800.1|725537_727064_-	sensor histidine kinase efflux regulator BaeS	NA	W8CYF6	Bacillus_phage	28.5	2.3e-30
WP_166066801.1|727236_728562_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_166066802.1|728580_731745_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_166070770.1|731747_733358_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
733636:733660	attL	TTGGTAGGCGCGATTGGACTCGAAC	NA	NA	NA	NA
WP_166066803.1|734057_736238_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_166066293.1|736290_737441_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	63.1	3.3e-98
WP_166066804.1|738338_738476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066805.1|738997_739207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066806.1|739494_739722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066807.1|739799_739985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066809.1|740200_740587_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_166066810.1|741006_741465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066811.1|741461_743390_-	DUF1983 domain-containing protein	NA	Q7Y5E0	Escherichia_phage	35.5	9.4e-05
WP_166066813.1|743386_745963_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	33.2	4.1e-48
WP_166066814.1|745996_746851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066815.1|746847_747504_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_166066175.1|747506_749135_-	hypothetical protein	NA	A0A0U4IQM0	Vibrio_phage	62.8	2.4e-33
WP_166066816.1|750196_750613_-	hypothetical protein	NA	I6NV38	Burkholderia_virus	34.8	7.4e-08
WP_166070771.1|750689_751319_-	hypothetical protein	NA	M4M9I0	Vibrio_phage	32.4	2.3e-21
WP_166066817.1|751309_751927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066818.1|751939_752317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066819.1|752413_752863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066820.1|752903_754019_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L0V108	Agrobacterium_phage	45.1	5.9e-84
WP_166066821.1|754091_754286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066822.1|754300_755257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066823.1|755285_755705_-	hypothetical protein	NA	B5AX64	Iodobacteriophage	55.2	1.6e-29
WP_166066824.1|755713_756256_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_166066825.1|756302_756854_-	lysozyme	NA	A0A291AYT7	Shigella_phage	40.4	7.5e-24
WP_166070772.1|756850_757168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066826.1|757167_757881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066827.1|757877_760232_-	hypothetical protein	NA	A0A248SKZ2	Klebsiella_phage	43.1	1.1e-135
WP_166066828.1|760218_760641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066829.1|761066_763175_+	IPTL-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_166066830.1|763259_764639_-|terminase	PBSX family phage terminase large subunit	terminase	L7TP33	Pseudomonas_virus	58.5	4.2e-140
WP_166066831.1|764635_765439_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	38.7	4.0e-34
WP_166066832.1|765846_767964_+	IPTL-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_166066834.1|768202_768505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066835.1|768509_768956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066836.1|768952_769474_-	DUF1367 family protein	NA	NA	NA	NA	NA
WP_166066837.1|769466_769823_-	endodeoxyribonuclease RusA	NA	A0A088F6Y8	Sulfitobacter_phage	50.0	3.8e-21
WP_166066838.1|769819_770308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066839.1|770304_770592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066840.1|770603_771989_-	AAA family ATPase	NA	H2BD70	Pseudomonas_phage	32.5	2.5e-47
WP_166066841.1|771985_772819_-	hypothetical protein	NA	A0A2H4JDG9	uncultured_Caudovirales_phage	70.1	5.4e-34
WP_166066842.1|773048_773806_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_166066843.1|775492_775876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066844.1|775951_776473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066845.1|776645_776849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066846.1|776855_777086_+	excisionase	NA	NA	NA	NA	NA
WP_166066847.1|777061_778213_+|integrase	tyrosine-type recombinase/integrase	integrase	Q774Z5	Bordetella_phage	37.0	2.2e-62
778288:778312	attR	TTGGTAGGCGCGATTGGACTCGAAC	NA	NA	NA	NA
>prophage 2
NZ_CP049905	Diaphorobacter sp. HDW4B chromosome, complete genome	5453503	789570	821844	5453503	terminase,protease,tail,portal,capsid,head,integrase	Pseudomonas_phage(25.0%)	41	815504:815520	830127:830143
WP_166066861.1|789570_794421_-	hypothetical protein	NA	A0A2H4J9A1	uncultured_Caudovirales_phage	33.6	4.0e-68
WP_166066862.1|794550_795045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066863.1|795163_795580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166070774.1|795615_795960_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_166066864.1|795956_796352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066865.1|796467_797109_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	45.5	7.6e-52
WP_166066866.1|797197_797554_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_166066867.1|797550_798111_-	HK97 gp10 family phage protein	NA	I7GSL4	Xanthomonas_virus	34.0	3.1e-09
WP_166066868.1|798110_798437_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_166066869.1|798439_798781_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q3HQT2	Burkholderia_phage	52.3	2.5e-22
WP_166066870.1|798783_798942_-	hypothetical protein	NA	Q3HQT1	Burkholderia_phage	60.4	1.1e-07
WP_166066871.1|798953_800132_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	62.9	5.2e-139
WP_166066872.1|800128_800977_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	55.8	2.1e-73
WP_166066873.1|800954_802193_-|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	52.2	2.0e-117
WP_166066874.1|802202_803900_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	61.4	1.8e-201
WP_166066875.1|803911_804226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166070775.1|804381_804585_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_166066876.1|804673_804895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066877.1|805140_805479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066878.1|805861_806167_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_166066879.1|806479_806938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069014.1|807337_807577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066880.1|807587_807887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066881.1|807855_809718_-	AAA family ATPase	NA	K4NWL6	Pseudomonas_phage	43.2	7.4e-124
WP_166066882.1|809714_810641_-	hypothetical protein	NA	A0A059VF77	Pseudomonas_phage	37.6	5.5e-27
WP_166066883.1|810646_810994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066884.1|811090_811228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066885.1|811224_811758_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_166066886.1|811754_812036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066887.1|812039_812294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166070776.1|812379_813099_+	S24 family peptidase	NA	F1C5C2	Cronobacter_phage	33.1	5.4e-14
WP_166066888.1|813095_813341_-	hypothetical protein	NA	NA	NA	NA	NA
815504:815520	attL	GGCAAAACAAAAGGCGC	NA	NA	NA	NA
WP_166070777.1|815558_816128_+	hypothetical protein	NA	G1D3R9	Mycobacterium_virus	38.0	5.0e-31
WP_166066889.1|816120_816573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066177.1|816608_816989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066890.1|816997_817663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066891.1|817814_818732_+	hypothetical protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	52.2	3.8e-20
WP_166066892.1|818817_819663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066893.1|819659_820451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066894.1|820447_820675_+	excisionase	NA	Q774Z6	Bordetella_phage	48.4	9.6e-10
WP_166066895.1|820644_821844_+|integrase	tyrosine-type recombinase/integrase	integrase	Q774Z5	Bordetella_phage	36.1	2.1e-55
830127:830143	attR	GGCAAAACAAAAGGCGC	NA	NA	NA	NA
>prophage 3
NZ_CP049905	Diaphorobacter sp. HDW4B chromosome, complete genome	5453503	3385126	3421779	5453503	terminase,protease,tail,portal,head,capsid	Pseudomonas_phage(35.71%)	49	NA	NA
WP_166068985.1|3385126_3386659_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.5	4.7e-23
WP_166068986.1|3386758_3387418_+	response regulator	NA	NA	NA	NA	NA
WP_166068987.1|3387414_3388791_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_166068988.1|3388823_3389762_-	pirin family protein	NA	NA	NA	NA	NA
WP_166068989.1|3390016_3390307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166068990.1|3390366_3390882_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_166068991.1|3391078_3391417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166068992.1|3391874_3393413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166068993.1|3393542_3393902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166068994.1|3394095_3395238_-	DUF3596 domain-containing protein	NA	Q774Z5	Bordetella_phage	37.7	6.1e-52
WP_166068995.1|3395225_3395459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166068996.1|3395455_3395761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066184.1|3395757_3395946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166068997.1|3395966_3396506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166068998.1|3397177_3397957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166068999.1|3397953_3398781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069001.1|3398808_3399651_-	KilA-N domain-containing protein	NA	A0A0H5ARR4	Pseudomonas_phage	47.1	2.4e-29
WP_166069002.1|3399647_3399989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069003.1|3399985_3400153_-	Arc domain-containing protein	NA	NA	NA	NA	NA
WP_166069004.1|3400270_3400684_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_166069005.1|3400886_3401552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069006.1|3401560_3401740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069007.1|3401732_3402053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069008.1|3402049_3402466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166066185.1|3402683_3402911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069010.1|3403240_3404290_-	serine/threonine protein kinase	NA	D2X3B9	Enterobacteria_phage	39.5	1.4e-66
WP_166069011.1|3404282_3404738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166070997.1|3405086_3405662_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	31.8	1.4e-12
WP_166069012.1|3406343_3406877_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_166066884.1|3406873_3407011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166066883.1|3407107_3407455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069013.1|3407460_3408387_+	hypothetical protein	NA	A0A059VF77	Pseudomonas_phage	37.6	4.2e-27
WP_166066881.1|3408383_3410246_+	AAA family ATPase	NA	K4NWL6	Pseudomonas_phage	43.2	7.4e-124
WP_166066880.1|3410214_3410514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069014.1|3410524_3410764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069015.1|3411163_3411622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069016.1|3411897_3412218_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_166069017.1|3412397_3412802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069018.1|3413866_3414145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069019.1|3414518_3414866_+	HNH endonuclease	NA	G3EN93	Psychrobacter_phage	40.2	6.6e-10
WP_166069020.1|3414868_3415204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069021.1|3415284_3415572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069022.1|3415696_3416119_+	hypothetical protein	NA	A0A2H4PI39	Pseudomonas_phage	41.7	8.9e-17
WP_166069023.1|3416078_3417830_+|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	60.3	9.2e-201
WP_166069024.1|3417838_3419089_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	68.1	1.2e-157
WP_166069025.1|3419091_3419943_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	50.9	1.7e-67
WP_166069026.1|3420006_3421230_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	68.8	1.3e-145
WP_166069028.1|3421279_3421456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069029.1|3421452_3421779_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	37.7	2.4e-09
>prophage 4
NZ_CP049905	Diaphorobacter sp. HDW4B chromosome, complete genome	5453503	4183274	4192603	5453503		Burkholderia_virus(22.22%)	17	NA	NA
WP_166066188.1|4183274_4183955_-	hypothetical protein	NA	A0A2H5BP39	Klebsiella_phage	52.6	4.6e-07
WP_166069662.1|4183951_4184164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069663.1|4184195_4184942_-	hypothetical protein	NA	A0A1J0GVP2	Pseudoalteromonas_phage	48.8	7.5e-51
WP_166069664.1|4184941_4185526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069665.1|4185583_4186033_-	hypothetical protein	NA	F8UBT5	Escherichia_phage	35.9	3.0e-15
WP_166069666.1|4186041_4186539_-	single-stranded DNA-binding protein	NA	Q6V7S6	Burkholderia_virus	70.0	8.2e-38
WP_166069667.1|4186584_4187250_-	hypothetical protein	NA	A0A1V0DZ81	Acinetobacter_phage	39.3	5.9e-31
WP_166069668.1|4187242_4188058_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	27.0	2.0e-12
WP_166069669.1|4188069_4189134_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	44.9	1.4e-34
WP_166069670.1|4189130_4189427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069671.1|4189789_4189948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069673.1|4189944_4190196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069674.1|4190205_4190466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166071063.1|4190572_4191145_-	DNA cytosine methyltransferase	NA	Q6UJ20	Burkholderia_virus	78.5	6.7e-84
WP_166069675.1|4191573_4191720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069676.1|4191771_4191975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069677.1|4192063_4192603_-	hypothetical protein	NA	J7HXB1	Pseudomonas_phage	63.1	6.0e-58
>prophage 5
NZ_CP049905	Diaphorobacter sp. HDW4B chromosome, complete genome	5453503	4198977	4220932	5453503	terminase,protease,tail,portal,head,capsid	Burkholderia_phage(33.33%)	27	NA	NA
WP_166069690.1|4198977_4200765_+	toprim domain-containing protein	NA	A0A0U4B0G9	Pseudomonas_phage	42.6	4.5e-126
WP_166069691.1|4200755_4201292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166069692.1|4201469_4201760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069693.1|4201756_4201909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069694.1|4201908_4202439_+	hypothetical protein	NA	I6WB02	Burkholderia_virus	35.3	4.2e-16
WP_166069695.1|4202700_4203270_+	NinG protein	NA	A0A2I7REF6	Vibrio_phage	38.3	6.4e-18
WP_166069696.1|4203266_4203734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069697.1|4203744_4204221_+	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	35.4	2.2e-19
WP_166069698.1|4204242_4204875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069699.1|4205488_4205755_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	54.0	4.3e-17
WP_166071065.1|4205904_4206105_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_166069700.1|4206107_4206326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069701.1|4206474_4206789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069702.1|4206800_4208498_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	61.2	1.8e-201
WP_166066873.1|4208507_4209746_+|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	52.2	2.0e-117
WP_166069703.1|4209723_4210572_+|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	54.6	3.0e-72
WP_166066871.1|4210568_4211747_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	62.9	5.2e-139
WP_166069704.1|4211758_4211917_+	hypothetical protein	NA	Q3HQT1	Burkholderia_phage	60.4	1.4e-07
WP_166066869.1|4211919_4212261_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q3HQT2	Burkholderia_phage	52.3	2.5e-22
WP_166069705.1|4212263_4212590_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_166069706.1|4212589_4213021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166069707.1|4213017_4213371_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_166069708.1|4213502_4214150_+	hypothetical protein	NA	A0A0H5BBY3	Pseudomonas_phage	35.3	2.4e-29
WP_166069709.1|4214257_4214650_+	hypothetical protein	NA	A0A286MN72	Klebsiella_phage	27.2	1.9e-05
WP_166069710.1|4214568_4214967_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_166069711.1|4215034_4215496_+	hypothetical protein	NA	A0A2H4J0E0	uncultured_Caudovirales_phage	47.1	2.9e-05
WP_166069712.1|4215631_4220932_+	hypothetical protein	NA	A0A1V0E8B0	Vibrio_phage	42.2	8.2e-75
>prophage 1
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	0	24594	761384		Acanthocystis_turfacea_Chlorella_virus(100.0%)	19	NA	NA
WP_166071178.1|1010_1319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166071179.1|1561_4048_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_166071180.1|4147_5482_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_166071181.1|5588_8174_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_166071182.1|8320_9343_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_166071183.1|9348_9858_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_166071184.1|10009_12319_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_166071808.1|12497_13262_-	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
WP_166071185.1|13644_14175_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_166071186.1|14368_14896_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_166071187.1|14897_15902_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_166071809.1|16162_18550_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_166071810.1|18620_18893_+	iron uptake protein	NA	NA	NA	NA	NA
WP_166071188.1|18914_20591_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_166071189.1|20583_20898_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_166071190.1|20937_21750_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166071811.1|21923_22880_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_166071191.1|22978_23665_+	RraA family protein	NA	NA	NA	NA	NA
WP_166071192.1|23661_24594_+	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	31.4	1.4e-25
>prophage 2
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	35749	39352	761384		Synechococcus_phage(50.0%)	4	NA	NA
WP_166071200.1|35749_36430_+	Fe2+-dependent dioxygenase	NA	V5UR52	Synechococcus_phage	40.9	1.4e-16
WP_166071201.1|36738_38103_-	OprD family porin	NA	NA	NA	NA	NA
WP_166071202.1|38099_38543_-	pseudoazurin	NA	NA	NA	NA	NA
WP_166071203.1|38539_39352_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	4.0e-13
>prophage 3
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	45821	52030	761384		Bacillus_phage(50.0%)	5	NA	NA
WP_166071208.1|45821_46607_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.6	5.2e-18
WP_166071209.1|46603_47557_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_166071210.1|47556_48498_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	38.0	5.5e-59
WP_166071211.1|48497_50258_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.4e-31
WP_166071212.1|50251_52030_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.6e-30
>prophage 4
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	67638	69115	761384		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_166071225.1|67638_68349_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	5.2e-09
WP_166071226.1|68335_69115_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	7.6e-14
>prophage 5
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	90952	91750	761384		Planktothrix_phage(100.0%)	1	NA	NA
WP_166071244.1|90952_91750_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.3e-13
>prophage 6
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	95028	98598	761384		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
WP_166071248.1|95028_96318_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.8e-170
WP_166071249.1|96343_96775_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.1e-50
WP_166071250.1|96743_97478_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	75.5	1.4e-97
WP_166071252.1|97593_98598_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2C9DSV6	Western_grey_kangaroopox_virus	28.1	2.1e-19
>prophage 7
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	102069	105534	761384		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_166071819.1|102069_102792_+	hypothetical protein	NA	A0A2H4UTM2	Bodo_saltans_virus	28.0	9.9e-16
WP_166071255.1|102788_103526_+	hypothetical protein	NA	M1HII9	Acanthocystis_turfacea_Chlorella_virus	38.8	1.2e-11
WP_166071256.1|103522_104701_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_166071257.1|104697_105534_+	hypothetical protein	NA	A0A1B1ISM5	uncultured_Mediterranean_phage	29.5	1.6e-22
>prophage 8
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	113672	114617	761384		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_166071267.1|113672_114617_-	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.3	6.2e-18
>prophage 9
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	125219	125999	761384		Planktothrix_phage(100.0%)	1	NA	NA
WP_166071278.1|125219_125999_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.2	1.9e-09
>prophage 10
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	176044	176797	761384		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_166071317.1|176044_176797_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.5e-14
>prophage 11
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	210339	211701	761384		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_166071340.1|210339_211701_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.2	8.6e-45
>prophage 12
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	221724	225688	761384		Ostreococcus_lucimarinus_virus(50.0%)	3	NA	NA
WP_166071349.1|221724_223266_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	33.7	1.5e-05
WP_166071350.1|223316_224555_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_166071351.1|224758_225688_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.2	1.7e-23
>prophage 13
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	234269	236903	761384		Tupanvirus(100.0%)	1	NA	NA
WP_166071358.1|234269_236903_+	IPTL-CTERM sorting domain-containing protein	NA	A0A2K9L1M9	Tupanvirus	49.1	8.0e-15
>prophage 14
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	248177	249287	761384		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_166071831.1|248177_249287_+	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	29.6	1.2e-33
>prophage 15
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	265239	266390	761384	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_166066593.1|265239_266390_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.7	9.7e-98
>prophage 16
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	290832	292437	761384		Catovirus(100.0%)	1	NA	NA
WP_166071401.1|290832_292437_+	GMC family oxidoreductase	NA	A0A1V0S9M4	Catovirus	29.5	6.1e-50
>prophage 17
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	297623	298535	761384		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_166071406.1|297623_298535_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.9	3.9e-09
>prophage 18
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	331277	335068	761384		Staphylococcus_phage(50.0%)	4	NA	NA
WP_166071434.1|331277_332870_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.9	1.5e-35
WP_166071435.1|332997_333411_+	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_166071436.1|333458_334250_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_166071438.1|334279_335068_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	24.0	5.4e-07
>prophage 19
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	340711	341539	761384		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_166071445.1|340711_341539_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	28.1	2.4e-05
>prophage 20
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	350295	351726	761384		Streptococcus_phage(100.0%)	1	NA	NA
WP_166071457.1|350295_351726_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	26.6	2.6e-20
>prophage 21
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	359514	361035	761384		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_166071464.1|359514_361035_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	39.7	1.2e-74
>prophage 22
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	372068	373361	761384		Burkholderia_virus(100.0%)	1	NA	NA
WP_166071479.1|372068_373361_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	5.3e-60
>prophage 23
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	396642	400842	761384		Staphylococcus_phage(25.0%)	5	NA	NA
WP_166071499.1|396642_397416_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	2.7e-11
WP_166071500.1|397408_398113_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.7	1.0e-09
WP_166071501.1|398136_399660_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	28.1	1.2e-18
WP_166071502.1|399656_400028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166071503.1|400029_400842_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	38.2	6.3e-11
>prophage 24
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	414643	416344	761384		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_166071518.1|414643_416344_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	26.3	2.9e-34
>prophage 25
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	426240	428435	761384		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_166071528.1|426240_427227_+	hydroxyacid dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.5	4.6e-24
WP_166071841.1|427268_428435_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	29.6	3.3e-37
>prophage 26
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	435012	437768	761384		Catovirus(50.0%)	2	NA	NA
WP_166071843.1|435012_436974_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	1.6e-31
WP_166071534.1|436970_437768_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	1.2e-14
>prophage 27
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	441314	442124	761384		Staphylococcus_phage(100.0%)	1	NA	NA
WP_166071539.1|441314_442124_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	1.3e-11
>prophage 28
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	457373	458474	761384		Streptococcus_phage(100.0%)	1	NA	NA
WP_166071556.1|457373_458474_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	38.5	3.2e-66
>prophage 29
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	464595	467582	761384		Hepacivirus(50.0%)	2	NA	NA
WP_166071564.1|464595_466248_+	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	26.2	7.3e-30
WP_166071565.1|466466_467582_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	62.1	1.5e-50
>prophage 30
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	471505	472264	761384		Mollivirus(100.0%)	1	NA	NA
WP_166071570.1|471505_472264_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	30.8	8.2e-21
>prophage 31
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	482778	484959	761384		Apis_mellifera_filamentous_virus(100.0%)	1	NA	NA
WP_166071580.1|482778_484959_+	ATP-binding protein	NA	A0A0K1Y7P8	Apis_mellifera_filamentous_virus	27.3	1.6e-08
>prophage 32
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	489699	493321	761384		Microcystis_phage(33.33%)	5	NA	NA
WP_166071589.1|489699_490776_+	metallophosphoesterase	NA	A0A075BTY6	Microcystis_phage	32.0	2.3e-08
WP_166071590.1|490863_491322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166071845.1|491521_492424_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	30.2	5.9e-34
WP_166071846.1|492572_492914_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_166071591.1|492952_493321_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	49.2	7.0e-10
>prophage 33
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	500825	502511	761384		Planktothrix_phage(100.0%)	1	NA	NA
WP_166071598.1|500825_502511_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-19
>prophage 34
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	516923	520400	761384		Mycobacterium_phage(33.33%)	4	NA	NA
WP_166071613.1|516923_518141_-	alpha/beta fold hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	34.2	5.4e-06
WP_166071614.1|518085_518829_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166071615.1|518946_519660_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-12
WP_166071616.1|519656_520400_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.7	1.7e-10
>prophage 35
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	524068	528082	761384		Escherichia_phage(66.67%)	6	NA	NA
WP_166071620.1|524068_524980_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	28.1	8.9e-22
WP_166071621.1|525079_526051_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_166071622.1|526625_527027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166071623.1|527084_527348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166071849.1|527378_527762_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	56.4	1.1e-29
WP_166071624.1|527779_528082_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	41.1	7.8e-15
>prophage 36
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	551041	552577	761384		Tupanvirus(100.0%)	1	NA	NA
WP_166071646.1|551041_552577_-	long-chain fatty acid--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	25.2	7.0e-11
>prophage 37
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	580013	580979	761384		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_166071665.1|580013_580979_+	2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	26.8	3.0e-12
>prophage 38
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	586162	589363	761384		Oenococcus_phage(100.0%)	3	NA	NA
WP_166071670.1|586162_587359_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	24.1	2.2e-28
WP_166071671.1|587482_588196_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166071672.1|588208_589363_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	25.1	1.6e-23
>prophage 39
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	593974	600377	761384		Acinetobacter_phage(66.67%)	5	NA	NA
WP_166071676.1|593974_596332_-	xanthine dehydrogenase family protein	NA	A0A0P0I429	Acinetobacter_phage	23.7	5.1e-37
WP_166071677.1|596328_596808_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	32.5	2.0e-12
WP_166071678.1|596944_597748_-	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
WP_166071680.1|597825_598869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166071681.1|598868_600377_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	8.7e-14
>prophage 40
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	606110	607040	761384		Burkholderia_virus(100.0%)	1	NA	NA
WP_166071688.1|606110_607040_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	34.4	7.7e-13
>prophage 41
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	616504	617281	761384		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_166071696.1|616504_617281_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.3	2.4e-07
>prophage 42
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	626592	627993	761384		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_166071706.1|626592_627993_-	agmatine deiminase family protein	NA	M1ICB7	Acanthocystis_turfacea_Chlorella_virus	32.4	1.5e-31
>prophage 43
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	633449	636652	761384		Lactobacillus_phage(50.0%)	2	NA	NA
WP_166071858.1|633449_635186_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	24.1	1.3e-13
WP_166071711.1|635323_636652_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.0	1.6e-35
>prophage 44
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	656506	661413	761384		uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_166071732.1|656506_658879_+	DNA polymerase II	NA	A0A1S5Y2Z1	uncultured_archaeal_virus	25.5	1.4e-42
WP_166071733.1|659076_661413_+	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	37.0	2.5e-12
>prophage 45
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	678992	680489	761384		Staphylococcus_phage(100.0%)	1	NA	NA
WP_166071748.1|678992_680489_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	1.9e-13
>prophage 46
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	731331	731988	761384		Bacillus_virus(100.0%)	1	NA	NA
WP_166071787.1|731331_731988_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-24
>prophage 47
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	736421	738725	761384		Bacillus_phage(100.0%)	1	NA	NA
WP_166071792.1|736421_738725_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	22.5	2.2e-16
>prophage 48
NZ_CP049906	Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence	761384	752939	754361	761384		Bacillus_phage(100.0%)	1	NA	NA
WP_166071803.1|752939_754361_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	4.2e-18
