The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	388792	433071	4863742	protease,lysis,holin,portal,head,coat,tail,integrase	Salmonella_phage(45.59%)	69	379562:379578	441650:441666
379562:379578	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|388792_389845_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|390127_391231_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|391242_392493_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_022630914.1|392698_393862_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	98.2	2.1e-225
WP_153266261.1|394091_394232_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	100.0	3.2e-16
WP_022630916.1|394299_394695_-	hypothetical protein	NA	C6ZR27	Salmonella_phage	55.3	3.2e-24
WP_022630917.1|394698_395172_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.5	3.3e-68
WP_022630918.1|395171_395621_-	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	85.3	2.7e-48
WP_022630919.1|395622_395922_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	3.1e-56
WP_022630920.1|395918_396317_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	72.0	3.5e-31
WP_023167639.1|396313_396478_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	5.5e-23
WP_022630922.1|396488_396782_-	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	87.6	3.8e-43
WP_001253478.1|396828_397113_-	Anti-RecBCD protein 1	NA	E7C9P9	Salmonella_phage	97.9	1.5e-44
WP_022630923.1|397112_397820_-	recombinase	NA	A0A1R3Y600	Salmonella_virus	99.6	2.6e-138
WP_000902087.1|397816_397960_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	100.0	2.4e-19
WP_001749553.1|397949_398138_-	DUF5444 family protein	NA	B8K1E1	Salmonella_phage	100.0	1.6e-31
WP_015995137.1|398118_398271_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	100.0	3.2e-25
WP_024144163.1|398594_398885_-	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	73.3	1.1e-31
WP_022630926.1|398916_399159_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	58.4	7.8e-18
WP_022630927.1|399186_399387_-	Restriction inhibitor protein ral	NA	A0A1R3Y5S4	Salmonella_virus	97.0	1.1e-30
WP_001682202.1|399601_400180_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_015975212.1|400200_400503_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	100.0	3.7e-49
WP_001095984.1|400856_401507_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|401587_401773_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|401879_402158_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|402192_402339_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|402331_403147_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|403143_404520_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|404593_405031_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|405027_405201_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|405167_405344_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|405346_405679_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|405671_405848_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|405840_406452_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|406448_406673_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149926.1|406669_406873_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000219138.1|406853_407033_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
WP_001235452.1|407029_407653_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_022630928.1|407978_408497_+	endodeoxyribonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_000738703.1|408721_409048_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001167374.1|409031_409469_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_011233123.1|409486_409936_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001028469.1|410148_410670_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_000808099.1|410993_411236_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|411239_411629_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|411628_412033_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|412036_412525_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_022630929.1|412502_414002_+	DNA packaging protein	NA	Q76H24	Enterobacteria_phage	99.8	8.2e-307
WP_000774649.1|414001_416179_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	100.0	0.0e+00
WP_000433852.1|416192_417104_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196937.1|417103_418396_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000684729.1|418434_418644_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_015975196.1|418627_419128_+|head	head completion protein	head	A0A192Y830	Salmonella_phage	100.0	3.2e-90
WP_001122424.1|419087_420506_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_022630932.1|420509_421148_+|tail	tail protein	tail	A8CGD2	Salmonella_phage	99.5	2.4e-90
WP_022630933.1|421147_421603_+	DUF2824 family protein	NA	A0A1R3Y5P3	Salmonella_virus	99.3	3.9e-87
WP_022630934.1|421605_422295_+	hypothetical protein	NA	A0A192Y6A3	Salmonella_phage	98.7	6.8e-115
WP_058657163.1|422305_423721_+	phage DNA ejection protein	NA	A0A192Y834	Salmonella_phage	99.8	6.9e-247
WP_058657166.1|423720_425550_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	99.5	0.0e+00
WP_000889769.1|425567_425897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757527.1|425927_426293_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_015975201.1|426306_426486_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_015975190.1|426585_426837_-	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
WP_015975191.1|426927_427089_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	100.0	1.2e-22
WP_015975192.1|427157_428060_+	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	100.0	8.5e-174
WP_022630940.1|428270_430274_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	99.9	0.0e+00
WP_000671497.1|430332_431790_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|431779_432712_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|432708_433071_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
441650:441666	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	1040935	1049663	4863742	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1040935_1042054_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1042050_1043997_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1044126_1044348_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1044671_1044992_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1045020_1047297_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1047486_1047945_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1048407_1049663_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	1099726	1190637	4863742	protease,lysis,holin,tRNA,terminase,tail,integrase	Salmonella_phage(58.7%)	90	1102635:1102654	1166525:1166544
WP_001154025.1|1099726_1100530_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1100522_1101845_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1101825_1102530_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022630856.1|1102529_1106996_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1102635:1102654	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1107340_1109182_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1109441_1109990_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1110017_1110665_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1110726_1111917_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1112097_1113189_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1113795_1115196_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1115396_1115858_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1116174_1117389_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1117633_1119070_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1119147_1120350_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_022631098.1|1120544_1121837_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	1.0e-252
WP_000065276.1|1121881_1122130_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1122170_1122410_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1122452_1123610_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1123572_1126773_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1126899_1127250_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1127298_1127430_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1127726_1128161_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1128266_1128494_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1128528_1128849_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1128933_1129917_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1129919_1130669_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1130679_1131027_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1131023_1131482_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1131485_1131794_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1131797_1132442_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1132441_1132699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1132753_1133731_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1133742_1134339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1134930_1135164_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1135273_1135495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1135579_1136182_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1136390_1137002_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1136998_1137139_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1137135_1137825_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1138019_1138145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1138280_1138730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1139090_1139777_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1140052_1140382_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1140365_1140818_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1140835_1141282_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1141750_1142296_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1143416_1143749_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1143848_1144346_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1144462_1144996_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1145085_1145781_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1145790_1146528_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1146425_1147130_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_031615525.1|1149628_1150552_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_000178849.1|1150590_1150833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1150886_1153325_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1153324_1153906_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1154381_1155350_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1155997_1156624_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1156692_1156992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1156976_1157663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1157933_1158125_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1158551_1161164_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1161371_1162382_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1162547_1163090_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1163086_1164196_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000053044.1|1166413_1168321_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1166525:1166544	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1168335_1169589_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1169593_1171234_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1171230_1171794_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1172049_1172217_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1172316_1172835_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1172903_1174664_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1174849_1175302_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1175373_1176426_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1176782_1177292_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1177508_1178114_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1178100_1180254_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1180272_1180719_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_022630854.1|1180842_1182897_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	23.8	1.1e-08
WP_000424187.1|1182932_1183391_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1183485_1184148_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1184321_1184735_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1184779_1185097_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1185154_1186366_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1186580_1187129_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1187154_1187934_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1187982_1188264_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1188260_1188590_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1188676_1189336_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1189956_1190637_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	1978294	1985100	4863742	tail,integrase	Salmonella_phage(33.33%)	11	1973157:1973179	1982872:1982894
1973157:1973179	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_031247788.1|1978294_1979176_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1979648_1979837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1979901_1980069_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1980325_1980859_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1980912_1981143_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1981332_1981827_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1981886_1982741_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1983114_1983468_-	YebY family protein	NA	NA	NA	NA	NA
1982872:1982894	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1983484_1984360_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_165619350.1|1984360_1984732_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1984869_1985100_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	2060550	2139208	4863742	protease,plate,transposase,holin,portal,capsid,head,terminase,tail,integrase	Salmonella_phage(82.35%)	103	2067088:2067103	2140831:2140846
WP_000502119.1|2060550_2061009_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2061189_2062395_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2062473_2063961_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2064217_2065621_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2065635_2066043_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2066042_2066411_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2066482_2067967_+	alpha-amylase	NA	NA	NA	NA	NA
2067088:2067103	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2068006_2068432_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2068617_2069823_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2069819_2070053_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2070317_2070704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2070823_2071138_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2071354_2073037_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2073029_2074025_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2074017_2074725_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2074724_2076095_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2076116_2076560_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2076556_2077774_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2077878_2078346_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2078350_2079355_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2079351_2079765_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2079764_2080142_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2080141_2080879_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2080888_2081158_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2081166_2081961_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2082242_2082866_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2082904_2083153_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2083227_2083455_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2083764_2084580_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2084558_2086271_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2086435_2086681_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2086697_2087609_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2087784_2088705_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2088693_2089164_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2089144_2090575_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2090648_2091344_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2091435_2091735_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2092384_2093581_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2093841_2094030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2094040_2094253_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2094707_2095976_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2095978_2096398_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2096524_2096686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2097879_2098092_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2098088_2098502_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2098549_2098663_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2098737_2098971_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2099084_2099690_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2099659_2101222_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2101208_2101796_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2101798_2102878_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2102870_2103284_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2103288_2103822_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2103821_2104880_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2104876_2106217_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2106250_2108179_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2108263_2108557_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2108586_2108943_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2108942_2110439_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2110428_2110593_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2110596_2111157_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2111153_2111666_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2111637_2112042_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2112038_2112362_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2112364_2112565_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2112615_2113821_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2113835_2114486_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2114463_2115705_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2115704_2115887_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2115898_2117632_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2117628_2118123_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2118246_2118597_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2118647_2118980_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2119442_2119835_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2119831_2120446_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2120445_2120727_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2120713_2121100_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2121245_2121503_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2121653_2122406_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2122419_2123409_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2123416_2124277_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2124293_2124683_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2124679_2125573_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2125572_2126055_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2126056_2126875_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2126871_2127096_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2127092_2128250_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2128246_2128801_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2128829_2129054_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2129151_2129847_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2130052_2130391_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2130353_2130578_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2131117_2131489_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2131546_2132374_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2132510_2133050_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2133120_2133654_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2133655_2133913_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2133923_2134505_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2134508_2135078_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2135117_2135345_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2135346_2136336_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2136627_2137425_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2138734_2139208_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2140831:2140846	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	2225167	2235673	4863742		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2225167_2226481_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2226507_2227587_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2227591_2228365_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2228361_2229354_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2229359_2229911_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2229911_2230790_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2230837_2231737_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2231736_2232822_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2233198_2234092_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2234269_2235673_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	2304688	2313859	4863742	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_022631044.1|2304688_2306722_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2306962_2307421_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2307592_2308123_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2308179_2308647_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2308693_2309413_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2309409_2311095_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2311317_2312049_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2312108_2312216_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2312196_2312928_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2312911_2313859_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	2333266	2399658	4863742	tail,holin,lysis	Salmonella_phage(28.57%)	59	NA	NA
WP_000989296.1|2333266_2333962_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2334115_2335000_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2335176_2335896_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2335892_2336138_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2336342_2337584_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2337577_2338813_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2338887_2339898_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2339913_2341434_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2341567_2342566_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2343064_2344087_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2344236_2345379_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2345393_2346062_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2346391_2347249_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2347237_2347627_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2347631_2348999_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2349215_2350103_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2350135_2351458_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2351501_2353493_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2353836_2355306_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2355495_2356359_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2356479_2357529_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2357607_2358465_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2358529_2360218_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2360234_2361173_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2361172_2362303_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2362671_2363853_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2363917_2364583_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2364584_2364707_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2365094_2365349_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2365672_2366245_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2366457_2367444_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2367473_2368193_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2368606_2369179_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000561748.1|2371165_2372971_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2372980_2374075_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2374074_2375100_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2375101_2376691_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2376694_2377039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2377429_2378620_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2378647_2379343_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2379494_2381255_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2381379_2381664_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2381772_2382393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2382420_2383428_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2383607_2383835_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2383866_2385627_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2385907_2386411_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2386438_2386729_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2387076_2388906_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2388959_2389403_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2389780_2390308_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2390310_2391552_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2392144_2392474_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2392770_2394102_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2394130_2394499_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2394513_2395503_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2395831_2398198_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2398366_2398570_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2398866_2399658_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	2768207	2857925	4863742	plate,holin,portal,capsid,head,tRNA,terminase,tail,integrase	Enterobacteria_phage(64.41%)	102	2813750:2813776	2849926:2849952
WP_001134566.1|2768207_2768759_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2768783_2769419_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2769422_2770784_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2770794_2771688_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2771803_2772652_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2772690_2773608_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2773629_2774826_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2774941_2775868_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2775905_2776166_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2776277_2776658_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2776657_2777389_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2777400_2778129_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2778140_2779046_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2779042_2779723_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2779996_2780971_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2780987_2782787_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000589087.1|2783038_2783518_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2783514_2784471_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2784470_2785121_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2785152_2785728_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2785724_2785889_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2786152_2787775_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2787759_2788497_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2788627_2789962_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2789979_2790879_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2790981_2791569_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2791630_2792014_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2792332_2793022_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2793137_2794175_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2794378_2794798_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|2794870_2795551_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082639.1|2795604_2798265_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2798379_2799735_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2799779_2800103_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|2800099_2801401_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2801504_2801960_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2807836_2810410_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2810539_2811271_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2811267_2812248_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2812379_2813117_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2813388_2813727_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
2813750:2813776	attL	CAACGCGCCTTCGGGCGCGTTTTTTGT	NA	NA	NA	NA
WP_165619356.1|2813877_2814681_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.8	1.4e-63
WP_001353016.1|2814625_2814823_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|2815015_2815312_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|2815447_2815588_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001383550.1|2815778_2816039_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001763778.1|2816081_2817182_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.7	6.0e-206
WP_000005430.1|2817339_2818524_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_000290450.1|2818523_2819036_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651563.1|2819091_2819466_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
WP_000333503.1|2819474_2819630_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_024144064.1|2819616_2822424_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_022631005.1|2822436_2822925_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.0e-85
WP_022631004.1|2822951_2823551_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.4e-86
WP_024144069.1|2823770_2824259_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	81.4	9.8e-68
WP_010835343.1|2824228_2824846_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_165619359.1|2824850_2825309_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	77.1	1.3e-61
WP_065305617.1|2825387_2827256_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	55.0	1.8e-157
WP_000071724.1|2827252_2827861_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111954.1|2827853_2828750_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213447.1|2828753_2829104_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271888.1|2829100_2829682_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	6.1e-101
WP_000356339.1|2829678_2830314_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|2830306_2830774_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780549.1|2830911_2831319_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
WP_000072327.1|2831315_2831708_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2831704_2832028_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2832030_2832231_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|2832230_2832725_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632335.1|2832826_2833627_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_022631073.1|2833672_2834725_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.1	3.7e-197
WP_001262654.1|2834747_2835584_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613782.1|2835738_2837490_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000098531.1|2837514_2838534_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	2.8e-202
WP_022631072.1|2839037_2839562_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	52.0	8.4e-33
WP_022631071.1|2839558_2840083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163773.1|2840146_2840482_-	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	90.7	4.1e-49
WP_000211257.1|2840545_2840857_-	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	7.2e-48
WP_022631070.1|2840861_2841821_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	4.9e-180
WP_031247798.1|2841886_2844739_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.3	0.0e+00
WP_022631086.1|2844735_2845125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157878345.1|2845121_2845739_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104303.1|2845750_2846050_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	8.2e-41
WP_000153700.1|2846046_2846313_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985163.1|2846309_2846513_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_001092663.1|2846536_2846953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|2847045_2847159_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|2847155_2847398_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|2847409_2847688_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000813365.1|2847698_2848040_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|2848058_2848385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|2848480_2848783_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_000974887.1|2848849_2849839_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_010989056.1|2850006_2850054_+	hypothetical protein	NA	NA	NA	NA	NA
2849926:2849952	attR	CAACGCGCCTTCGGGCGCGTTTTTTGT	NA	NA	NA	NA
WP_000200080.1|2850153_2851314_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2851274_2852183_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2852240_2853362_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2853371_2854442_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2854881_2855400_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2855392_2856613_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2856769_2857117_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2857157_2857925_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP035547	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 chromosome, complete genome	4863742	4424264	4444684	4863742	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4424264_4424993_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4425189_4425480_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4425728_4426184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4426180_4426786_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4426790_4428536_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4428538_4429171_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4429163_4430279_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4430269_4430629_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4430792_4432340_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4432339_4433269_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4433265_4433628_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4433955_4434678_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4434687_4435731_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4435718_4435928_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4435927_4436881_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_022630954.1|4436880_4439235_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	1.2e-65
WP_001185654.1|4439331_4439460_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4439419_4439737_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4439788_4440313_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4440312_4441740_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4441729_4441927_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4441923_4442379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4442538_4442853_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4442865_4443471_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4443473_4443761_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4444336_4444684_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP035549	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_89, complete sequence	88898	0	33530	88898	integrase,portal,holin,terminase	Escherichia_phage(93.1%)	31	151:164	23829:23842
151:164	attL	TGTTAGAAATTTAA	NA	NA	NA	NA
WP_001292231.1|165_1194_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
WP_000888609.1|2387_2627_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_000897062.1|2654_4163_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	57.0	4.3e-162
WP_001096838.1|4162_5143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435256.1|5523_5916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130998.1|6024_6210_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|6416_6608_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_000579539.1|7641_7806_-	DUF3927 family protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
WP_000467090.1|7805_8240_-	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_000077921.1|10447_11656_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.0	2.9e-230
WP_046891376.1|11769_12051_-	hypothetical protein	NA	A0A222YW96	Escherichia_phage	98.9	6.9e-42
WP_099145002.1|12280_12658_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	99.2	1.1e-69
WP_001230915.1|12911_13172_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_000209223.1|13174_13609_-	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_022630892.1|13645_20482_-	DEAD/DEAH box helicase family protein	NA	A0A222YYH3	Escherichia_phage	99.0	0.0e+00
WP_001273800.1|20633_21119_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_001548248.1|21150_21348_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	96.9	7.0e-33
WP_000350312.1|21347_22055_-	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	99.1	1.3e-129
WP_000245715.1|22054_22279_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_022630891.1|22692_23655_-	hypothetical protein	NA	A0A222YXV1	Escherichia_phage	100.0	3.5e-178
WP_001557744.1|23855_24854_-	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	100.0	1.4e-182
23829:23842	attR	TGTTAGAAATTTAA	NA	NA	NA	NA
WP_071802339.1|24867_26136_-|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	1.7e-244
WP_001244352.1|26634_26967_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	99.1	2.6e-56
WP_000094097.1|27011_27569_-	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	99.5	2.3e-97
WP_001043715.1|27694_29059_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	98.5	3.1e-244
WP_000156172.1|29153_29522_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	4.0e-37
WP_022630890.1|29521_31489_-	hypothetical protein	NA	A0A222YWA3	Escherichia_phage	93.4	2.8e-307
WP_000066531.1|31481_32102_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.0	8.3e-80
WP_000526264.1|32091_32538_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_000457140.1|32537_32864_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000904917.1|32969_33530_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	98.9	4.7e-98
>prophage 2
NZ_CP035549	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_89, complete sequence	88898	37442	88176	88898	tail,tRNA	Escherichia_phage(98.51%)	67	NA	NA
WP_001396839.1|37442_37592_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_000654652.1|37983_38829_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	100.0	4.5e-161
WP_000156306.1|38839_40270_-	hypothetical protein	NA	A0A222YWB2	Escherichia_phage	99.2	2.9e-269
WP_000965099.1|40266_40641_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	99.2	1.6e-65
WP_022630908.1|40646_44429_-	structural injection transglycosylase	NA	A0A222YXR4	Escherichia_phage	97.9	0.0e+00
WP_001025043.1|44443_45265_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	7.7e-158
WP_001077897.1|45653_46409_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|46790_47498_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187859.1|47513_48065_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	100.0	1.6e-98
WP_000012433.1|48119_48611_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_001112722.1|48619_49192_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	100.0	6.0e-101
WP_000801017.1|49259_49994_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001033848.1|50037_51696_-|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	99.8	3.7e-311
WP_001396841.1|51763_52042_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001038834.1|52189_53887_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
WP_001427915.1|54132_54438_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.0	3.4e-50
WP_000020025.1|54454_54913_+	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_000243176.1|55066_55525_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
WP_000887293.1|55595_56402_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	100.0	7.7e-118
WP_001272820.1|56401_56686_-	hypothetical protein	NA	A0A222YXW1	Escherichia_phage	100.0	4.7e-38
WP_022630907.1|56952_57909_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	2.9e-180
WP_000076908.1|57921_58260_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	100.0	2.3e-52
WP_000585023.1|58547_59189_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	100.0	7.5e-116
WP_000595051.1|59181_59469_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_001287145.1|59737_61399_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.8	0.0e+00
WP_000045489.1|61447_62353_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	100.0	1.0e-174
WP_000812238.1|62345_63026_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_001258018.1|63009_63915_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	100.0	2.2e-166
WP_000828868.1|63974_64628_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	100.0	1.9e-103
WP_000046500.1|64624_65605_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000203293.1|65608_66376_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
WP_001557712.1|66372_67164_-	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	100.0	3.6e-152
WP_000162415.1|67326_67629_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000806445.1|67699_68038_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_022630906.1|68094_68454_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	97.5	2.9e-61
WP_022630904.1|69286_70483_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	96.5	8.5e-198
WP_000542383.1|70475_70805_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_001557715.1|71133_71787_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.1	1.4e-114
WP_024144056.1|72054_72966_+	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	99.7	2.2e-169
WP_000201621.1|73005_73356_-	hypothetical protein	NA	A0A222YZD3	Escherichia_phage	100.0	9.2e-60
WP_022630902.1|73501_73786_-	hypothetical protein	NA	A0A222YY28	Escherichia_phage	100.0	1.4e-45
WP_022630901.1|73845_74772_-	DNA-binding protein	NA	A0A222YWG0	Escherichia_phage	82.1	5.7e-141
WP_022630899.1|75299_75467_-	hypothetical protein	NA	A0A222YWH9	Escherichia_phage	98.2	1.9e-23
WP_022630898.1|75798_76377_-	recombinase	NA	A0A222YXV2	Escherichia_phage	100.0	2.5e-78
WP_024133811.1|76664_77261_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	99.5	1.1e-108
WP_000834211.1|77564_78053_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	64.8	6.0e-41
WP_000072161.1|78049_78298_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.1	7.0e-30
WP_001018053.1|78294_78603_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	83.1	3.4e-34
WP_000139729.1|78565_78790_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	93.2	5.5e-34
WP_000022451.1|78786_79098_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	3.4e-58
WP_000616788.1|79094_79787_+	hypothetical protein	NA	A0A222YWF0	Escherichia_phage	100.0	5.7e-138
WP_046891371.1|79885_80881_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	100.0	1.9e-198
WP_046891370.1|80894_81194_+	hypothetical protein	NA	A0A222YY12	Escherichia_phage	100.0	1.3e-51
WP_000034256.1|81180_81828_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	100.0	2.9e-115
WP_001557730.1|81814_82006_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	100.0	4.6e-29
WP_001557731.1|82007_82223_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	100.0	1.3e-37
WP_001142594.1|82224_82680_+	DUF4014 family protein	NA	A0A222YXP4	Escherichia_phage	100.0	8.8e-79
WP_001344848.1|84011_84221_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001443773.1|84394_84541_+	hypothetical protein	NA	A0A222YXH0	Escherichia_phage	100.0	1.7e-20
WP_022630896.1|84552_84942_+	DNA repair protein	NA	A0A222YZE2	Escherichia_phage	100.0	2.4e-69
WP_000098854.1|85076_85499_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	100.0	1.8e-70
WP_001190712.1|85607_85829_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216038.1|85828_86209_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	100.0	2.5e-63
WP_000113017.1|86213_86411_+	hypothetical protein	NA	A0A222YWI9	Escherichia_phage	100.0	2.9e-26
WP_022630895.1|86443_87220_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	99.6	1.6e-141
WP_001557736.1|87226_87667_-	DUF2829 domain-containing protein	NA	A0A222YXY1	Escherichia_phage	100.0	2.8e-82
WP_001557737.1|87681_88176_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	100.0	3.4e-92
>prophage 1
NZ_CP035548	Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence	153015	58010	114082	153015	transposase,integrase	Escherichia_phage(17.65%)	45	85682:85741	114075:114894
WP_000608644.1|58010_59273_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|59596_60742_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|60835_61369_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|61365_61683_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001447736.1|61939_62365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000606835.1|62410_67897_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_001259346.1|68045_68753_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000637384.1|68749_71197_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000351984.1|71211_71529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010740.1|71525_72056_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_001447719.1|72018_73284_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_000575345.1|73280_73952_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000983282.1|73948_74956_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_001447718.1|75059_77867_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000709517.1|77905_78766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796664.1|78888_79530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547566.1|79823_80144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186917.1|80447_80633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085160.1|80852_81821_+	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	1.2e-29
WP_000739139.1|81831_82740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|82800_83331_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|83425_84415_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|84477_85488_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
85682:85741	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|85733_86438_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001132147.1|86611_86962_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	40.0	4.8e-08
WP_000843496.1|86995_87193_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|87233_89711_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000758221.1|89807_90248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022630998.1|90334_93481_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	1.5e-60
WP_001398209.1|93491_94784_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|94897_95251_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|95278_96664_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|96853_97534_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_022630999.1|97526_99002_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.4e-27
WP_000790483.1|99252_99684_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|99827_100178_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_001148756.1|102110_103085_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_000796235.1|104015_104687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631000.1|104706_105495_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
WP_165619391.1|106694_107294_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.9	1.4e-31
WP_001067858.1|107284_107989_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000888203.1|108157_108637_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|108706_111859_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|111882_113058_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_001067858.1|113377_114082_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
114075:114894	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCCCCAGCAGCATCTCCAGCTGTGAACGCTGTTCGGCTGACGGTATCAGTGCCAGTTTGTTCCACAGGCGCAACGTCGCCTTTTCCCTTACCTCTGAAATCAACCGGGTCAGCGTAGTGGCTCCGGGGAGAATAATAGTCTATCCCGGCATTGCCAGTCGGGGATATTAAAAAGAGTATAGGTTTTTATTGCGATAAACTAGGTTTCACTTTGGTTCACCATGAAGATGGATTCGCAGTTCTAATGTGTAATGAGGTTCGGATTCATCTATGGGAGGCAAGTGATGAAGGCTGGCGCTCTCGTAGTAATGATTCACCGGTTTGTACAGGTGCGGAGTCGTTTATTGCTGGTACTGCTAGTTGCCGCATTGAAGTAGAGGGAATTGATGAATTATATCAACATATTAAGCCTTTGGGCATTTTGCACCCCAATACATCATTAAAAGATCAGTGGTGGGATGAACGAGACTTTGCAGTAATTGATCCCGACAACAATTTGATTAGCTTTTTTCAACAAATAAAAAGCTAAAATCTATTATTAATCTGTTCAGCAATCGGGCGCGATTGCTGAATAAAAGATACGAGAGACCTCTCTTGTATCTTTTTTATTTTGAGTGGTTTTGTCCGTTACACTAGAAAACCGAAAGACAATAAAAATTTTATTCTTGCTGAGTCTGGCTTTCGGTAAGCTAGACAAAACGGACAAAATAAAAATCTAAATATGCTTGAACAACTTGTAACTTAAATTCATAACTGTATTT	NA	NA	NA	NA
