The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	445131	478389	5405359	capsid,tRNA,integrase,head,terminase,portal,protease,tail	uncultured_Caudovirales_phage(75.0%)	34	462739:462756	478734:478751
WP_002919147.1|445131_446079_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|446093_446603_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446731_447856_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447827_448301_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|448326_448869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|448873_449446_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|449449_450268_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|450264_450522_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450497_451052_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|456847_457069_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|457362_460473_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|460485_461625_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|462003_462654_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462739:462756	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|462929_464156_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|464248_465190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|465371_465656_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|465666_466446_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|466948_467167_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|467159_467348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|467424_467553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|467651_468020_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|468016_468382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|468381_470517_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|470859_471195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|471243_471756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|472019_473186_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|473237_473798_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|473799_475041_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|475037_475373_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|475369_475669_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|475668_476112_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|476104_476257_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|476387_476744_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|476727_478389_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
478734:478751	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	1233668	1279903	5405359	coat,capsid,head,integrase,tRNA,terminase,lysis,portal,tail,plate	Salmonella_phage(83.72%)	61	1231962:1232008	1268529:1268575
1231962:1232008	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1233668_1234694_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1234696_1235326_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1235448_1235691_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1235723_1236233_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1236240_1236441_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1236404_1236743_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1236810_1237044_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1237043_1237271_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1237267_1238119_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1238115_1240500_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1240662_1240851_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1240862_1241096_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1241191_1241875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1241861_1242941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1242940_1243942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1244463_1244733_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1244789_1245833_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1245832_1247596_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1247736_1248570_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1248586_1249639_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1249642_1250296_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1250391_1250856_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1250855_1251059_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1251062_1251278_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1251258_1251768_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1251772_1252156_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1252152_1252581_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1252555_1252714_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1252676_1253099_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1253091_1253538_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1253560_1254427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1254521_1255094_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1255090_1255453_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1255439_1256348_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1256340_1257012_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1257013_1258963_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1258972_1260091_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1260142_1261216_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1261364_1262537_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1262546_1263062_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1263114_1263414_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1263428_1263548_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1263774_1266171_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1266167_1266653_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1266649_1267744_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1267810_1268029_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1268056_1268434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1269037_1269520_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1268529:1268575	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1269630_1270107_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1270096_1270387_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1270453_1270795_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1270776_1270917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1270942_1272604_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1272690_1273569_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1273693_1274284_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1274403_1275690_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1275709_1276501_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1276664_1278029_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1278288_1278537_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1278555_1279104_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1279135_1279903_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	1384619	1444326	5405359	capsid,integrase,transposase,terminase,tail	Salmonella_phage(34.04%)	79	1393819:1393834	1447027:1447042
WP_004151980.1|1384619_1386086_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1386153_1387731_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_087831089.1|1387922_1389173_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	8.0e-207
WP_004243823.1|1389189_1389381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059065281.1|1389377_1389974_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.3	5.3e-108
WP_023285452.1|1389970_1390477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152545.1|1390473_1390632_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_009485475.1|1390624_1390918_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1391027_1391276_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_165539438.1|1391324_1392206_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	83.3	1.9e-133
WP_165539440.1|1392202_1393024_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_165539442.1|1393020_1393227_-	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	76.0	6.2e-16
WP_004164029.1|1393223_1393523_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1393519_1393669_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
1393819:1393834	attL	TTTACCATTTTGGTAA	NA	NA	NA	NA
WP_004144290.1|1393889_1394471_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_023285447.1|1394625_1394859_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_004152537.1|1395005_1395215_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285446.1|1395214_1395982_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1395978_1396764_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_071182195.1|1396883_1397228_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_071182197.1|1397420_1397831_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
WP_032441402.1|1397814_1398006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165562114.1|1398002_1398398_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	79.0	2.6e-58
WP_165562113.1|1398390_1398780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040227357.1|1398779_1399205_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	5.5e-59
WP_071182194.1|1399201_1400140_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
WP_071182193.1|1400224_1400530_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
WP_110224090.1|1400522_1400861_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.9	1.4e-44
WP_004178082.1|1401281_1402769_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_020277900.1|1402885_1403251_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187429.1|1403219_1403477_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_011790968.1|1403808_1405059_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_015586033.1|1405319_1406231_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015059991.1|1406532_1407330_-	carbapenem-hydrolyzing class D beta-lactamase OXA-48	NA	NA	NA	NA	NA
WP_004187367.1|1408626_1408893_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004187369.1|1408937_1409387_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_004187371.1|1409508_1409871_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_004187372.1|1409892_1410156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206907.1|1410273_1410684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060578229.1|1410712_1411192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725064.1|1411184_1411430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046853563.1|1411808_1412327_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004187380.1|1412381_1412825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187382.1|1412827_1413802_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	7.9e-85
WP_004187383.1|1414042_1414783_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_004187387.1|1414801_1415050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187390.1|1415046_1415532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187392.1|1415528_1416116_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187394.1|1416108_1416357_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004187397.1|1416353_1416815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187400.1|1416955_1417501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059997.1|1417806_1418391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187405.1|1418390_1418549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187406.1|1418573_1418918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103113638.1|1419444_1420632_+	RelB antitoxin	NA	NA	NA	NA	NA
WP_015059995.1|1420650_1420923_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015059994.1|1420919_1421603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|1421647_1421866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|1421868_1422078_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	42.0	7.0e-07
WP_019725070.1|1422200_1423466_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.4	2.6e-112
WP_004187425.1|1423453_1423888_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_004178082.1|1424286_1425774_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_165562112.1|1425852_1426182_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	6.7e-28
WP_032457429.1|1426239_1426824_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_165562111.1|1426820_1428296_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	90.6	2.5e-271
WP_165562110.1|1428454_1428787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152472.1|1429492_1429696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087826981.1|1429699_1431379_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.1	1.4e-193
WP_004152470.1|1431375_1431681_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_040120462.1|1431989_1432388_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	1.6e-36
WP_110220407.1|1432400_1433408_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	4.7e-181
WP_004152466.1|1433417_1433810_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_025367999.1|1433802_1434081_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_024622836.1|1434129_1434741_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.5	5.4e-47
WP_165562109.1|1434740_1437218_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	58.3	8.6e-277
WP_165562108.1|1437219_1437690_+	hypothetical protein	NA	Q858G2	Salmonella_phage	54.6	1.1e-44
WP_048293158.1|1437682_1438180_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
WP_004152460.1|1438192_1440937_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_165562107.1|1440936_1444326_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	3.7e-121
1447027:1447042	attR	TTTACCATTTTGGTAA	NA	NA	NA	NA
>prophage 4
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	1783967	1790872	5405359	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1783967_1784831_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_039819854.1|1784841_1785615_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004151134.1|1785855_1786752_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819857.1|1786994_1788356_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004175198.1|1788674_1789397_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1789393_1790872_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	1835849	1847533	5405359	transposase	Enterobacteria_phage(25.0%)	11	NA	NA
WP_004180506.1|1835849_1837265_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1837286_1838657_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1838811_1839876_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819507.1|1839889_1840759_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_004175259.1|1840790_1841681_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1841695_1842250_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_039819510.1|1842429_1843596_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_077255456.1|1845210_1845315_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004144151.1|1846006_1846129_-	small membrane protein	NA	NA	NA	NA	NA
WP_045327201.1|1846265_1846460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039819511.1|1846528_1847533_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 6
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	2898692	2909579	5405359		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2898692_2901800_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2901854_2903120_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2903150_2904239_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2904325_2904586_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2904883_2905744_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2905764_2906526_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2906786_2907689_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2907700_2908966_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2908958_2909579_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	3134509	3176251	5405359	terminase,integrase	Klebsiella_phage(34.04%)	62	3167364:3167378	3173373:3173387
WP_014343022.1|3134509_3137533_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3137588_3137786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3137760_3137892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3138012_3138177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108714555.1|3138651_3139425_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	8.2e-77
WP_004152574.1|3139421_3140618_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3140617_3140971_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3140972_3141626_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3141679_3142030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3142282_3142468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3142520_3142862_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3142861_3143884_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3143886_3144114_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3144189_3144603_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3144788_3146792_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3146781_3146934_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3146969_3147395_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3147398_3147839_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3147849_3148995_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3148998_3149439_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3149533_3149920_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3149919_3150426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3150422_3150842_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3150810_3151092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3151131_3152073_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3152084_3152579_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3152582_3153785_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3153836_3154385_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3154440_3155892_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3156129_3157530_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3157480_3157969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3158334_3158655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3158889_3159279_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3159275_3159806_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3159808_3160057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3160074_3160203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3160240_3160396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3160462_3161245_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3161241_3161718_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3161714_3162677_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3162678_3164337_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3164913_3165135_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3165232_3165901_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3166071_3166386_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3166378_3166567_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3166940_3167102_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3167094_3167349_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3167364:3167378	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3167416_3167539_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3167535_3167961_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3167957_3168152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3168148_3168976_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3169080_3169599_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3169604_3170315_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3170304_3170529_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3170624_3170738_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3170980_3171214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3171286_3171433_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3171392_3171635_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3171615_3172797_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3172993_3173542_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3173373:3173387	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3173740_3175273_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3175489_3176251_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	3521996	3547950	5405359	head,integrase,tail,protease	Pectobacterium_phage(22.22%)	39	3533246:3533261	3548011:3548026
WP_004191050.1|3521996_3522470_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_159225346.1|3522508_3523504_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.6	7.0e-105
WP_159225347.1|3523514_3524267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225352.1|3524253_3524577_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_064185222.1|3524579_3526244_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_009308353.1|3526243_3527638_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_071035057.1|3527722_3528175_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	67.2	1.5e-49
WP_004199477.1|3528181_3528442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199520.1|3528425_3528659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225348.1|3528720_3529245_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	6.2e-44
WP_159225349.1|3529285_3529726_-	hypothetical protein	NA	R9TRJ4	Aeromonas_phage	43.8	3.6e-13
WP_004199527.1|3529731_3530079_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071838911.1|3530066_3530390_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_048256710.1|3530379_3530973_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	2.7e-80
WP_029499143.1|3531041_3531233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225350.1|3531414_3531753_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	9.5e-46
WP_159225351.1|3531752_3531992_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_159225353.1|3531984_3532350_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	62.2	2.5e-31
WP_159225332.1|3532433_3532727_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	85.6	7.7e-44
WP_159225333.1|3532726_3533089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225334.1|3533085_3533292_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	94.1	1.2e-30
3533246:3533261	attL	GCCAGTTTCAGGCGGT	NA	NA	NA	NA
WP_159225335.1|3533288_3533843_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	46.4	2.1e-05
WP_009308335.1|3533970_3534756_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.4e-63
WP_009308334.1|3534795_3535029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308333.1|3535032_3535683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225336.1|3535721_3537110_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	46.6	1.3e-104
WP_060617680.1|3537106_3538099_-	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	55.5	2.6e-30
WP_046387639.1|3538101_3538260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|3538343_3538790_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_024623103.1|3538850_3539045_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	45.9	1.7e-07
WP_159225337.1|3539124_3539526_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	60.2	2.7e-39
WP_159225339.1|3540466_3540700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159225338.1|3540744_3542874_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.9e-97
WP_009308318.1|3542873_3543440_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|3543441_3543627_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_004199480.1|3543836_3544061_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_016197576.1|3544064_3545093_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
WP_004150834.1|3545368_3547021_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3547290_3547950_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
3548011:3548026	attR	GCCAGTTTCAGGCGGT	NA	NA	NA	NA
>prophage 9
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	3632719	3718469	5405359	capsid,tRNA,head,integrase,terminase,lysis,tail,protease,portal,plate	Salmonella_phage(50.98%)	87	3688245:3688263	3718544:3718562
WP_002898139.1|3632719_3634012_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3634102_3635446_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3635454_3636066_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3636188_3640442_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3640577_3641072_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3641355_3641487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3641604_3642573_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3642687_3644454_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3644454_3646176_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3646202_3646922_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3647275_3647494_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3647614_3649894_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3649924_3650242_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3650567_3650789_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3650865_3652806_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3652802_3653918_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3654064_3655723_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3656142_3656838_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3656953_3657853_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3657996_3659649_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3659659_3660628_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3660839_3661274_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3661425_3663144_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3663182_3664184_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3664194_3665637_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3665724_3666738_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3666734_3667565_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3667596_3668736_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3669613_3670129_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3670355_3671084_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3671104_3671836_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3671842_3672559_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3672558_3673227_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3673410_3674142_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3674184_3675657_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3675653_3676370_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3676448_3677576_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3677617_3678106_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3678163_3679009_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3679005_3679959_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3679969_3681103_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3681266_3682379_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3682727_3683207_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3683295_3684198_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3685019_3685307_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3685509_3685773_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3685779_3686163_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3686429_3688115_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3688106_3688229_-	hypothetical protein	NA	NA	NA	NA	NA
3688245:3688263	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3688334_3688553_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3688644_3689745_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3689741_3690227_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3690223_3692617_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3692843_3692963_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3692977_3693277_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3693329_3693845_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3693854_3695027_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3695165_3696242_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3696271_3696433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3696471_3697203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3697206_3700158_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3700159_3700759_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3700751_3701660_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3701646_3702009_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3702005_3702578_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3702692_3702857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3702855_3703365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3703361_3703808_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3703800_3704232_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3704194_3704341_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3704327_3704756_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3704752_3705136_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3705140_3705650_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3705630_3705846_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3705849_3706053_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3706052_3706517_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3706612_3707263_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3707266_3708325_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3708341_3709175_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3709317_3711084_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3711083_3712109_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3712170_3713913_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3714188_3714866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3714980_3715214_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3715224_3715413_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004178082.1|3715513_3717001_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3717488_3718469_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3718544:3718562	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	4297296	4308950	5405359	integrase	Enterobacteria_phage(70.0%)	15	4297148:4297161	4301361:4301374
4297148:4297161	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4297296_4298400_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4298410_4299664_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4300016_4301207_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4301194_4302145_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4301361:4301374	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4302144_4302570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4302916_4303066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4303138_4303705_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4303722_4303968_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4303964_4304702_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4305001_4305139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4305243_4305510_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4305512_4306064_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4306060_4306288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4306284_4306605_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4306616_4308950_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 11
NZ_CP040023	Klebsiella pneumoniae strain KPC160132 chromosome, complete genome	5405359	4777133	4782958	5405359		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4777133_4779467_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4779481_4779802_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4779798_4780026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4780022_4780565_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4780567_4780834_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4781394_4782132_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4782128_4782374_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4782391_4782958_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP040024	Klebsiella pneumoniae strain KPC160132 plasmid pIncC-L132, complete sequence	155920	105886	140480	155920	integrase,transposase	Salmonella_phage(61.54%)	38	101532:101552	150266:150286
101532:101552	attL	ACTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_096043117.1|105886_107034_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	7.8e-148
WP_001187970.1|107184_109638_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050848.1|109839_110043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|110114_110720_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|110712_110982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|110995_111214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064431.1|111287_111845_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_000595210.1|111919_112771_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001032042.1|112975_113122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077335.1|113228_113615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|113792_115520_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|115506_115785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|115857_116097_+	permease	NA	NA	NA	NA	NA
WP_000338626.1|116106_116223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868821.1|116343_116718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|116831_117557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342218.1|117531_117735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342219.1|117797_121952_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.7e-23
WP_000787563.1|121948_122221_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000750746.1|122225_122468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|122515_122815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|122981_123434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|123449_124052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|124313_124595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|124893_125430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|125432_126443_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|126447_127317_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139717.1|127313_127805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342220.1|127850_127982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342221.1|128131_129046_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_013362812.1|131404_132373_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_085281207.1|132316_132754_+|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	4.5e-40
WP_014342101.1|132901_133024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|133003_133879_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_013362812.1|133913_134882_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001323888.1|136793_136961_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|136949_137510_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|137513_140480_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
150266:150286	attR	CAAACTTTCACATGTGAAAGT	NA	NA	NA	NA
>prophage 1
NZ_CP040026	Klebsiella pneumoniae strain KPC160132 plasmid pIncFI-L132, complete sequence	109938	0	98119	109938	tail,terminase,integrase,portal	Salmonella_phage(89.77%)	103	22164:22188	39175:39199
WP_039817730.1|234_828_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.8	1.3e-98
WP_040223256.1|1012_1846_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	57.1	1.0e-64
WP_014342174.1|1971_2529_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|2538_2958_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_040223254.1|3021_3666_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	5.2e-93
WP_074185743.1|3665_4136_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	78.7	2.7e-70
WP_014342178.1|4138_4534_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	74.8	2.6e-50
WP_014342179.1|4553_5657_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_014342180.1|5850_6726_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
WP_014342181.1|6803_7946_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_040203489.1|8076_10380_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_040203999.1|10455_11025_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.4e-94
WP_072201198.1|11034_11745_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	3.6e-71
WP_160333948.1|11770_12130_-	hypothetical protein	NA	J9Q741	Salmonella_phage	95.0	2.4e-55
WP_072201193.1|13683_13917_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_014342188.1|13916_15002_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_014342190.1|15499_15655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704555.1|15653_17213_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_014342193.1|17526_18171_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
WP_164486292.1|18371_19589_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_014342074.1|20040_20253_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_014342075.1|20252_20867_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.3e-37
WP_014342076.1|20950_21127_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_072196934.1|21297_22347_-	recombinase	NA	J9Q736	Salmonella_phage	96.3	5.5e-193
22164:22188	attL	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
WP_019704549.1|22376_22643_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_014342079.1|22642_23587_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
WP_032440516.1|23647_24655_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.3	2.1e-144
WP_040170151.1|24774_25206_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	9.0e-65
WP_014342082.1|25361_25661_-	lipoprotein	NA	NA	NA	NA	NA
WP_023343104.1|25671_26052_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	64.3	1.0e-43
WP_014342084.1|26291_26717_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	8.6e-60
WP_108714635.1|26731_30250_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	92.9	0.0e+00
WP_032439780.1|30430_31663_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_032443561.1|31759_34045_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.9	8.8e-244
WP_014342090.1|34160_34373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342091.1|34646_35027_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_040120267.1|35021_36122_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
WP_023279484.1|36471_36831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021313794.1|36895_37306_-	toxin YafO	NA	NA	NA	NA	NA
WP_040203500.1|37315_37933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440523.1|38027_38273_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
WP_040203502.1|38269_38656_-	phage family protein	NA	Q716B1	Shigella_phage	71.2	1.9e-45
WP_072042571.1|38665_39511_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	4.9e-91
39175:39199	attR	CGGCCGTCGCCAGGAAGGTTTTACC	NA	NA	NA	NA
WP_040203506.1|39657_41175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342099.1|42588_42978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279477.1|43152_43368_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
WP_048333216.1|43351_43474_-	hypothetical protein	NA	J9Q729	Salmonella_phage	76.5	4.8e-08
WP_014342105.1|43470_44793_-	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
WP_050484893.1|44792_45260_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	7.5e-49
WP_032439773.1|45339_46128_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
WP_032439771.1|46416_47583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072196452.1|47625_48750_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	6.3e-203
WP_032440528.1|48896_50237_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_040203349.1|50301_51027_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	9.6e-128
WP_077257223.1|51271_52057_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	24.8	1.8e-07
WP_014342115.1|52102_52459_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_021313115.1|52464_53130_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_014342117.1|53370_53892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342118.1|53946_54102_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	64.7	1.3e-13
WP_040203611.1|54094_54346_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	4.5e-24
WP_040203608.1|54348_55041_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	88.3	3.9e-118
WP_004109805.1|55054_55378_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_048333199.1|55468_56914_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
WP_108714630.1|69187_69799_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	71.6	4.2e-76
WP_004109817.1|69786_70584_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_165564217.1|70576_71275_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.0	9.9e-122
WP_032423010.1|71361_71697_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_108714631.1|71740_76270_-	tape measure protein	NA	J9Q712	Salmonella_phage	70.0	0.0e+00
WP_014342129.1|76277_76502_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|76627_76945_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|77006_77753_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_108714632.1|77820_78213_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	2.9e-46
WP_021313126.1|78214_78688_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|78678_79023_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_040223264.1|79120_79954_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	1.6e-131
WP_160552724.1|79953_80334_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.7	3.4e-52
WP_014342133.1|80271_80460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040203708.1|80435_80864_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_004109857.1|80942_81821_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342135.1|81847_82747_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_019704587.1|82769_84344_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.7	1.3e-275
WP_004109863.1|84376_85633_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|85635_86277_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|86452_86719_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|86728_87619_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109875.1|87615_88167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004109877.1|88156_88798_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	96.2	2.6e-108
WP_023279438.1|88794_89463_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_162551857.1|89462_90167_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	8.2e-108
WP_108714634.1|90226_91786_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	5.2e-280
WP_004109887.1|91788_92064_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_014342146.1|92114_92549_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_004109890.1|92707_93238_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	85.1	9.3e-72
WP_123609186.1|93247_93547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|93871_94522_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|94572_94776_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_042935000.1|95368_95851_-	hypothetical protein	NA	J9Q805	Salmonella_phage	78.1	2.5e-71
WP_032439735.1|96076_96265_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
WP_072196389.1|96292_96490_-	hypothetical protein	NA	J9Q753	Salmonella_phage	80.0	6.4e-26
WP_072196390.1|96700_97120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072201200.1|97227_97527_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	2.5e-29
WP_047065796.1|97675_97888_-	hypothetical protein	NA	J9Q804	Salmonella_phage	76.5	1.3e-24
WP_019704577.1|97900_98119_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
>prophage 2
NZ_CP040026	Klebsiella pneumoniae strain KPC160132 plasmid pIncFI-L132, complete sequence	109938	101232	109168	109938		Salmonella_phage(75.0%)	9	NA	NA
WP_032439726.1|101232_101550_-	hypothetical protein	NA	J9Q750	Salmonella_phage	73.3	2.1e-42
WP_032439724.1|101910_102990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439722.1|103278_103542_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	4.8e-29
WP_094313856.1|103693_104395_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	70.2	4.7e-79
WP_040223258.1|104483_106169_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.1	0.0e+00
WP_040203292.1|106297_106876_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.0e-55
WP_014342167.1|107003_107159_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|107158_107584_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_040203296.1|108580_109168_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.1	9.9e-91
>prophage 1
NZ_CP040025	Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence	150325	1727	62949	150325	integrase,transposase	uncultured_Caudovirales_phage(26.32%)	60	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|4916_5885_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_020444838.1|7417_8872_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9854_11132_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11194_13192_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14231_15439_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16867_17299_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17549_19025_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19017_19698_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19887_21273_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21301_21655_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21768_23061_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23071_26218_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26304_26745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26871_29319_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29359_29557_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29590_30328_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30616_31066_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31299_33117_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33116_34013_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34052_34433_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34437_35367_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35421_36102_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36098_37499_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37715_38150_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38381_38561_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40303_40813_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40862_41360_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41691_42018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|42014_42728_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42736_43282_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43357_43720_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45616_46153_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46185_46611_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46623_47913_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47960_49712_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49729_50092_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50141_50492_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50849_51119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51106_51682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51712_52207_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52250_52619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52652_52856_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52904_53162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53237_53492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53667_53934_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53921_54404_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|54604_56008_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|56036_56669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|58186_58744_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|58737_59109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|59105_59606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|59602_59929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|60183_60540_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_108714626.1|60529_60922_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|60927_61632_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001247892.1|61755_62046_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|62244_62949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
