The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	291276	302457	4642566		Bacillus_phage(100.0%)	7	NA	NA
WP_165562295.1|291276_294291_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	32.2	1.3e-24
WP_043217889.1|294253_294640_+	response regulator	NA	W8CYM9	Bacillus_phage	36.8	1.4e-13
WP_165562296.1|294689_297101_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	31.5	1.0e-24
WP_041108843.1|297097_297484_+	response regulator	NA	W8CYM9	Bacillus_phage	29.6	1.3e-06
WP_165562297.1|297476_299138_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	2.9e-18
WP_165562298.1|299203_302071_+	response regulator	NA	W8CYF6	Bacillus_phage	33.9	3.4e-27
WP_041108847.1|302067_302457_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.3	2.0e-15
>prophage 2
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	540330	605960	4642566	transposase,tRNA	Bacillus_phage(14.29%)	58	NA	NA
WP_165562390.1|540330_541263_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_165562391.1|541259_542624_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_041110380.1|542620_543994_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_041110378.1|544379_545237_+	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_043217696.1|545370_546030_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_061340220.1|546026_546683_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_165564114.1|546727_547495_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	37.7	1.1e-28
WP_041110371.1|547583_547901_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_041110369.1|547908_548172_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_061337740.1|548201_549089_-	lysophospholipid acyltransferase	NA	NA	NA	NA	NA
WP_041110366.1|549134_549698_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_041110365.1|549815_550763_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_165562392.1|550759_552814_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_061337738.1|552818_553361_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_041110362.1|553357_554107_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_041110361.1|554137_555517_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.9	2.5e-20
WP_165562393.1|555598_557164_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	8.7e-41
WP_165562394.1|557347_559768_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.4	9.7e-116
WP_165562395.1|559764_560880_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_165562396.1|560892_561996_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	36.1	5.1e-56
WP_061338170.1|562022_563474_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003290924.1|563980_564115_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_041110355.1|564126_564525_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_074519951.1|564517_564763_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_165562397.1|564765_566430_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_165562398.1|566502_567870_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_165562399.1|568294_570187_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_165562400.1|570183_570834_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_165562401.1|570852_571641_+	ParA family protein	NA	Q8JL10	Natrialba_phage	29.3	1.7e-21
WP_041110349.1|571650_572523_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.9	1.2e-12
WP_165562402.1|572653_573058_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_041110348.1|573074_573947_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_041110347.1|574017_574245_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_041110346.1|574338_574809_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_041110345.1|574821_575358_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_041110344.1|575373_576918_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_041110343.1|576968_577835_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_041110342.1|577865_579242_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_041110341.1|579317_579746_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_165562403.1|579854_581219_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A2K9L821	Tupanvirus	32.0	3.2e-23
WP_043222804.1|581307_582090_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165562404.1|582092_583928_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.4	5.4e-127
WP_165562405.1|584073_584901_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_165564115.1|584914_586975_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046622200.1|586967_588578_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_165562406.1|588579_590082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_165562407.1|590074_591697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085987739.1|592544_592844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165562408.1|593063_593393_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_011911495.1|593555_594584_-|transposase	IS30-like element ISPsp7 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	5.9e-46
WP_165562409.1|594691_596074_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.7	2.2e-11
WP_003292145.1|596070_596748_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	4.3e-29
WP_011914431.1|597260_597503_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_031323827.1|597595_599863_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.3	2.4e-84
WP_003292143.1|599936_600209_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	41.5	6.6e-05
WP_014597615.1|600235_600676_+	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_003292141.1|600858_602622_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_165562410.1|604952_605960_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	907115	943977	4642566	transposase,protease	Bacillus_phage(25.0%)	33	NA	NA
WP_165562533.1|907115_908651_-|protease	protease	protease	NA	NA	NA	NA
WP_165562534.1|908827_909226_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_165562535.1|909339_910074_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.7	7.2e-30
WP_043222516.1|910108_911428_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_041109556.1|911438_912344_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	36.9	4.4e-37
WP_102847920.1|912340_912808_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_043222514.1|912902_913304_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_043222509.1|913421_914309_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_165562536.1|914465_916010_+	phosphoenolpyruvate carboxykinase	NA	A0A2H4PQN1	Staphylococcus_phage	47.3	8.6e-126
WP_165562537.1|916153_917356_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	54.4	1.5e-109
WP_034018616.1|917617_919000_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_041109566.1|919133_919736_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_043222500.1|919800_921822_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_165562538.1|922628_923507_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_165562539.1|923507_925700_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_165562540.1|925699_927130_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_165562541.1|927126_928212_-	carbamoyl-phosphate-synthetase	NA	NA	NA	NA	NA
WP_041109578.1|928208_928514_-	PqqD family protein	NA	NA	NA	NA	NA
WP_165562542.1|928760_929957_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_165562543.1|929963_930320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041109581.1|930372_930996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041109583.1|931308_931860_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_041109585.1|931930_932137_-	DUF2795 domain-containing protein	NA	NA	NA	NA	NA
WP_043222489.1|932195_932471_-	general stress protein	NA	NA	NA	NA	NA
WP_061339199.1|932613_933519_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165562544.1|933619_934861_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_165562545.1|934857_936648_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_165562546.1|936847_938005_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_165562547.1|938032_938464_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_061339155.1|938520_938979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165562548.1|939155_939989_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_165562549.1|940079_942635_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_043218549.1|942939_943977_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	2554524	2665623	4642566	transposase,integrase,protease,tRNA	Escherichia_phage(13.04%)	96	2588989:2589009	2608699:2608719
WP_076611315.1|2554524_2555943_+|transposase	IS1380-like element ISPsp9 family transposase	transposase	NA	NA	NA	NA
WP_041105032.1|2556243_2556462_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_165563233.1|2556517_2557117_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_165563234.1|2557288_2558320_+	acyltransferase	NA	NA	NA	NA	NA
WP_165563235.1|2558365_2558665_-	peptidase inhibitor I78 family protein	NA	NA	NA	NA	NA
WP_041105036.1|2558782_2559184_+	PA2779 family protein	NA	NA	NA	NA	NA
WP_041105148.1|2559183_2560110_+	PA2778 family cysteine peptidase	NA	NA	NA	NA	NA
WP_041105038.1|2560118_2561402_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_041105040.1|2561867_2563790_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.1	2.2e-126
WP_041105042.1|2563807_2564341_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	37.4	4.0e-14
WP_003289526.1|2564400_2564595_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_165563236.1|2564622_2564979_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_165563237.1|2565148_2566153_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.1	2.4e-28
WP_165563238.1|2566187_2568566_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011913482.1|2568569_2568872_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.4e-11
WP_041105054.1|2568852_2569209_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165563239.1|2569515_2569842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165563240.1|2570255_2570711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165564156.1|2571000_2571288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563241.1|2571397_2572345_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	46.8	3.4e-72
WP_165563242.1|2572662_2574201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563243.1|2574610_2575687_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_165563244.1|2575875_2576070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563245.1|2577164_2578112_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165563246.1|2578204_2580169_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	38.9	1.2e-124
WP_165563247.1|2580666_2583357_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_079379915.1|2583424_2583847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165564157.1|2583869_2585090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057390146.1|2585905_2587636_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_057390140.1|2587628_2588918_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_165563248.1|2588967_2589312_-	RulB protein	NA	A0A218MNF2	uncultured_virus	62.3	5.5e-33
2588989:2589009	attL	CTTACTCTTATCGATGCTGTA	NA	NA	NA	NA
WP_165563249.1|2589304_2589742_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	38.5	2.1e-16
WP_165563250.1|2590019_2590334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563251.1|2590905_2592234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563252.1|2592479_2594039_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	50.3	5.5e-120
WP_003284817.1|2594100_2594436_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003284819.1|2594432_2594750_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_165563253.1|2595714_2596877_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	54.6	1.0e-86
WP_165563254.1|2598605_2599547_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_165563255.1|2599826_2600345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165562410.1|2600726_2601734_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_165563256.1|2601801_2602059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165563257.1|2603409_2604078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025297450.1|2604174_2604378_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	66.7	9.5e-17
WP_165563258.1|2604370_2604982_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_165564158.1|2604978_2605581_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_165564135.1|2605673_2607173_+|transposase	IS21-like element ISPst3 family transposase	transposase	NA	NA	NA	NA
WP_013983804.1|2607165_2607969_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_165563259.1|2608889_2609999_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.3	8.0e-25
2608699:2608719	attR	CTTACTCTTATCGATGCTGTA	NA	NA	NA	NA
WP_009238019.1|2610049_2611303_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_024542659.1|2611478_2611685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165564159.1|2613755_2613878_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_165563260.1|2614001_2614427_+	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
WP_011078033.1|2614617_2615067_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011078034.1|2615063_2615501_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003150544.1|2615829_2616759_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_003089075.1|2617647_2618883_-	TolC family protein	NA	NA	NA	NA	NA
WP_003288512.1|2618882_2619185_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_003089077.1|2619177_2622261_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.2	2.9e-88
WP_003299768.1|2622260_2623298_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003288515.1|2623743_2624418_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.2e-32
WP_165563261.1|2624414_2625809_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.0	4.0e-21
WP_003089081.1|2625933_2626140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089083.1|2626238_2627606_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	56.3	8.7e-29
WP_023095846.1|2627598_2628540_-	chromate resistance protein	NA	NA	NA	NA	NA
WP_003089087.1|2628698_2630003_+	MFS transporter	NA	NA	NA	NA	NA
WP_003089089.1|2630267_2630948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089091.1|2630960_2631698_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_003089094.1|2632209_2632515_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_003089095.1|2632535_2632976_+	DedA family protein	NA	NA	NA	NA	NA
WP_003288518.1|2632972_2633221_+	TraX family protein	NA	NA	NA	NA	NA
WP_003288519.1|2633896_2634343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089107.1|2634373_2634613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150546.1|2634612_2635023_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_165563262.1|2635026_2638020_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.5	2.2e-258
WP_003089113.1|2638032_2638245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150552.1|2638252_2638528_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089115.1|2638540_2638891_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003089120.1|2638965_2639364_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_020932527.1|2640188_2640656_-	DUF2231 domain-containing protein	NA	NA	NA	NA	NA
WP_082866549.1|2640702_2641467_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_165563263.1|2641459_2643238_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_165563264.1|2643338_2643857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082117369.1|2643933_2644068_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_165563253.1|2645705_2646868_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	54.6	1.0e-86
WP_165564160.1|2646935_2647253_+	YegP family protein	NA	NA	NA	NA	NA
WP_165563265.1|2648274_2650374_-|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
WP_165563266.1|2650386_2652894_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_165563267.1|2652890_2653544_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_165563268.1|2653537_2654704_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	30.3	5.7e-29
WP_165563269.1|2654721_2656497_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_165563270.1|2656493_2659514_-	Reverse transcriptase	NA	NA	NA	NA	NA
WP_010562502.1|2660626_2661895_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_165563271.1|2662570_2663173_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	57.8	1.5e-54
WP_013983804.1|2663327_2664131_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_165564135.1|2664123_2665623_-|transposase	IS21-like element ISPst3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	2843347	2854422	4642566	tRNA	uncultured_Caudovirales_phage(60.0%)	12	NA	NA
WP_074519851.1|2843347_2845756_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	6.5e-88
WP_041105559.1|2845774_2846401_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_165563367.1|2846444_2847770_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	8.8e-79
WP_041105557.1|2847766_2848141_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.0	2.7e-09
WP_165563368.1|2848208_2849489_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	56.1	2.7e-101
WP_165563369.1|2849647_2851042_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_041105554.1|2851307_2851973_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	77.5	1.7e-86
WP_061337178.1|2852065_2852458_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	75.2	1.6e-49
WP_165563370.1|2852457_2852817_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	63.3	4.3e-36
WP_165563371.1|2852816_2853119_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	55.0	1.5e-21
WP_043220293.1|2853115_2853451_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	1.6e-37
WP_165563372.1|2853441_2854422_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	72.5	2.1e-138
>prophage 6
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	3143724	3172720	4642566	transposase,integrase	Staphylococcus_phage(33.33%)	26	3138112:3138126	3174526:3174540
3138112:3138126	attL	GACCGAATGGACGAG	NA	NA	NA	NA
WP_003300466.1|3143724_3144933_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_141396778.1|3144929_3146603_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_036998704.1|3146599_3148663_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_082041292.1|3148655_3149096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101153433.1|3149303_3149552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003292677.1|3149615_3149792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003292676.1|3149788_3150151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003292675.1|3150176_3151136_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_008569954.1|3151366_3151780_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_003298426.1|3151776_3152457_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003292672.1|3152461_3152923_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_003292671.1|3153137_3154058_-	cation transporter	NA	NA	NA	NA	NA
WP_023444715.1|3154447_3154777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563521.1|3155415_3158586_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_165563522.1|3158603_3159950_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_165563523.1|3159959_3161267_-	TolC family protein	NA	NA	NA	NA	NA
WP_011911495.1|3161896_3162925_+|transposase	IS30-like element ISPsp7 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	5.9e-46
WP_165563524.1|3163213_3164533_+	OprD family porin	NA	NA	NA	NA	NA
WP_044316307.1|3164854_3165529_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	9.5e-29
WP_165563525.1|3165525_3166899_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_003292662.1|3167021_3167426_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_165563526.1|3167518_3168409_+	cation transporter	NA	NA	NA	NA	NA
WP_003292660.1|3168495_3169128_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_076545171.1|3169986_3170292_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3B212	Gordonia_phage	37.8	9.6e-05
WP_111263156.1|3171995_3172331_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_165563527.1|3172327_3172720_-|transposase	transposase	transposase	NA	NA	NA	NA
3174526:3174540	attR	CTCGTCCATTCGGTC	NA	NA	NA	NA
>prophage 7
NZ_CP045858	Pseudomonas balearica strain EC28 chromosome, complete genome	4642566	3735714	3805543	4642566	transposase,integrase,protease,tRNA	uncultured_virus(10.0%)	60	3785983:3785999	3799091:3799107
WP_165563751.1|3735714_3737220_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.2	7.2e-85
WP_102847940.1|3737315_3738411_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	3.3e-07
WP_165563752.1|3738524_3739262_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_165563753.1|3739286_3740396_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_165563754.1|3740485_3742585_-	molybdopterin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_165563755.1|3742694_3744410_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.9	2.0e-62
WP_165563756.1|3744522_3745065_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_165563757.1|3745130_3746264_-	GGDEF domain-containing protein	NA	A0A2D0WB36	Bordetella_virus	33.1	2.0e-07
WP_041107113.1|3746481_3746697_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_041107115.1|3746893_3747364_+	bacterioferritin	NA	NA	NA	NA	NA
WP_061340392.1|3747465_3747792_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_041107119.1|3748069_3748987_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	26.9	1.4e-19
WP_041107120.1|3748983_3750093_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	2.5e-26
WP_043219117.1|3750096_3750588_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	42.1	1.3e-06
WP_165563758.1|3750605_3751976_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_041107126.1|3752044_3753625_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.0	4.5e-21
WP_041107128.1|3753734_3755204_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.4	1.5e-95
WP_139047981.1|3755297_3755849_-	sugar ABC transporter ATPase	NA	NA	NA	NA	NA
WP_165563759.1|3755960_3757337_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	35.2	1.5e-36
WP_041107134.1|3757406_3758231_+	M23 family metallopeptidase	NA	I2E8W3	Clostridium_phage	42.5	7.8e-17
WP_041107136.1|3758247_3758790_+	hydrolase	NA	NA	NA	NA	NA
WP_165563760.1|3758882_3760175_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_061340401.1|3760319_3762518_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_061338747.1|3762569_3762989_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_061340402.1|3763278_3764949_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_061340403.1|3765092_3766145_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.0	4.6e-78
WP_165563761.1|3766222_3767086_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003119937.1|3767757_3767985_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_165563762.1|3768087_3768678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563763.1|3768674_3770075_+	DEAD/DEAH box helicase family protein	NA	I4AZM6	Saccharomonospora_phage	33.0	1.0e-40
WP_165563764.1|3770165_3770468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563765.1|3770866_3771478_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_096067268.1|3771627_3772878_-	TerD family protein	NA	NA	NA	NA	NA
WP_165563766.1|3773124_3774330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165563767.1|3774606_3774978_+|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	30.0	9.0e-05
WP_165563768.1|3774974_3775310_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_165563769.1|3775372_3776899_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.7	1.4e-123
WP_043290347.1|3777906_3778434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165563770.1|3778448_3780491_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_165562412.1|3780491_3781181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014159572.1|3781177_3781981_+	cytochrome c	NA	NA	NA	NA	NA
WP_165563771.1|3781993_3782377_+	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_023101973.1|3783981_3785130_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_023101972.1|3785281_3786802_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
3785983:3785999	attL	CAAGATCGCCTTCACCG	NA	NA	NA	NA
WP_165564190.1|3786960_3788460_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_165563772.1|3788452_3789256_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.2	5.2e-34
WP_165563773.1|3789410_3789734_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_165564191.1|3791356_3792487_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165563527.1|3792628_3793021_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111263156.1|3793017_3793353_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_165563774.1|3795209_3796403_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_003090776.1|3798222_3798801_-	TerD family protein	NA	NA	NA	NA	NA
WP_003090777.1|3798836_3799415_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.8	2.5e-30
3799091:3799107	attR	CGGTGAAGGCGATCTTG	NA	NA	NA	NA
WP_003090778.1|3799443_3800478_-	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	45.9	6.5e-69
WP_003090780.1|3800490_3800940_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_165563775.1|3800987_3802178_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_165563776.1|3802174_3802771_-	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	36.5	3.4e-22
WP_165563777.1|3802773_3803502_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_165563778.1|3803501_3804449_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_003090784.1|3804448_3805543_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	8.2e-38
