The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	53830	114814	6716578	transposase,plate	Dishui_lake_phycodnavirus(20.0%)	59	NA	NA
WP_023094285.1|53830_54523_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079384552.1|54569_54944_+	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_071534147.1|55095_55311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134273854.1|58365_58869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019485604.1|58865_59183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003114586.1|59413_60115_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071534148.1|60364_60877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025992542.1|61897_62086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126584460.1|62399_62657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083536.1|63075_63471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073647740.1|63741_65151_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_023097114.1|65314_66688_+	T3SS effector bifunctional cytotoxin exoenzyme T	NA	NA	NA	NA	NA
WP_003083559.1|67183_67870_+	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_003083569.1|67900_68254_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_003083573.1|68250_68916_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_003104304.1|68930_69314_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003118561.1|69595_71257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083582.1|71866_72007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003083584.1|72068_72206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012613433.1|72831_74664_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	28.3	2.7e-17
WP_003083588.1|74719_75148_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003111525.1|75414_75585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003111524.1|75587_76058_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_003111523.1|76074_76623_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	41.6	6.1e-34
WP_003083593.1|76661_77168_-	DUF1993 family protein	NA	NA	NA	NA	NA
WP_003083596.1|77233_78154_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003083599.1|78261_79149_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003111521.1|79211_79916_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003118563.1|79999_80455_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003122274.1|80565_80799_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003083612.1|80810_81248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003083614.1|81304_81721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003118564.1|81812_82940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034003444.1|82947_83931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106611.1|83963_84629_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003106612.1|84621_85164_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003083621.1|85241_87287_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	21.3	4.6e-34
WP_003083624.1|87283_87559_+	YheV family putative metal-binding protein	NA	NA	NA	NA	NA
WP_003118567.1|87647_88706_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_003106614.1|88935_89850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106615.1|89911_91624_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_003128189.1|91616_92816_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003111510.1|92815_93535_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.3e-19
WP_058148208.1|93531_96630_-	protein kinase	NA	M1PCM5	Moumouvirus	27.4	1.6e-22
WP_003083639.1|96637_97366_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_034003448.1|97375_98056_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_009875647.1|98052_101583_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_003115051.1|101579_102929_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_003115052.1|102935_104270_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003083660.1|104285_104750_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009314907.1|104794_106342_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_023114795.1|106709_107744_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_003083666.1|107832_108351_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003104973.1|108363_109860_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003083670.1|109935_110424_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003119488.1|110591_111437_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003104971.1|111438_111948_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003083676.1|111944_113804_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003104969.1|113767_114814_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	650862	703629	6716578	tRNA,tail,plate,holin	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_003129196.1|650862_651888_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|651966_652536_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|652619_652973_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|652963_653506_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|653478_654711_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|654754_655261_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|655354_656908_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|656904_658176_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|658276_660199_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|660477_660810_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|660853_661705_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|661704_662085_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003161932.1|662121_662928_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_033936327.1|663043_664030_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|664026_665319_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_023129218.1|665299_668071_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|668197_669214_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|669210_669885_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003117960.1|669886_670645_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_034003256.1|670645_671707_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_034003258.1|671858_674252_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003099542.1|674300_674930_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033936330.1|675058_676093_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|676326_677436_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|677491_678538_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|678652_679900_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|680005_680836_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|680959_681634_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|681633_682452_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_015649712.1|682524_684003_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|684320_684635_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|684734_685505_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|685962_686163_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|686210_686570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073647038.1|686933_687383_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	6.5e-26
WP_021263056.1|687404_687920_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	6.3e-33
WP_003121844.1|687916_688474_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|688626_688953_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|688949_689837_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003118911.1|689829_690363_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_034003260.1|690364_692473_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.1	3.2e-224
WP_003085172.1|692481_692922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003121848.1|692964_694125_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|694137_694641_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|694655_695000_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034003262.1|695169_697407_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003085182.1|697416_698289_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|698263_698470_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003121851.1|698527_699517_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.7e-106
WP_033983396.1|699549_700179_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.9	2.5e-87
WP_003121852.1|700175_700538_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|700534_700792_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113175.1|701139_701745_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	4.6e-75
WP_003085203.1|701746_702796_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003142812.1|702792_703629_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.2e-70
>prophage 3
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	1445879	1454907	6716578		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1445879_1446515_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1446560_1447454_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1447558_1448563_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1448988_1449312_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079384482.1|1449378_1451946_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092265.1|1452071_1453079_-	TolB family protein	NA	NA	NA	NA	NA
WP_034002366.1|1453226_1453733_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	75.3	6.2e-57
WP_003092260.1|1453866_1454907_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	2595971	2653867	6716578	terminase,integrase,tRNA,tail,holin	Pseudomonas_phage(56.92%)	79	2587951:2587968	2610731:2610748
2587951:2587968	attL	GATCGGCTTCAACCAGCA	NA	NA	NA	NA
WP_003119978.1|2595971_2597252_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	1.8e-97
WP_003108773.1|2597253_2598651_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2598655_2599630_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2599717_2600701_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003090393.1|2600697_2601033_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2601029_2601335_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2601334_2601694_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003097619.1|2601690_2602086_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2602196_2602865_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_016852955.1|2603200_2604268_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.7	8.3e-136
WP_003116724.1|2604269_2604506_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_165567134.1|2604585_2606565_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	41.1	4.0e-75
WP_042853816.1|2606662_2607169_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	96.4	1.4e-88
WP_042853817.1|2607165_2607531_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	95.5	1.9e-60
WP_165567135.1|2607527_2608313_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	95.9	3.8e-138
WP_165567136.1|2608309_2608951_-	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	93.9	1.5e-119
WP_003160553.1|2608947_2609271_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	100.0	9.4e-59
WP_034033554.1|2609267_2609762_-	DUF550 domain-containing protein	NA	L7TI87	Pseudomonas_virus	95.7	1.3e-88
WP_031690108.1|2609911_2610340_-	hypothetical protein	NA	H2BD44	Pseudomonas_phage	96.5	3.4e-72
WP_088406988.1|2610336_2612022_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	97.8	9.9e-309
2610731:2610748	attR	TGCTGGTTGAAGCCGATC	NA	NA	NA	NA
WP_157738343.1|2612137_2612464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135811308.1|2612627_2614370_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	92.7	5.8e-288
WP_003099027.1|2614373_2615363_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	61.1	7.5e-91
WP_043514455.1|2615375_2615576_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	98.5	1.6e-29
WP_014602814.1|2615582_2616482_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	3.2e-104
WP_010793153.1|2616494_2617403_-	hypothetical protein	NA	Q858E0	Salmonella_phage	71.6	2.8e-124
WP_010793152.1|2617413_2617623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010793151.1|2617619_2617841_-	hypothetical protein	NA	A0A127KNM7	Pseudomonas_phage	95.7	2.8e-30
WP_019486665.1|2617824_2617977_-	hypothetical protein	NA	A0A127KNF7	Pseudomonas_phage	100.0	6.9e-12
WP_003099041.1|2618552_2618924_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_023096619.1|2618972_2619236_-	hypothetical protein	NA	A0A127KNM4	Pseudomonas_phage	100.0	1.6e-45
WP_033953764.1|2619293_2619500_-	hypothetical protein	NA	A0A0U4IJ22	Pseudomonas_phage	97.1	3.0e-34
WP_034004099.1|2619510_2619717_-	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	98.5	1.5e-30
WP_023101084.1|2620152_2620392_-	DUF1654 domain-containing protein	NA	A0A127KND4	Pseudomonas_phage	96.2	2.0e-37
WP_034004098.1|2620485_2620803_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	97.1	6.6e-49
WP_031635265.1|2620856_2621456_-	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	51.7	9.3e-52
WP_019396726.1|2621604_2621847_+	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	100.0	7.5e-37
WP_034004095.1|2622105_2622618_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	98.8	2.1e-89
WP_010793144.1|2622700_2623273_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	99.5	7.1e-102
WP_165567137.1|2623275_2624238_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	51.4	4.7e-13
WP_108110598.1|2624365_2624779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108110594.1|2624771_2625215_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.6	1.0e-76
WP_058170155.1|2625243_2626113_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	97.9	4.1e-165
WP_004349441.1|2626227_2626617_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_016852757.1|2626609_2626894_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	97.9	5.9e-41
WP_031637685.1|2626925_2627192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115879.1|2627474_2627897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139270288.1|2628033_2628465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022579916.1|2628593_2629190_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	60.5	4.4e-46
WP_023087355.1|2629176_2630472_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	58.5	1.4e-145
WP_003451684.1|2630474_2631830_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	46.0	4.3e-97
WP_165567138.1|2631826_2632906_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.1	1.1e-201
WP_003103389.1|2633034_2633778_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_023087394.1|2633787_2634759_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.0	1.9e-110
WP_023087395.1|2634800_2635286_+	hypothetical protein	NA	A0A0M3LS62	Mannheimia_phage	40.0	3.3e-07
WP_023087396.1|2635269_2635734_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	2.0e-09
WP_055320631.1|2635733_2636123_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.8	9.6e-34
WP_023087397.1|2636126_2636801_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	1.0e-115
WP_022579906.1|2636797_2637208_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	44.1	3.0e-25
WP_003451664.1|2637275_2637929_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.3	1.3e-59
WP_019396742.1|2637938_2638319_+	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	3.1e-29
WP_003103408.1|2638381_2638645_+	hypothetical protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	3.6e-16
WP_165567139.1|2638641_2641833_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	41.1	2.2e-155
WP_003103417.1|2641838_2642177_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	98.2	1.5e-59
WP_034004060.1|2642173_2642923_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	90.4	3.0e-132
WP_057390272.1|2642925_2643690_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	99.2	5.2e-148
WP_126633639.1|2643761_2644343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165567140.1|2644408_2645020_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	83.7	1.8e-87
WP_137462633.1|2645050_2645284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567141.1|2645372_2648957_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	75.8	0.0e+00
WP_071557737.1|2648953_2649238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031674996.1|2650127_2650895_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	51.8	2.7e-56
WP_165567142.1|2650938_2651568_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	93.8	1.0e-109
WP_165567143.1|2651564_2651933_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	84.4	1.3e-43
WP_165567144.1|2651929_2652193_+	hypothetical protein	NA	H2BDA1	Pseudomonas_phage	93.8	7.7e-35
WP_003160542.1|2652228_2652492_+	hypothetical protein	NA	Q9MC87	Pseudomonas_phage	94.3	9.0e-44
WP_021263881.1|2652596_2653085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004354886.1|2653081_2653327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165567145.1|2653351_2653867_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	92.9	1.6e-92
>prophage 5
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	2821396	2900041	6716578	transposase,bacteriocin,integrase	Salmonella_phage(14.29%)	47	2821260:2821289	2876405:2876434
2821260:2821289	attL	GGGGTCATGCCGAGATAAGGGGAAAATTCA	NA	NA	NA	NA
WP_003111042.1|2821396_2824411_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	1.7e-72
WP_003111043.1|2824407_2824770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120171.1|2824949_2825414_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003120172.1|2825421_2826327_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003111046.1|2826323_2827052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012075823.1|2827067_2828477_-	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
WP_003111048.1|2828887_2830204_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_003111049.1|2830225_2830969_-	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
WP_003111050.1|2830998_2831970_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003111051.1|2832150_2833152_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_010792965.1|2833190_2833412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095636.1|2833738_2834716_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023095637.1|2834705_2836367_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023095638.1|2836347_2836923_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	8.9e-44
WP_023980443.1|2838656_2839604_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_023095640.1|2839606_2839864_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_023095641.1|2839962_2840289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095642.1|2840285_2840657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023095643.1|2841608_2842055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074250675.1|2842069_2842906_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_071536849.1|2844536_2845067_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_165567150.1|2845476_2848590_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	4.2e-47
WP_049875008.1|2848599_2849781_-	efflux RND transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	23.9	1.2e-05
WP_023095647.1|2850034_2851630_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	5.0e-20
WP_023095648.1|2851629_2852655_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023095649.1|2852654_2853725_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_023095650.1|2853724_2855650_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023095651.1|2855770_2858464_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.0	2.9e-36
WP_023095652.1|2858631_2859033_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_023095653.1|2859034_2859742_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_023095655.1|2861375_2863202_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	1.4e-26
WP_023095656.1|2863285_2864629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031277719.1|2866774_2867557_-	SDR family oxidoreductase	NA	F2NZ12	Diadromus_pulchellus_ascovirus	27.4	1.3e-05
WP_003131969.1|2867641_2868076_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|2868147_2868498_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|2868510_2868786_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003156770.1|2868857_2870543_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
WP_000995360.1|2870560_2870926_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|2870922_2871159_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_165567151.1|2871155_2871944_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_045890798.1|2871940_2872144_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|2872274_2872835_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_003120098.1|2876528_2877053_+	hypothetical protein	NA	NA	NA	NA	NA
2876405:2876434	attR	TGAATTTTCCCCTTATCTCGGCATGACCCC	NA	NA	NA	NA
WP_023093482.1|2877365_2879063_+	two-partner secretion system transporter TpsB1	NA	NA	NA	NA	NA
WP_011920678.1|2891188_2892490_-|transposase	ISL3-like element IS1411 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.4	9.4e-150
WP_124124669.1|2897500_2897881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086008657.1|2898878_2900041_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
>prophage 6
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	5012051	5022339	6716578	integrase	Pseudomonas_phage(90.0%)	14	5011777:5011807	5024029:5024059
5011777:5011807	attL	AGGGTTCGATTCCCTTCGCCCGCTCCAGATC	NA	NA	NA	NA
WP_165567184.1|5012051_5012762_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	67.4	1.3e-89
WP_165567185.1|5012855_5013839_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.3	1.0e-92
WP_165567186.1|5013838_5015131_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.3	3.5e-245
WP_165567187.1|5015389_5016652_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	54.5	2.1e-117
WP_023088522.1|5016653_5017004_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	1.6e-19
WP_019725828.1|5018285_5018504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105750598.1|5018517_5018769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5018780_5018873_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_046890062.1|5018889_5019324_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	5.5e-62
WP_160189255.1|5019454_5019832_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.0	2.9e-59
WP_023088865.1|5019835_5020126_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
WP_160330328.1|5020129_5020288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023086597.1|5020299_5020515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567188.1|5020986_5022339_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	30.7	4.6e-22
5024029:5024059	attR	AGGGTTCGATTCCCTTCGCCCGCTCCAGATC	NA	NA	NA	NA
>prophage 7
NZ_CP045002	Pseudomonas aeruginosa strain PAG5 chromosome, complete genome	6716578	5641771	5649065	6716578	integrase	Pseudomonas_phage(87.5%)	10	5641179:5641238	5653730:5653811
5641179:5641238	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
WP_003162405.1|5641771_5642779_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	3.7e-77
WP_023087821.1|5642775_5644068_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.0	3.0e-241
WP_165567187.1|5644326_5645589_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	54.5	2.1e-117
WP_023088522.1|5645590_5645941_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	1.6e-19
WP_019725828.1|5647220_5647439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105750598.1|5647452_5647704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5647715_5647808_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_046890062.1|5647824_5648259_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	98.6	5.5e-62
WP_165567200.1|5648393_5648771_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	99.2	9.6e-63
WP_023088865.1|5648774_5649065_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
5653730:5653811	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP045003	Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence	513322	0	65187	513322	transposase,integrase	Shigella_phage(33.33%)	38	42755:42771	68096:68112
WP_009681706.1|1016_2573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009681705.1|2565_7524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009681704.1|8221_8641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087785415.1|9473_9743_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_165567216.1|9976_10333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019485048.1|11346_11604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004352797.1|11909_12776_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.3	4.6e-60
WP_012077888.1|12772_13066_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086008398.1|13096_14250_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.9	1.9e-85
WP_010794468.1|14423_15650_+|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
WP_021263740.1|15687_18729_-	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	25.0	3.0e-29
WP_023096322.1|18729_20742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077893.1|21501_23628_-	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_012077896.1|26411_27881_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.9	7.9e-28
WP_012077900.1|31997_32645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025297754.1|32710_32998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567215.1|33647_33971_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	40.5	3.4e-08
WP_012077905.1|37511_39755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160328552.1|42751_43567_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
42755:42771	attL	TCCGCGCCTACGCCAGC	NA	NA	NA	NA
WP_153565776.1|43640_44183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794469.1|44646_46020_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_124083333.1|46016_46526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794470.1|46509_48474_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_029771340.1|48473_48893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567217.1|48904_49810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011920678.1|49899_51201_-|transposase	ISL3-like element IS1411 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.4	9.4e-150
WP_165567218.1|53069_54017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042858451.1|54316_54919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165567219.1|55001_55784_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.3	2.6e-22
WP_044286610.1|55926_56634_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_165567220.1|56630_56897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165567221.1|56947_57742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100250167.1|59418_60614_-|transposase	IS3-like element ISPpu29 family transposase	transposase	U5P429	Shigella_phage	32.6	1.2e-21
WP_165567222.1|61143_62724_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_042933865.1|62730_63027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567223.1|63028_63454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567224.1|63649_64033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165567225.1|64131_65187_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
68096:68112	attR	TCCGCGCCTACGCCAGC	NA	NA	NA	NA
>prophage 2
NZ_CP045003	Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence	513322	92140	152966	513322	transposase,integrase	Escherichia_phage(23.08%)	57	91043:91102	153091:153213
91043:91102	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001067855.1|92140_92845_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|92957_93773_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067858.1|94026_94731_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004896925.1|95615_96158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155092.1|96516_97401_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_165567249.1|97456_98965_-	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	59.0	6.8e-160
WP_002001451.1|100432_101617_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|101665_101851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|102070_102352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|102332_103106_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_032728035.1|103289_104306_+|transposase	IS30-like element IS1394 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
WP_000050481.1|105607_107149_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|107553_108393_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000186237.1|108889_109522_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|109659_110490_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_074412830.1|110570_110855_-	Pathogenicity locus	NA	NA	NA	NA	NA
WP_063860608.1|111007_111745_-	subclass B1 metallo-beta-lactamase IMP-45	NA	NA	NA	NA	NA
WP_003159191.1|111822_112377_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000845048.1|112537_113551_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_003090771.1|113925_114486_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	1.8e-57
WP_003090772.1|114489_117456_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	96.8	0.0e+00
WP_010792922.1|117995_118241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792921.1|118719_119616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058131725.1|120755_121829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285139.1|121859_123050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285138.1|123197_123857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058131721.1|123989_125066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065285137.1|125083_125662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010792915.1|125780_126203_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010792914.1|126355_126703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792913.1|126752_127073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160329452.1|127211_127496_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	56.2	2.6e-20
WP_010792911.1|127602_128088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285136.1|128084_130301_+	exodeoxyribonuclease	NA	NA	NA	NA	NA
WP_010792909.1|130275_132087_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_010792908.1|132123_132465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792907.1|132569_132920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792906.1|132923_133319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792905.1|133321_133699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792904.1|133700_134327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019486150.1|134329_135124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285134.1|135120_136644_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_019486152.1|136653_136977_+	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_065285133.1|136964_137438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285132.1|137437_140386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438451.1|140366_140744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065285131.1|140747_142049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111075.1|142029_142689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057390462.1|142685_143390_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_100219735.1|143469_144165_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_019486160.1|144174_145068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019486161.1|145064_146489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111073.1|146481_148530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083199921.1|148709_149906_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_021264138.1|149912_150392_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065761940.1|150588_151428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|152201_152966_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
153091:153213	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATTTGGTATCTCTCATAAACGGATGTTTTTGAGAGAACTATCTTCGGCCTTCACACGCACGAAA	NA	NA	NA	NA
>prophage 3
NZ_CP045003	Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence	513322	448250	509728	513322	protease,transposase,integrase	Acinetobacter_phage(12.5%)	52	461946:461960	513007:513021
WP_010792510.1|448250_449009_+	hypothetical protein	NA	A0A172Q0Q4	Acinetobacter_phage	25.7	3.8e-10
WP_165567236.1|449001_450096_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.0	3.3e-39
WP_010792508.1|450095_451043_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_010792507.1|451042_451771_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010792506.1|451773_452367_+	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	37.4	4.7e-24
WP_010792505.1|452363_453554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792504.1|453601_454051_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	30.2	1.3e-10
WP_010792503.1|454062_455097_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.2	3.1e-71
WP_010792502.1|455125_455704_+	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	31.0	5.7e-06
WP_010792501.1|455737_456316_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	43.7	9.9e-35
WP_010792500.1|456450_457476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792499.1|457580_458141_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_021018408.1|458347_459547_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011920678.1|460295_461597_-|transposase	ISL3-like element IS1411 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.4	9.4e-150
461946:461960	attL	CGTCCTTGTTCTTGG	NA	NA	NA	NA
WP_010792497.1|462494_463754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010792496.1|463962_464466_-	TerD family protein	NA	NA	NA	NA	NA
WP_010792495.1|464843_466112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792494.1|466138_466990_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_065760315.1|468039_468360_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_065760316.1|468356_468692_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065760317.1|468755_470291_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	51.0	8.6e-118
WP_065760318.1|470376_470787_-	glutathione transferase	NA	NA	NA	NA	NA
WP_010792492.1|471886_473098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038405141.1|473284_474400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038405140.1|474412_474661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792489.1|474869_475955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021018404.1|476079_477225_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.3	6.8e-35
WP_010792486.1|477646_477838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567237.1|478215_479001_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_165567238.1|480408_480696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010792484.1|480892_482143_+	TerD family protein	NA	NA	NA	NA	NA
WP_021018402.1|482188_482713_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_010792483.1|482709_483105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060616973.1|483314_485198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794447.1|486545_487070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794448.1|487748_488153_+	response regulator	NA	NA	NA	NA	NA
WP_010794449.1|488149_488995_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_010794450.1|489125_490421_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010794451.1|492540_493632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010794452.1|493663_494869_-	hypothetical protein	NA	J9Q6K3	Salmonella_phage	38.7	2.6e-08
WP_010794453.1|495002_496037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567239.1|496460_497381_+	hypothetical protein	NA	A0A2I7R6K1	Vibrio_phage	44.3	1.0e-33
WP_165567240.1|497383_497758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042854470.1|498122_499004_+	prohibitin family protein	NA	A0A1S6UA41	Serratia_phage	54.4	1.6e-52
WP_162835983.1|500504_500678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567241.1|500807_501446_+	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	37.0	1.8e-32
WP_165567242.1|501498_501921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567243.1|502076_502421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165567244.1|502496_502931_+	GTP pyrophosphokinase	NA	A0A141E1X8	Streptococcus_phage	46.7	4.8e-26
WP_165567245.1|503100_503871_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011920678.1|506210_507512_-|transposase	ISL3-like element IS1411 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.4	9.4e-150
WP_009681710.1|508597_509728_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
513007:513021	attR	CCAAGAACAAGGACG	NA	NA	NA	NA
