The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	445118	478376	5381963	portal,capsid,protease,tRNA,integrase,head,terminase,tail	uncultured_Caudovirales_phage(75.0%)	34	462726:462743	478721:478738
WP_002919147.1|445118_446066_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|446080_446590_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446718_447843_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447814_448288_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|448313_448856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|448860_449433_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|449436_450255_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|450251_450509_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450484_451039_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|456834_457056_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|457349_460460_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|460472_461612_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|461990_462641_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462726:462743	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|462916_464143_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|464235_465177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|465358_465643_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|465653_466433_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|466935_467154_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|467146_467335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|467411_467540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|467638_468007_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|468003_468369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|468368_470504_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|470846_471182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|471230_471743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|472006_473173_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|473224_473785_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|473786_475028_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|475024_475360_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|475356_475656_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|475655_476099_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|476091_476244_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|476374_476731_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|476714_478376_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
478721:478738	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	1233655	1279890	5381963	portal,plate,capsid,tRNA,integrase,head,coat,terminase,lysis,tail	Salmonella_phage(83.72%)	61	1231949:1231995	1268516:1268562
1231949:1231995	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1233655_1234681_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1234683_1235313_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1235435_1235678_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1235710_1236220_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1236227_1236428_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1236391_1236730_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1236797_1237031_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1237030_1237258_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1237254_1238106_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1238102_1240487_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1240649_1240838_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1240849_1241083_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1241178_1241862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1241848_1242928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1242927_1243929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1244450_1244720_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1244776_1245820_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1245819_1247583_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1247723_1248557_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1248573_1249626_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1249629_1250283_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1250378_1250843_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1250842_1251046_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1251049_1251265_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1251245_1251755_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1251759_1252143_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1252139_1252568_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1252542_1252701_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1252663_1253086_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1253078_1253525_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1253547_1254414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1254508_1255081_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1255077_1255440_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1255426_1256335_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1256327_1256999_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1257000_1258950_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1258959_1260078_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1260129_1261203_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1261351_1262524_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1262533_1263049_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1263101_1263401_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1263415_1263535_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1263761_1266158_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1266154_1266640_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1266636_1267731_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1267797_1268016_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1268043_1268421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1269024_1269507_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1268516:1268562	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1269617_1270094_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1270083_1270374_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1270440_1270782_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1270763_1270904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1270929_1272591_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1272677_1273556_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1273680_1274271_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1274390_1275677_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1275696_1276488_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1276651_1278016_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1278275_1278524_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1278542_1279091_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1279122_1279890_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	1384606	1451036	5381963	transposase,protease,integrase,holin,terminase,tail	Salmonella_phage(31.37%)	73	1385601:1385618	1453784:1453801
WP_004151980.1|1384606_1386073_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1385601:1385618	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|1386140_1387718_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_087831089.1|1387909_1389160_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	8.0e-207
WP_004243823.1|1389176_1389368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059065281.1|1389364_1389961_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.3	5.3e-108
WP_023285452.1|1389957_1390464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152545.1|1390460_1390619_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_009485475.1|1390611_1390905_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1391014_1391263_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_165539438.1|1391311_1392193_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	83.3	1.9e-133
WP_165539440.1|1392189_1393011_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_165539442.1|1393007_1393214_-	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	76.0	6.2e-16
WP_004164029.1|1393210_1393510_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1393506_1393656_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1393876_1394458_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_023285447.1|1394612_1394846_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_004152537.1|1394992_1395202_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285446.1|1395201_1395969_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1395965_1396751_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_071182195.1|1396870_1397215_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_165539443.1|1397407_1397842_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.7e-16
WP_004151293.1|1397948_1398791_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|1398790_1398967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165539445.1|1398963_1399650_+	DUF551 domain-containing protein	NA	A0A2I6PID9	Escherichia_phage	59.8	1.8e-19
WP_071182193.1|1399734_1400040_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
WP_023339258.1|1400032_1400371_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_032418540.1|1400445_1400703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457429.1|1400780_1401365_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_147001537.1|1401361_1402837_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.7	1.9e-279
WP_087826983.1|1402996_1403353_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.9	4.1e-39
WP_108714601.1|1404059_1404266_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	75.0	1.6e-08
WP_032447873.1|1404280_1405963_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.5e-264
WP_004141364.1|1405959_1406259_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	68.4	3.1e-32
WP_004141362.1|1406255_1406579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071182166.1|1406590_1407280_+	peptidase	NA	G9L6C4	Escherichia_phage	74.7	1.7e-65
WP_048982556.1|1407294_1408281_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.9e-179
WP_020953461.1|1408334_1408772_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_071182165.1|1408782_1409124_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	71.7	1.8e-36
WP_032447863.1|1409174_1409498_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	84.1	2.6e-45
WP_071182164.1|1409497_1410103_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.5	1.4e-87
WP_071182163.1|1410102_1412580_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.6	0.0e+00
WP_004152438.1|1412579_1413044_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_147001540.1|1413043_1413583_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	79.0	9.5e-72
WP_147001541.1|1413593_1416215_+	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	32.0	1.8e-54
WP_147001542.1|1416216_1417923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147001543.1|1417922_1420469_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	46.0	4.5e-212
WP_122051134.1|1420470_1420842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418553.1|1421225_1421414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064152944.1|1421565_1422255_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	2.1e-79
WP_085457688.1|1422569_1422866_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	65.1	8.1e-25
WP_077273473.1|1425801_1426383_-	sugar transferase	NA	NA	NA	NA	NA
WP_004146394.1|1426626_1427031_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_023339240.1|1427017_1427323_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_071182157.1|1427312_1427942_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	2.5e-92
WP_071182156.1|1427938_1428439_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	86.9	1.0e-67
WP_004152009.1|1428625_1430494_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1430477_1431656_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1431949_1433182_-	MFS transporter	NA	NA	NA	NA	NA
WP_004221278.1|1433255_1434167_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174861.1|1434263_1434437_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_002913841.1|1434807_1437036_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1437089_1438622_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1438625_1440686_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1440866_1441508_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1441504_1442542_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1442805_1443699_+	ROK family protein	NA	NA	NA	NA	NA
WP_002913829.1|1443708_1445142_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1445359_1445986_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1446081_1447368_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1447466_1448168_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1448164_1449076_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|1449203_1449563_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|1449572_1451036_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1453784:1453801	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	1759337	1766242	5381963	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1759337_1760201_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_039819854.1|1760211_1760985_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004151134.1|1761225_1762122_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819857.1|1762364_1763726_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004175198.1|1764044_1764767_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1764763_1766242_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	1809586	1822903	5381963	transposase	Enterobacteria_phage(22.22%)	12	NA	NA
WP_000043543.1|1809586_1810993_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1811219_1812635_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1812656_1814027_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1814181_1815246_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819507.1|1815259_1816129_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_004175259.1|1816160_1817051_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1817065_1817620_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_039819510.1|1817799_1818966_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_077255456.1|1820580_1820685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004144151.1|1821376_1821499_-	small membrane protein	NA	NA	NA	NA	NA
WP_045327201.1|1821635_1821830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039819511.1|1821898_1822903_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 6
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	2875278	2886165	5381963		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2875278_2878386_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2878440_2879706_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2879736_2880825_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2880911_2881172_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2881469_2882330_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2882350_2883112_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2883372_2884275_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2884286_2885552_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2885544_2886165_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	3111095	3152837	5381963	terminase,integrase	Klebsiella_phage(34.04%)	62	3143950:3143964	3149959:3149973
WP_014343022.1|3111095_3114119_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3114174_3114372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3114346_3114478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3114598_3114763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108714555.1|3115237_3116011_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	8.2e-77
WP_004152574.1|3116007_3117204_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3117203_3117557_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3117558_3118212_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3118265_3118616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3118868_3119054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3119106_3119448_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3119447_3120470_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3120472_3120700_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3120775_3121189_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3121374_3123378_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3123367_3123520_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3123555_3123981_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3123984_3124425_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3124435_3125581_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3125584_3126025_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3126119_3126506_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3126505_3127012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3127008_3127428_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3127396_3127678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3127717_3128659_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3128670_3129165_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3129168_3130371_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3130422_3130971_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3131026_3132478_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3132715_3134116_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3134066_3134555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3134920_3135241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3135475_3135865_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3135861_3136392_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3136394_3136643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3136660_3136789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3136826_3136982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3137048_3137831_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3137827_3138304_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3138300_3139263_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3139264_3140923_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3141499_3141721_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3141818_3142487_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3142657_3142972_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3142964_3143153_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3143526_3143688_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3143680_3143935_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3143950:3143964	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3144002_3144125_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3144121_3144547_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3144543_3144738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3144734_3145562_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3145666_3146185_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3146190_3146901_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3146890_3147115_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3147210_3147324_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3147566_3147800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3147872_3148019_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3147978_3148221_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3148201_3149383_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3149579_3150128_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3149959:3149973	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3150326_3151859_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3152075_3152837_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	3498593	3524547	5381963	integrase,head,protease,tail	Pectobacterium_phage(22.22%)	39	3509843:3509858	3524608:3524623
WP_004191050.1|3498593_3499067_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_159225346.1|3499105_3500101_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.6	7.0e-105
WP_159225347.1|3500111_3500864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225352.1|3500850_3501174_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_064185222.1|3501176_3502841_-|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	3.1e-105
WP_009308353.1|3502840_3504235_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_071035057.1|3504319_3504772_-	DNA-packaging protein	NA	A3EYX3	Salmonella_phage	67.2	1.5e-49
WP_004199477.1|3504778_3505039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199520.1|3505022_3505256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225348.1|3505317_3505842_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.1	6.2e-44
WP_159225349.1|3505882_3506323_-	hypothetical protein	NA	R9TRJ4	Aeromonas_phage	43.8	3.6e-13
WP_004199527.1|3506328_3506676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071838911.1|3506663_3506987_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_048256710.1|3506976_3507570_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	2.7e-80
WP_029499143.1|3507638_3507830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225350.1|3508011_3508350_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	9.5e-46
WP_159225351.1|3508349_3508589_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_159225353.1|3508581_3508947_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	62.2	2.5e-31
WP_159225332.1|3509030_3509324_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	85.6	7.7e-44
WP_159225333.1|3509323_3509686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225334.1|3509682_3509889_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	94.1	1.2e-30
3509843:3509858	attL	GCCAGTTTCAGGCGGT	NA	NA	NA	NA
WP_159225335.1|3509885_3510440_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	46.4	2.1e-05
WP_009308335.1|3510567_3511353_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.4e-63
WP_009308334.1|3511392_3511626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308333.1|3511629_3512280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159225336.1|3512318_3513707_-	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	46.6	1.3e-104
WP_060617680.1|3513703_3514696_-	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	55.5	2.6e-30
WP_046387639.1|3514698_3514857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644597.1|3514940_3515387_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	5.7e-30
WP_024623103.1|3515447_3515642_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	45.9	1.7e-07
WP_159225337.1|3515721_3516123_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	60.2	2.7e-39
WP_159225339.1|3517063_3517297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159225338.1|3517341_3519471_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.9e-97
WP_009308318.1|3519470_3520037_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|3520038_3520224_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_004199480.1|3520433_3520658_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_016197576.1|3520661_3521690_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	4.4e-94
WP_004150834.1|3521965_3523618_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3523887_3524547_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
3524608:3524623	attR	GCCAGTTTCAGGCGGT	NA	NA	NA	NA
>prophage 9
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	3609316	3695066	5381963	portal,plate,capsid,protease,tRNA,integrase,head,terminase,lysis,tail	Salmonella_phage(50.98%)	87	3664842:3664860	3695141:3695159
WP_002898139.1|3609316_3610609_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3610699_3612043_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3612051_3612663_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3612785_3617039_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3617174_3617669_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3617952_3618084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3618201_3619170_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3619284_3621051_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3621051_3622773_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3622799_3623519_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3623872_3624091_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3624211_3626491_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3626521_3626839_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3627164_3627386_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3627462_3629403_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3629399_3630515_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3630661_3632320_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3632739_3633435_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3633550_3634450_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3634593_3636246_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3636256_3637225_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3637436_3637871_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3638022_3639741_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3639779_3640781_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3640791_3642234_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3642321_3643335_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3643331_3644162_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3644193_3645333_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3646210_3646726_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3646952_3647681_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3647701_3648433_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3648439_3649156_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3649155_3649824_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3650007_3650739_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3650781_3652254_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3652250_3652967_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3653045_3654173_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3654214_3654703_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3654760_3655606_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3655602_3656556_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3656566_3657700_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3657863_3658976_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3659324_3659804_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3659892_3660795_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3661616_3661904_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3662106_3662370_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3662376_3662760_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3663026_3664712_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3664703_3664826_-	hypothetical protein	NA	NA	NA	NA	NA
3664842:3664860	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3664931_3665150_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3665241_3666342_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3666338_3666824_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3666820_3669214_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3669440_3669560_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3669574_3669874_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3669926_3670442_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3670451_3671624_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3671762_3672839_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3672868_3673030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3673068_3673800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3673803_3676755_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3676756_3677356_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3677348_3678257_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3678243_3678606_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3678602_3679175_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3679289_3679454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3679452_3679962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3679958_3680405_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3680397_3680829_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3680791_3680938_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3680924_3681353_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3681349_3681733_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3681737_3682247_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3682227_3682443_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3682446_3682650_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3682649_3683114_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3683209_3683860_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3683863_3684922_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3684938_3685772_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3685914_3687681_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3687680_3688706_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3688767_3690510_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3690785_3691463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3691577_3691811_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3691821_3692010_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004178082.1|3692110_3693598_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3694085_3695066_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3695141:3695159	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	4273893	4285547	5381963	integrase	Enterobacteria_phage(70.0%)	15	4273745:4273758	4277958:4277971
4273745:4273758	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4273893_4274997_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4275007_4276261_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4276613_4277804_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4277791_4278742_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4277958:4277971	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4278741_4279167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4279513_4279663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4279735_4280302_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4280319_4280565_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4280561_4281299_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4281598_4281736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4281840_4282107_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4282109_4282661_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4282657_4282885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4282881_4283202_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4283213_4285547_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 11
NZ_CP040033	Klebsiella pneumoniae strain KPC160117 chromosome, complete genome	5381963	4753738	4759563	5381963		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4753738_4756072_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4756086_4756407_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4756403_4756631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4756627_4757170_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4757172_4757439_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4757999_4758737_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4758733_4758979_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4758996_4759563_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP040034	Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence	176345	29818	53569	176345	transposase,integrase	Enterobacteria_phage(33.33%)	23	29754:29813	53575:54397
29754:29813	attL	ACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|29818_30523_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|30797_31811_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|31955_32453_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|32609_32855_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|32860_33652_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|33815_34163_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259026.1|34156_35128_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_000214125.1|35344_36559_+	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
WP_001747812.1|36586_36769_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000163574.1|36765_37392_-	tetracycline resistance transcriptional repressor TetR(G)	NA	NA	NA	NA	NA
WP_001257840.1|37495_38671_+	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
WP_001253717.1|38691_39483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012372820.1|39574_41107_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014342205.1|41333_41711_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_014342204.1|41746_42295_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_012372818.1|42375_43131_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_165539487.1|43300_44161_-	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	99.7	3.9e-160
WP_001235713.1|44343_44901_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|45064_48070_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_000743213.1|48562_48787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052259184.1|48783_49521_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000813355.1|49734_51006_-|transposase	IS4-like element ISPa13 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|52864_53569_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
53575:54397	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTG	NA	NA	NA	NA
>prophage 2
NZ_CP040034	Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence	176345	126302	160896	176345	transposase,integrase	Salmonella_phage(61.54%)	38	121948:121968	170691:170711
121948:121968	attL	ACTTTCACATGTGAAAGTTTG	NA	NA	NA	NA
WP_096043117.1|126302_127450_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	7.8e-148
WP_001187970.1|127600_130054_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000050848.1|130255_130459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|130530_131136_+	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000184110.1|131128_131398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|131411_131630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000064431.1|131703_132261_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_000595210.1|132335_133187_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001032042.1|133391_133538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077335.1|133644_134031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|134208_135936_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|135922_136201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|136273_136513_+	permease	NA	NA	NA	NA	NA
WP_000338626.1|136522_136639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868821.1|136759_137134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|137247_137973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342218.1|137947_138151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342219.1|138213_142368_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.7e-23
WP_000787563.1|142364_142637_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000750746.1|142641_142884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|142931_143231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|143397_143850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|143865_144468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|144729_145011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|145309_145846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|145848_146859_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|146863_147733_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139717.1|147729_148221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342220.1|148266_148398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342221.1|148547_149462_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_013362812.1|151820_152789_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_085281207.1|152732_153170_+|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	4.5e-40
WP_014342101.1|153317_153440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|153419_154295_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_013362812.1|154329_155298_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001323888.1|157209_157377_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|157365_157926_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|157929_160896_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
170691:170711	attR	CAAACTTTCACATGTGAAAGT	NA	NA	NA	NA
>prophage 1
NZ_CP040035	Klebsiella pneumoniae strain KPC160117 plasmid pQnr-L117, complete sequence	148625	1727	62949	148625	integrase,transposase	uncultured_Caudovirales_phage(26.32%)	60	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|4916_5885_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_020444838.1|7417_8872_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9854_11132_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11194_13192_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14231_15439_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16867_17299_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17549_19025_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19017_19698_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19887_21273_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21301_21655_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21768_23061_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23071_26218_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26304_26745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26871_29319_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29359_29557_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29590_30328_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30616_31066_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31299_33117_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33116_34013_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34052_34433_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34437_35367_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35421_36102_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36098_37499_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37715_38150_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38381_38561_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40303_40813_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40862_41360_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41691_42018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|42014_42728_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42736_43282_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43357_43720_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45616_46153_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46185_46611_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46623_47913_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47960_49712_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49729_50092_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50141_50492_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50849_51119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51106_51682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51712_52207_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52250_52619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52652_52856_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52904_53162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53237_53492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53667_53934_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53921_54404_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|54604_56008_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|56036_56669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|58186_58744_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|58737_59109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|59105_59606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|59602_59929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|60183_60540_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_108714626.1|60529_60922_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|60927_61632_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001247892.1|61755_62046_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|62244_62949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
