The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	135701	179560	10444916	integrase,transposase,tRNA	Stx2-converting_phage(12.5%)	50	153160:153178	177696:177714
WP_166341169.1|135701_136775_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_166341171.1|136871_137909_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_166353116.1|139006_139753_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166353117.1|139888_141043_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_018273742.1|141764_142121_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035681142.1|142171_143722_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|143769_144369_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_166341173.1|144455_145604_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	50.1	3.8e-94
WP_085404705.1|145604_145823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085404706.1|146047_147025_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	52.1	7.2e-78
WP_028152108.1|147028_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085404707.1|147310_148063_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	26.5	8.4e-10
WP_166341175.1|148074_148917_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166341177.1|148913_149657_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166341179.1|149755_150568_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166341181.1|150644_151814_-	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_166341183.1|151938_152898_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166341185.1|152953_154381_-	peptidase	NA	NA	NA	NA	NA
153160:153178	attL	GGAGCTTGTTGAGGTAGCC	NA	NA	NA	NA
WP_166341187.1|154586_155462_-	DMT family transporter	NA	NA	NA	NA	NA
WP_071913733.1|155603_156002_+	RidA family protein	NA	NA	NA	NA	NA
WP_071913735.1|156061_156607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014495138.1|156551_156896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085404716.1|157104_157692_-|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	36.0	3.7e-29
WP_166341189.1|157883_158168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341191.1|158503_158737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063983186.1|158742_159045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341193.1|159460_161506_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_166341195.1|161798_162023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341197.1|162279_162999_+	porin family protein	NA	NA	NA	NA	NA
WP_166341199.1|163189_164275_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_028152127.1|164372_164765_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_166353119.1|164902_165145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084514.1|165216_166281_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_028152129.1|166458_166701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341201.1|167378_167549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341203.1|167766_168135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166096634.1|168222_168393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341205.1|168664_169333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341207.1|169719_169944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071913753.1|170295_170583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063983199.1|170771_171044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353121.1|171558_172688_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_018272321.1|173033_174377_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_071917443.1|174816_175053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155795197.1|175043_175205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341209.1|175223_175391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341211.1|175641_176913_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	26.5	6.2e-21
WP_166341213.1|177020_177488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341215.1|177620_177836_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
177696:177714	attR	GGCTACCTCAACAAGCTCC	NA	NA	NA	NA
WP_166341218.1|178018_179560_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
>prophage 2
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	296646	312298	10444916	transposase	Shigella_phage(60.0%)	14	NA	NA
WP_166353134.1|296646_297775_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_166341375.1|298628_299693_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080583977.1|300576_300876_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_157789084.1|301491_301878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341377.1|302595_302835_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_166341379.1|302925_303234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341381.1|303969_304176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341383.1|304364_305471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109866565.1|305709_306839_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_028154091.1|306987_307170_-	hypothetical protein	NA	A0A1X9SH55	Bradyrhizobium_phage	60.0	1.2e-10
WP_109866565.1|307660_308789_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_041483034.1|309987_310266_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011090953.1|310262_310619_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060909066.1|310672_312298_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
>prophage 3
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	363617	388440	10444916	integrase,protease,transposase,portal,terminase,capsid	Mycobacterium_phage(14.29%)	35	366146:366161	385863:385878
WP_038952271.1|363617_364886_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_166341434.1|365775_365994_-	hypothetical protein	NA	NA	NA	NA	NA
366146:366161	attL	CGTCGCGGCCGCGCGC	NA	NA	NA	NA
WP_166353138.1|366309_366909_-|integrase	site-specific integrase	integrase	A0A142F2H8	Mycobacterium_phage	28.6	1.3e-05
WP_085967575.1|367057_368187_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166341436.1|368241_368823_-	hypothetical protein	NA	A0A076G7B8	Sinorhizobium_phage	29.6	6.1e-16
WP_166341438.1|368882_369179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155258159.1|369272_369530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341440.1|369801_370302_+	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_028153794.1|370298_370577_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166341442.1|370575_370917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038945118.1|370974_371340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341444.1|371339_371513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028153791.1|371509_371767_+	DUF2312 domain-containing protein	NA	A0A2L0V115	Agrobacterium_phage	62.2	1.9e-17
WP_166341446.1|371766_372258_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_166341448.1|372254_374315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341450.1|374311_374719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028153787.1|374715_375027_+	hypothetical protein	NA	A0A191VYP5	Roseobacter_phage	45.8	2.1e-07
WP_049807985.1|375023_375293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341452.1|375282_375615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341454.1|375676_376909_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157790397.1|376905_377589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049807983.1|377768_378080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341456.1|378126_378828_-	response regulator transcription factor	NA	Q56AR1	Bacillus_thuringiensis_phage	32.4	1.9e-08
WP_166341458.1|379168_379369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341460.1|379420_379915_+	hypothetical protein	NA	I3ULZ5	Rhodobacter_phage	41.3	4.4e-23
WP_166341462.1|379911_381642_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	39.0	5.1e-111
WP_166341464.1|381645_382959_+|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	40.4	2.9e-82
WP_166341466.1|382955_383807_+|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	54.4	1.1e-69
WP_049813169.1|383849_385190_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	43.7	5.2e-79
WP_157789229.1|385219_385429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166353140.1|385616_386201_+	hypothetical protein	NA	M4QNT5	Tetraselmis_viridis_virus	55.3	1.2e-24
385863:385878	attR	GCGCGCGGCCGCGACG	NA	NA	NA	NA
WP_166341468.1|386194_386806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341470.1|386805_387129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341472.1|387130_387529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341474.1|387525_388440_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	45.0	1.1e-56
>prophage 4
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	557595	597860	10444916	holin,protease,transposase	Shigella_phage(20.0%)	42	NA	NA
WP_109866565.1|557595_558725_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_166341707.1|559119_559842_+	cytochrome c	NA	NA	NA	NA	NA
WP_166353156.1|559880_560234_-	cytochrome c	NA	NA	NA	NA	NA
WP_166341709.1|560499_560952_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_166341711.1|561224_561386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341713.1|561607_563896_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.7	8.4e-61
WP_166341715.1|563914_564226_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_166341717.1|564222_567297_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.7	7.1e-79
WP_166341719.1|567297_568434_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011084514.1|569564_570629_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166341721.1|570638_570851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341723.1|570868_571555_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_166341725.1|571691_572138_+	host attachment protein	NA	NA	NA	NA	NA
WP_166341727.1|572286_573108_+	universal stress protein	NA	NA	NA	NA	NA
WP_166341729.1|573190_573661_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_166341731.1|573694_574807_+	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_166341733.1|574836_576432_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_166353157.1|576428_577346_-	ribose-phosphate diphosphokinase	NA	NA	NA	NA	NA
WP_166341735.1|577345_578878_-	thymidine phosphorylase family protein	NA	NA	NA	NA	NA
WP_166341737.1|579375_579807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341739.1|579892_580780_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_166341741.1|580873_581203_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166341743.1|581803_582583_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_166353158.1|582805_583795_-	Tat pathway signal protein	NA	NA	NA	NA	NA
WP_157789200.1|584096_584255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341745.1|584275_584491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341747.1|584905_585460_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_166341749.1|585523_585703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353159.1|585726_586425_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_166341751.1|587193_587379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038937292.1|588124_588454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041483034.1|589666_589945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011090953.1|589941_590298_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060909066.1|590351_591977_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_166341753.1|592876_593719_+	ribonuclease HII	NA	NA	NA	NA	NA
WP_166341755.1|593766_593970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014494399.1|594292_595126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071911042.1|595261_595720_+	low affinity iron permease family protein	NA	A0A1C9EHA1	Mycobacterium_phage	43.4	5.3e-07
WP_014494401.1|595719_596241_+	DUF1003 domain-containing protein	NA	NA	NA	NA	NA
WP_028170171.1|596398_596638_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_166341757.1|596703_597447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014494404.1|597443_597860_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	608558	651095	10444916	protease,transposase	Bradyrhizobium_phage(20.0%)	41	NA	NA
WP_085971921.1|608558_609318_+|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_166341761.1|609513_609981_-	DNA ligase	NA	A0A1X9SH33	Bradyrhizobium_phage	60.1	5.9e-46
WP_166341763.1|610892_613256_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_166341765.1|613559_613961_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_018272321.1|614354_615698_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_014494388.1|617408_617618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341767.1|617869_619039_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_084795104.1|619338_619581_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	51.4	5.8e-13
WP_063982871.1|619757_619982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341769.1|619988_620270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038936050.1|620335_620839_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071911104.1|621078_621717_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_063982874.1|621786_622353_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_166353161.1|622345_623398_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_166341771.1|623575_623980_-	VOC family protein	NA	NA	NA	NA	NA
WP_166341773.1|625275_625839_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_071911114.1|625835_626183_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_166353162.1|626185_626656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038937344.1|626676_627192_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_038937343.1|627279_627474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341775.1|627913_628069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341777.1|628513_631273_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	24.0	1.8e-17
WP_166341779.1|631386_631977_-	DNA ligase	NA	A0A1X9SH33	Bradyrhizobium_phage	64.7	2.6e-67
WP_011084514.1|632665_633730_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166341781.1|633749_634052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|634064_635129_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166341783.1|635764_636007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341785.1|636136_636334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341787.1|636460_636655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341789.1|637257_637488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341791.1|637497_637767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341793.1|637763_638228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341795.1|638862_639210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341797.1|641890_642139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341799.1|642131_642371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166341801.1|644353_644737_+	RidA family protein	NA	NA	NA	NA	NA
WP_166341803.1|644778_645300_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	40.0	6.9e-19
WP_166341805.1|645575_645794_-	cation transporter	NA	W0UWC9	Spodoptera_exigua_multiple_nucleopolyhedrovirus	37.9	5.2e-05
WP_085967575.1|645899_647028_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166341807.1|647249_648872_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	52.2	9.9e-149
WP_166353163.1|649250_651095_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5ESM9	Bathycoccus_sp._RCC1105_virus	43.1	4.1e-98
>prophage 6
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	795928	806122	10444916	tRNA	uncultured_Mediterranean_phage(88.89%)	12	NA	NA
WP_166341931.1|795928_797311_-	LysM peptidoglycan-binding domain-containing M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	40.9	2.4e-18
WP_049808103.1|797420_798038_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	2.8e-27
WP_166341932.1|798308_798680_+	response regulator	NA	NA	NA	NA	NA
WP_085404650.1|798683_799451_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	38.4	9.8e-38
WP_166341933.1|799556_799919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063983114.1|800116_801448_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.8	8.5e-98
WP_166341934.1|801641_802454_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	48.4	1.4e-55
WP_166341935.1|802450_802996_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_028156107.1|803082_803319_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	63.6	5.5e-08
WP_063983111.1|803486_804236_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	49.7	1.2e-43
WP_063983110.1|804257_805097_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	37.5	1.5e-31
WP_063983109.1|805093_806122_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.7	5.3e-23
>prophage 7
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	1094013	1110953	10444916	integrase,head,protease,transposase	Acidithiobacillus_phage(40.0%)	15	1091202:1091217	1100085:1100100
1091202:1091217	attL	AGGCCGATGCGATCTT	NA	NA	NA	NA
WP_166342053.1|1094013_1095276_+|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	26.7	2.5e-06
WP_166342054.1|1095651_1096995_-|transposase	IS1380-like element ISBdi2 family transposase	transposase	NA	NA	NA	NA
WP_166342055.1|1097116_1097365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342056.1|1097537_1097720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342057.1|1098007_1098217_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011090937.1|1099447_1100209_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
1100085:1100100	attR	AGGCCGATGCGATCTT	NA	NA	NA	NA
WP_166341218.1|1100227_1101769_-|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_166342058.1|1101953_1102388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273740.1|1103214_1103814_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_035681142.1|1103861_1105412_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273742.1|1105462_1105819_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166353185.1|1107563_1108692_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.1	2.8e-17
WP_166342059.1|1109704_1109977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342060.1|1109976_1110306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342061.1|1110446_1110953_-|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
>prophage 9
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	1532179	1590699	10444916	integrase,transposase	Stx2-converting_phage(28.57%)	59	1548800:1548816	1569267:1569283
WP_166342317.1|1532179_1533244_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342318.1|1533769_1534012_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_026192128.1|1534282_1535347_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342319.1|1535557_1536898_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_166342320.1|1537027_1537435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342321.1|1537653_1538187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342322.1|1538183_1539434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342323.1|1539911_1542326_-	response regulator	NA	NA	NA	NA	NA
WP_166342324.1|1542643_1543357_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166342325.1|1543367_1543571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028149875.1|1543597_1543777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342326.1|1543974_1544355_+	YciI family protein	NA	NA	NA	NA	NA
WP_166342327.1|1544364_1544955_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_166342328.1|1545082_1547140_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	29.7	1.7e-68
WP_166342329.1|1547202_1548450_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_071912729.1|1548462_1548966_-	GAF domain-containing protein	NA	NA	NA	NA	NA
1548800:1548816	attL	TCGCCGCTGTCGCCGTC	NA	NA	NA	NA
WP_166342330.1|1548962_1550321_-	MFS transporter	NA	NA	NA	NA	NA
WP_166342331.1|1550435_1551359_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166342332.1|1552948_1553779_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_166342333.1|1553904_1554441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342334.1|1554497_1554983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342335.1|1555290_1555764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342336.1|1555889_1556594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342337.1|1556703_1557105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192391.1|1557295_1557694_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011090953.1|1557690_1558047_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041482620.1|1558100_1559726_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_166342338.1|1560335_1561082_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_166342339.1|1561018_1561600_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	32.5	1.0e-10
WP_166342340.1|1561706_1561973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342341.1|1562281_1562599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342342.1|1562595_1563294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342343.1|1563825_1564446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342344.1|1565012_1565285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342345.1|1565356_1567237_+	hypothetical protein	NA	A0A2D2W1V2	Sinorhizobium_phage	36.4	9.1e-45
WP_109866565.1|1567340_1568470_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_166342346.1|1568658_1569261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273740.1|1569898_1570498_-	UPF0149 family protein	NA	NA	NA	NA	NA
1569267:1569283	attR	GACGGCGACAGCGGCGA	NA	NA	NA	NA
WP_035681142.1|1570545_1572096_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273742.1|1572146_1572503_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166342347.1|1573197_1574541_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166342348.1|1574667_1575102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342349.1|1575597_1575915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342054.1|1576041_1577385_-|transposase	IS1380-like element ISBdi2 family transposase	transposase	NA	NA	NA	NA
WP_166342350.1|1577551_1578022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342351.1|1578143_1579487_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166342352.1|1579899_1580334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342353.1|1580320_1580668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342354.1|1580658_1581120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342355.1|1581178_1581343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342356.1|1581472_1582270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342351.1|1582923_1584267_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166342357.1|1584372_1585875_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	42.0	9.0e-104
WP_166342358.1|1585855_1586032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342359.1|1586120_1586399_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166342360.1|1587585_1587768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084514.1|1587787_1588852_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342361.1|1588891_1589230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018272321.1|1589355_1590699_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	1848678	1886879	10444916	transposase,tRNA	Synechococcus_phage(16.67%)	31	NA	NA
WP_166342351.1|1848678_1850022_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_028147494.1|1850219_1850699_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_166091178.1|1850774_1851746_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011084514.1|1853117_1854182_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342514.1|1854854_1855556_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_071912382.1|1855723_1856740_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_014494125.1|1856753_1856993_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_008135034.1|1857005_1857803_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	40.0	7.3e-44
WP_014494124.1|1858093_1858417_+	DUF1476 domain-containing protein	NA	NA	NA	NA	NA
WP_014494123.1|1858483_1858972_-	cyanase	NA	NA	NA	NA	NA
WP_166342515.1|1859061_1860630_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_166342516.1|1860778_1861528_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_166342517.1|1861524_1862502_+	NADPH:quinone oxidoreductase family protein	NA	NA	NA	NA	NA
WP_166342518.1|1862535_1863285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084514.1|1865020_1866085_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342519.1|1866094_1867303_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_166342520.1|1867443_1868643_-	TrmJ/YjtD family RNA methyltransferase	NA	NA	NA	NA	NA
WP_166342521.1|1868991_1870203_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_166342522.1|1870300_1870843_+	DUF3455 domain-containing protein	NA	NA	NA	NA	NA
WP_166342523.1|1870847_1872074_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_166342524.1|1872080_1874759_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.3	3.0e-73
WP_166342525.1|1875226_1876375_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_166342526.1|1876385_1876754_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_166353249.1|1876934_1879802_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.6	5.8e-261
WP_166342527.1|1879954_1880950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014494106.1|1881043_1882132_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.3	7.2e-119
WP_060909066.1|1882776_1884402_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_011090953.1|1884455_1884812_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041483034.1|1884808_1885087_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166342528.1|1885412_1885577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353121.1|1885749_1886879_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
>prophage 11
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	2221703	2329381	10444916	integrase,protease,transposase,tail,head,portal,terminase,plate,capsid	Acidithiobacillus_phage(11.54%)	107	2311845:2311860	2335680:2335695
WP_011084514.1|2221703_2222768_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342815.1|2223106_2224672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342817.1|2224804_2225500_+	WbqC family protein	NA	NA	NA	NA	NA
WP_166342819.1|2226100_2227078_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	31.0	1.8e-28
WP_166342821.1|2227074_2227722_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166342823.1|2227718_2228870_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166342825.1|2228866_2229697_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_166342827.1|2229702_2230623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342830.1|2230631_2231300_-	acetyltransferase	NA	NA	NA	NA	NA
WP_166342833.1|2231478_2234430_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_166353287.1|2234670_2234958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342836.1|2235088_2236282_+	CoA transferase	NA	NA	NA	NA	NA
WP_166342839.1|2238603_2240418_+	chloride channel protein	NA	NA	NA	NA	NA
WP_011084514.1|2240840_2241905_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166342841.1|2242020_2243019_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	38.0	4.6e-56
WP_166342843.1|2243028_2243712_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166342845.1|2244116_2244299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342847.1|2244535_2245507_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_166342849.1|2245503_2246505_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166342851.1|2246970_2247240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342853.1|2247332_2248847_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_166342855.1|2248856_2249399_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_166342857.1|2250993_2251608_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_166342859.1|2251972_2254432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342861.1|2254781_2256842_-	modulator protein	NA	NA	NA	NA	NA
WP_166342863.1|2257824_2258403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342865.1|2258399_2258741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342867.1|2259913_2260711_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_166342869.1|2260735_2261935_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_166342871.1|2262050_2263334_-	MFS transporter	NA	NA	NA	NA	NA
WP_166342873.1|2263386_2264640_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_166342875.1|2264722_2265460_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166342877.1|2265564_2268540_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_166342879.1|2268532_2268961_+	heme-binding protein	NA	NA	NA	NA	NA
WP_028181654.1|2270467_2271007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342881.1|2271061_2271331_-	hypothetical protein	NA	I6NSG0	Burkholderia_phage	51.9	3.0e-18
WP_166342883.1|2271707_2272694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155251958.1|2273034_2273337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028180258.1|2273337_2274717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035718192.1|2274716_2274968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342885.1|2275098_2275659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342887.1|2275773_2276112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028180262.1|2276108_2276402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028180263.1|2276310_2276811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342889.1|2276807_2277716_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6G1	Thiobacimonas_phage	38.2	3.5e-34
WP_166353199.1|2277785_2278835_-	hypothetical protein	NA	R4JDM6	Burkholderia_phage	31.1	3.6e-35
WP_166342891.1|2278852_2279059_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_166342171.1|2279058_2279445_-|tail	phage tail protein	tail	A0A088FQM4	Escherichia_phage	50.8	3.1e-32
WP_166342894.1|2282508_2283012_-|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	45.2	1.1e-37
WP_166342897.1|2283024_2284434_-|tail	phage tail sheath protein	tail	A0A1W6JT53	Escherichia_phage	48.6	4.6e-118
WP_166342900.1|2284515_2285010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342903.1|2285000_2285618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342905.1|2285617_2286520_-	hypothetical protein	NA	A0A1X9SGY6	Bradyrhizobium_phage	40.4	9.4e-32
WP_166342907.1|2286526_2289742_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	36.5	1.2e-185
WP_166342909.1|2289742_2290441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038944511.1|2290424_2291276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342911.1|2291275_2292133_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	31.5	5.6e-18
WP_166342913.1|2292132_2292546_-|plate	phage baseplate protein	plate	K4I3Z7	Acidithiobacillus_phage	37.3	4.5e-13
WP_028181382.1|2292602_2293451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342915.1|2293453_2293981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342917.1|2293982_2294336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342919.1|2294335_2294779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342921.1|2294780_2295839_-|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	37.3	1.8e-50
WP_166342923.1|2295877_2296240_-|head	head decoration protein	head	NA	NA	NA	NA
WP_166342925.1|2296251_2297553_-	S49 family peptidase	NA	A0A219Y8X7	Aeromonas_phage	43.6	2.0e-43
WP_166353289.1|2297549_2299133_-|portal	phage portal protein	portal	G8DH43	Emiliania_huxleyi_virus	39.8	1.7e-89
WP_028181390.1|2299156_2299363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342927.1|2299415_2299676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166342929.1|2299703_2301650_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	44.6	1.8e-136
WP_166342931.1|2301652_2301835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342933.1|2301821_2302406_-|terminase	terminase small subunit	terminase	A0A2D1GMW4	Marinobacter_phage	32.9	2.8e-08
WP_166342935.1|2302408_2302990_-	deoxynucleotide monophosphate kinase	NA	A0A1W6DX10	Sphingobium_phage	44.9	2.2e-29
WP_166342937.1|2303576_2306447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342939.1|2306564_2307206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342941.1|2307205_2307583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342943.1|2307710_2308601_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_166342945.1|2309266_2310133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342947.1|2310631_2311018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342949.1|2311029_2311305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342951.1|2311365_2311806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028153906.1|2311809_2312070_+	hypothetical protein	NA	NA	NA	NA	NA
2311845:2311860	attL	CCAGGCGTTCGTTGAC	NA	NA	NA	NA
WP_060910679.1|2312066_2312324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038945744.1|2312310_2312562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038945745.1|2312561_2312768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028153910.1|2312778_2313126_+	HNH endonuclease	NA	A0A291AUJ4	Sinorhizobium_phage	54.3	5.8e-30
WP_038945746.1|2313138_2313549_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_129557523.1|2313685_2314096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060910677.1|2314212_2314464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342954.1|2314836_2315046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342956.1|2315062_2317570_-	bifunctional DNA primase/polymerase	NA	A0A0S0N1T8	Pseudomonas_phage	25.1	1.4e-24
WP_166342959.1|2317582_2317933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035675166.1|2317919_2318186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342962.1|2318197_2320147_-	DEAD/DEAH box helicase	NA	A0A2H4GY70	Pseudomonas_phage	39.6	2.5e-106
WP_166353291.1|2320146_2320746_-	DNA methyltransferase	NA	A0A1B1IT99	uncultured_Mediterranean_phage	42.4	4.2e-28
WP_166342964.1|2320778_2321036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166342967.1|2321041_2322154_-	hypothetical protein	NA	B4UTX3	Rhizobium_phage	44.5	1.4e-72
WP_166342969.1|2322255_2322831_-	DUF669 domain-containing protein	NA	A0A0R6PEL5	Moraxella_phage	31.0	1.7e-10
WP_166342971.1|2322873_2323656_-	ATP-binding protein	NA	B4UTW5	Rhizobium_phage	41.6	8.7e-50
WP_166342973.1|2323668_2323956_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166342975.1|2324273_2325008_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_028153235.1|2325111_2325513_+	hypothetical protein	NA	A0A0K8IXN3	Cronobacter_phage	61.8	1.5e-26
WP_166342977.1|2325574_2325871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342979.1|2325867_2327022_+	DNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_166353293.1|2327056_2327506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028182129.1|2327492_2327699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342981.1|2327853_2328000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166342983.1|2328196_2329381_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2335680:2335695	attR	CCAGGCGTTCGTTGAC	NA	NA	NA	NA
>prophage 12
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	3044912	3097301	10444916	holin,integrase,transposase	Trichoplusia_ni_ascovirus(10.0%)	60	3047543:3047559	3093327:3093343
WP_018272321.1|3044912_3046256_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166343826.1|3046937_3047492_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
3047543:3047559	attL	AGTGGTGGGTTACGCTG	NA	NA	NA	NA
WP_166343828.1|3047596_3048325_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_166343831.1|3048515_3048953_-	VOC family protein	NA	NA	NA	NA	NA
WP_166343833.1|3049120_3049771_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_166343835.1|3049962_3050355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343837.1|3050366_3051059_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_166343839.1|3051169_3051604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085405153.1|3052062_3052446_+	RidA family protein	NA	NA	NA	NA	NA
WP_063981484.1|3052643_3052907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343841.1|3053148_3053400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343843.1|3053504_3053990_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_166343845.1|3054101_3054869_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	2.1e-16
WP_071910270.1|3055074_3055323_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_166343847.1|3055436_3055940_+	collagen-like protein	NA	NA	NA	NA	NA
WP_028152311.1|3055936_3056176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166343849.1|3056271_3056538_-	DUF2277 domain-containing protein	NA	NA	NA	NA	NA
WP_071910266.1|3056780_3057842_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_071910264.1|3057860_3058202_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_028152315.1|3058367_3058721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085405162.1|3058726_3058969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166343851.1|3059014_3060439_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	41.7	3.5e-33
WP_166343853.1|3060609_3061212_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014492874.1|3061384_3061873_-	bacterioferritin	NA	NA	NA	NA	NA
WP_063981474.1|3062004_3062277_-	bacterioferritin	NA	NA	NA	NA	NA
WP_063981473.1|3062870_3063197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071910256.1|3063408_3063690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343855.1|3063789_3065016_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_166102215.1|3065023_3066673_-	energy-dependent translational throttle protein EttA	NA	A0A2I4R674	Erysipelothrix_phage	29.4	6.1e-45
WP_028152324.1|3066909_3067125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166102219.1|3067270_3068233_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.6	1.8e-20
WP_166343857.1|3068289_3069486_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_166343859.1|3069852_3070635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343861.1|3070637_3071489_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_166343863.1|3071685_3072132_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_166353271.1|3072170_3073196_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.4	3.6e-11
WP_166343865.1|3073527_3074703_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_166343867.1|3074826_3075072_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_063981465.1|3075164_3076007_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_166343869.1|3076073_3078245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166343871.1|3079063_3079375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343873.1|3079554_3080517_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166343875.1|3080513_3081314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343877.1|3081365_3081638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343879.1|3081658_3081940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343881.1|3082089_3082659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343883.1|3082658_3082982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343885.1|3083016_3083280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343887.1|3083509_3084691_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	43.5	9.7e-69
WP_109866565.1|3085448_3086578_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_166343889.1|3087852_3088515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343891.1|3088566_3089298_+	TIGR02391 family protein	NA	C7BGE5	Burkholderia_phage	42.0	1.1e-41
WP_166343893.1|3089530_3089935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166343895.1|3089963_3090527_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_166343897.1|3090609_3092055_-|integrase	site-specific integrase	integrase	A0A1X9SGU9	Bradyrhizobium_phage	32.0	2.9e-43
WP_166343899.1|3092842_3093322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166343901.1|3093406_3093712_-	hypothetical protein	NA	NA	NA	NA	NA
3093327:3093343	attR	CAGCGTAACCCACCACT	NA	NA	NA	NA
WP_166343903.1|3093823_3095470_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.4	6.7e-52
WP_166343905.1|3095489_3096083_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026192128.1|3096236_3097301_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	3921187	3994313	10444916	transposase	Shigella_phage(28.57%)	53	NA	NA
WP_011084514.1|3921187_3922252_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166344833.1|3922481_3924143_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.8	1.4e-20
WP_166344835.1|3924225_3924726_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_166344838.1|3924679_3925186_-	GFA family protein	NA	NA	NA	NA	NA
WP_166344840.1|3925412_3926540_-	alkene reductase	NA	NA	NA	NA	NA
WP_166344843.1|3926659_3928156_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_166344846.1|3928339_3929185_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014491844.1|3929344_3929551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028147928.1|3929624_3930038_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_166344849.1|3930059_3931172_-	amidohydrolase	NA	NA	NA	NA	NA
WP_166344852.1|3931243_3932305_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014491840.1|3932566_3932842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071909451.1|3932882_3933578_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_166344854.1|3933681_3934290_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166344856.1|3934404_3935859_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_166344858.1|3935866_3936616_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	7.3e-22
WP_166344860.1|3936720_3937398_-	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_166344862.1|3938461_3940084_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166344865.1|3940059_3941421_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_166344867.1|3943286_3944507_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_028144087.1|3944503_3945367_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020607990.1|3945858_3946053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166344869.1|3947201_3948977_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.6	1.3e-24
WP_166344871.1|3948973_3949834_-	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_166344873.1|3949826_3950996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166344875.1|3951589_3952303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344877.1|3952307_3954167_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_166344879.1|3954120_3955233_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	36.0	2.3e-24
WP_166344881.1|3955232_3956060_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_166344884.1|3956052_3956823_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_018645268.1|3956819_3957761_-	ribokinase	NA	NA	NA	NA	NA
WP_166344887.1|3957757_3958618_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_166344890.1|3958630_3959593_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_018645270.1|3959662_3960973_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161966258.1|3961406_3961625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344893.1|3963544_3964357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344896.1|3964299_3965544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344899.1|3965936_3966341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344902.1|3966341_3966683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157790378.1|3968304_3969060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344905.1|3968983_3970207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166353402.1|3971172_3972627_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011084685.1|3975063_3975825_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011084684.1|3976949_3977564_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_028182271.1|3978970_3980308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082755540.1|3980990_3981407_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_166353404.1|3982140_3983270_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.1	9.7e-18
WP_018273862.1|3983540_3984890_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109866544.1|3984964_3985725_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_026192128.1|3985960_3987025_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011084678.1|3987227_3989036_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011084675.1|3991192_3991768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353406.1|3993183_3994313_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	9.4e-21
>prophage 14
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	4002044	4072725	10444916	transposase	Stx2-converting_phage(25.0%)	52	NA	NA
WP_041482620.1|4002044_4003670_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_011084662.1|4004688_4004982_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_166344911.1|4005124_4006135_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	66.2	2.5e-126
WP_035680466.1|4006465_4008709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084659.1|4009135_4010377_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011084658.1|4010927_4011809_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_166353408.1|4011993_4013379_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_014497924.1|4014868_4015777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084653.1|4016239_4016674_-	VirK protein	NA	NA	NA	NA	NA
WP_011084514.1|4016934_4017999_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166344914.1|4018146_4019490_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_035678039.1|4020027_4021095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084649.1|4023108_4023798_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_018647881.1|4023824_4025279_+	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_166344917.1|4025289_4025952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084646.1|4026147_4028463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344920.1|4028755_4030138_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	32.0	1.4e-13
WP_018273742.1|4030662_4031019_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035681142.1|4031069_4032620_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|4032667_4033267_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_014497929.1|4034840_4035551_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.6	4.8e-63
WP_011084638.1|4039033_4039240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084637.1|4040075_4040477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166344923.1|4042132_4043164_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_026192128.1|4044943_4046008_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166344926.1|4046116_4046876_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	6.1e-08
WP_011084630.1|4046886_4047924_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011084629.1|4047920_4048742_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_011084628.1|4048752_4049028_-	translocation protein	NA	NA	NA	NA	NA
WP_011084627.1|4049030_4049696_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_011084626.1|4049688_4050810_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_011084625.1|4050806_4051343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084624.1|4051318_4052674_-	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_011084623.1|4052670_4053291_-	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_011084622.1|4053287_4053926_-	nodulation protein	NA	NA	NA	NA	NA
WP_166344929.1|4053937_4054801_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_166353410.1|4054809_4055289_-	nodulation protein NolB	NA	NA	NA	NA	NA
WP_035668374.1|4055564_4056185_+	nodulation protein NolW	NA	NA	NA	NA	NA
WP_161966260.1|4056741_4056918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084616.1|4057334_4057538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039156390.1|4058108_4059173_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080677780.1|4060482_4061043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344932.1|4061140_4061449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014497948.1|4061491_4061683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084612.1|4061799_4062693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084611.1|4062726_4063263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084610.1|4063265_4063694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084609.1|4063703_4065803_+	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_011084608.1|4065833_4066424_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011084606.1|4066990_4067413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080586761.1|4068527_4069874_+	insulinase family protein	NA	A0A2P1EIE5	Megavirus	22.2	1.4e-18
WP_166353121.1|4071596_4072725_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
>prophage 15
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	4119030	4167226	10444916	transposase	Acidithiobacillus_phage(40.0%)	28	NA	NA
WP_109866565.1|4119030_4120160_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_011084541.1|4121007_4121349_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_011084538.1|4122532_4123084_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_011084536.1|4123961_4124252_-	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_011084514.1|4125157_4126222_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166344949.1|4128501_4129593_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_011084529.1|4131957_4133274_+	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_011084514.1|4133396_4134461_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011084496.1|4134966_4135257_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_011084497.1|4135253_4135568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014498007.1|4136503_4136692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035668747.1|4137017_4138397_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_166344952.1|4139121_4139625_-	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_014498004.1|4139621_4139963_-	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_166344955.1|4142159_4142891_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.9e-62
WP_035680720.1|4146540_4146798_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_014497999.1|4147367_4147589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084509.1|4148110_4148455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011090953.1|4149000_4149357_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166344958.1|4149410_4150958_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.2	1.4e-83
WP_035666406.1|4152202_4152403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084514.1|4152445_4153510_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011084515.1|4153557_4155354_-	recombinase family protein	NA	NA	NA	NA	NA
WP_166344961.1|4155773_4158026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166344964.1|4158298_4162840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084521.1|4163297_4163876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014497929.1|4163906_4164617_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.6	4.8e-63
WP_038968105.1|4165957_4167226_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.2	5.5e-94
>prophage 16
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	4172723	4318312	10444916	transposase	Paenibacillus_phage(19.05%)	93	NA	NA
WP_011084514.1|4172723_4173788_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_018273862.1|4173837_4175187_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_085964990.1|4175261_4176022_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	1.0e-07
WP_011084494.1|4176187_4176850_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166344970.1|4176846_4177362_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_166344973.1|4178020_4179883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080586833.1|4182526_4182736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028144459.1|4183291_4183792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014498022.1|4186382_4187147_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014498023.1|4187143_4188418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014498024.1|4188414_4189296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028160578.1|4189276_4191157_-	ATPase	NA	NA	NA	NA	NA
WP_166341218.1|4193136_4194678_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_166344976.1|4195493_4195691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014498028.1|4195727_4196933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166344979.1|4196929_4200430_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166344982.1|4200426_4201068_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_166344985.1|4201057_4202473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166344988.1|4202686_4206022_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_166344991.1|4206018_4208673_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_166344994.1|4208947_4211185_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_166344997.1|4211153_4212488_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_166345000.1|4212484_4214857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353416.1|4215021_4215237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166345003.1|4215431_4215971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345006.1|4215975_4216836_+	metallophosphoesterase	NA	A0A126HHR4	Vibrio_phage	32.1	1.2e-12
WP_166345009.1|4216919_4217516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345012.1|4217512_4218274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345015.1|4218276_4218543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345018.1|4218952_4219678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345021.1|4219686_4222167_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_166345024.1|4222163_4222577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345027.1|4222579_4223194_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_166345030.1|4223256_4224495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014498031.1|4225149_4225596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166353418.1|4225997_4226750_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166345033.1|4227630_4227873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035668701.1|4227932_4228133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353263.1|4229500_4230802_-	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.0	8.9e-07
WP_049808069.1|4231358_4232681_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.8e-31
WP_166345036.1|4233104_4233377_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_018273734.1|4233578_4234598_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011084471.1|4235041_4235848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014498036.1|4237284_4237584_+	hypothetical protein	NA	A0A291AUP1	Sinorhizobium_phage	34.7	4.1e-08
WP_011084467.1|4238212_4238416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273742.1|4238971_4239328_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035681142.1|4239378_4240929_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|4240976_4241576_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_028154393.1|4242298_4243825_-	DUF1521 domain-containing protein	NA	NA	NA	NA	NA
WP_038951335.1|4244724_4246074_+|transposase	IS701-like element ISBj6 family transposase	transposase	NA	NA	NA	NA
WP_085971921.1|4246123_4246884_-|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_011084447.1|4246960_4248787_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	40.0	1.2e-105
WP_014498053.1|4250119_4251205_+	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	64.7	3.7e-131
WP_011084445.1|4251176_4252184_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	3.7e-85
WP_028153850.1|4252458_4255575_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_018272321.1|4258169_4259513_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166345039.1|4259663_4260074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353121.1|4261232_4262361_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166345042.1|4265303_4265489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084436.1|4265731_4265968_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_166353263.1|4268305_4269607_-	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.0	8.9e-07
WP_049808069.1|4270163_4271486_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.8e-31
WP_028153782.1|4272359_4272542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028153781.1|4272837_4274565_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	4.0e-15
WP_166345045.1|4274561_4275443_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166345048.1|4275439_4276402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_028153779.1|4276398_4278087_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166345051.1|4278118_4279486_-	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_028153778.1|4282165_4282657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080586945.1|4286017_4286167_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_018273862.1|4286373_4287723_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_166345054.1|4288082_4289039_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_166345057.1|4289226_4290519_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_085971921.1|4290568_4291329_-|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_166345060.1|4292368_4293433_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_028150881.1|4294179_4294359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028150883.1|4295209_4295467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345063.1|4295998_4296232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131233107.1|4296725_4296929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162136486.1|4298834_4299047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345066.1|4300577_4302281_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	23.4	4.7e-16
WP_166345069.1|4302411_4303326_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_063981038.1|4303478_4304531_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	2.1e-06
WP_166345072.1|4304527_4305058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063981036.1|4305054_4305672_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_028157463.1|4305668_4306196_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_166345075.1|4306418_4307165_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_166345078.1|4307379_4309128_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.1	7.5e-09
WP_166345081.1|4309236_4310661_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.0	2.0e-07
WP_071916645.1|4311591_4312062_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_166345083.1|4312070_4314239_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_166345086.1|4314235_4315579_+	cytochrome c	NA	NA	NA	NA	NA
WP_085971921.1|4317552_4318312_+|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
>prophage 17
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	4801780	4952297	10444916	integrase,protease,transposase	Bacillus_virus(13.04%)	120	4807068:4807127	4925438:4925452
WP_166345869.1|4801780_4802473_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_085402676.1|4802472_4803462_-	2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	26.4	1.5e-14
WP_166345872.1|4803461_4804280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_063980698.1|4804276_4805092_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.0e-24
WP_166345875.1|4805102_4806125_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166345878.1|4806264_4807071_+	creatininase family protein	NA	NA	NA	NA	NA
4807068:4807127	attL	CTAGTACCCGGAATCAGAGCTGAGTGATACGGCGGCCTTTGAAACGGCGTTGACGGACCT	NA	NA	NA	NA
WP_026192128.1|4807080_4808145_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
4807068:4807127	attL	CTAGTACCCGGAATCAGAGCTGAGTGATACGGCGGCCTTTGAAACGGCGTTGACGGACCT	NA	NA	NA	NA
WP_063980696.1|4808330_4808594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345881.1|4808990_4810958_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_166345884.1|4810986_4812720_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_166345887.1|4812733_4814047_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	4.0e-31
WP_166353460.1|4814157_4815453_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_028159962.1|4815526_4815766_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_166353461.1|4815867_4817493_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_166345889.1|4817695_4818571_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_014490313.1|4818953_4819727_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_166345891.1|4820101_4820899_+	RimK-like protein	NA	NA	NA	NA	NA
WP_071916215.1|4821004_4821937_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	30.5	1.8e-25
WP_063980690.1|4822216_4823137_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063980689.1|4823149_4824445_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_166345893.1|4824655_4825657_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_166345895.1|4825893_4826676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028148322.1|4826803_4827019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345897.1|4827206_4828346_+	monooxygenase	NA	NA	NA	NA	NA
WP_166345899.1|4828342_4829956_+	benzoate-CoA ligase family protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.4	2.9e-39
WP_166345901.1|4830095_4830608_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166345903.1|4830597_4831230_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_166345905.1|4831376_4832417_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_085398808.1|4832531_4833350_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166345907.1|4833342_4834116_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.6e-30
WP_166345909.1|4834291_4835296_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166345911.1|4835341_4836709_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_166345913.1|4836819_4837704_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166345915.1|4839802_4840792_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166353463.1|4841018_4841240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345917.1|4841251_4842055_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_166353464.1|4842214_4843189_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_166345919.1|4843192_4843870_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_166345921.1|4843998_4845144_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_166345923.1|4845150_4846125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166345925.1|4846283_4847108_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085398819.1|4847206_4848817_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063980668.1|4848853_4849993_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_166345927.1|4850363_4850852_+	BA14K family protein	NA	NA	NA	NA	NA
WP_166345930.1|4852100_4853156_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_166345933.1|4853883_4854327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345936.1|4854400_4856440_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_166345939.1|4856475_4856721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166345942.1|4856947_4857805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345945.1|4859943_4861197_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_166345948.1|4861974_4862727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166345951.1|4862794_4863469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166345954.1|4864481_4866728_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_166345957.1|4867924_4868716_-|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_166345960.1|4870651_4871452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166345963.1|4871711_4872572_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166345966.1|4872558_4873080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166345969.1|4873076_4873685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353466.1|4874040_4874286_-	helix-turn-helix transcriptional regulator	NA	K7PH71	Enterobacterial_phage	45.3	4.5e-05
WP_026192128.1|4875118_4876183_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166345972.1|4876206_4876554_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_166345975.1|4876732_4877365_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	30.4	1.2e-09
4876137:4877261	attR	AGGTCCGTCAACGCCGTTTCAAAGGCCGCCGTATCACTCAGCTCTGATTCCGGGTACTAGGACGAGGCTAATGCCGCGACTGACTGACACGTCGCTCCGCGCCCTTCCGGTCCCCGCGAAGGGGCAGCGCACCTACTTTGACGAGGTAGTCCCGAACTTCGGCTGCCGTGTATCCCAGGGCGGCACGAGGAGCTTTATCGTCCAGCTCGGAGCGGATCGCAGGCTTATCACTATCGGCCGATACCCACCCATTTCGCTCGCCAAGGCGCGGGAGGAAGCAAGGCGTCTCATGGCGGAGCGCACGCTCGGACGTTTCCGCCCGCAATCTGTTCCCTGGGAAGAGGCGCGAGAACTGTTTCTCGCACGGTGCACGCAGAAGAATAGCCGAGGACGGTCAAGGATTACCGCCGCCTGCTGAAGCGGCATTTTCCGTTTGGCCGCAAGAAGGTCTCCGAGAACACGCCGCAGGATATCAATCATCGGATTGATCGCCTCCGTGGCACGGTCTCCGAGCAGAACCACGCCCCCGTGGCAATCAAGATTTTCTTCGCGCGGGCGCAGCGCCGCCAGTATGTGCAGCATTCGCCGTGCGAAGGATGCAGATAGTCAAACGACAGTCCCGCACACGCATCCTCTCGCCTGAGGAGCTCGCTGCCGTATATGCGGCTGCGTCCGAGGTGGGGTATCCGTTTGGCACCATCGTGCAGCTCTGCATACTCACCGGCCAGCGTCGCGGTGAGATCGTGCAGCTTCGCCGCAGCTACCTATCAGATACTGTTACGCTTCCGCCTTCGATCACGAAGAACAATCGCACGCATACGTTCCCGATTGGAAACATGGCGCGGAGCATCATCGAGAATATTCGAGGCGAGGATGACTTGCTGTTTATCGGGACGCACGGAAGAGGCATCTTCAGCAATTGGTCGAAGGAAAAGACCGCACTCGATCTCCTGCTATCGAAAAGTGGTCTCGAAGTGCAGCCGTGGACGCTTCATGATCTGCGGCGCACCTTCGCCTCTGGCCTAGCAATGCTCGGCGTCCGGCTCGAGGTTGTCGAGAAAATGCTCAACCACGTCTCGGGGAGCTTCGCCGGCGTCGCCGGCATCTACCAGCGCCACACGTATC	NA	NA	NA	NA
WP_166345978.1|4877905_4878373_+	hypothetical protein	NA	NA	NA	NA	NA
4876137:4877261	attR	AGGTCCGTCAACGCCGTTTCAAAGGCCGCCGTATCACTCAGCTCTGATTCCGGGTACTAGGACGAGGCTAATGCCGCGACTGACTGACACGTCGCTCCGCGCCCTTCCGGTCCCCGCGAAGGGGCAGCGCACCTACTTTGACGAGGTAGTCCCGAACTTCGGCTGCCGTGTATCCCAGGGCGGCACGAGGAGCTTTATCGTCCAGCTCGGAGCGGATCGCAGGCTTATCACTATCGGCCGATACCCACCCATTTCGCTCGCCAAGGCGCGGGAGGAAGCAAGGCGTCTCATGGCGGAGCGCACGCTCGGACGTTTCCGCCCGCAATCTGTTCCCTGGGAAGAGGCGCGAGAACTGTTTCTCGCACGGTGCACGCAGAAGAATAGCCGAGGACGGTCAAGGATTACCGCCGCCTGCTGAAGCGGCATTTTCCGTTTGGCCGCAAGAAGGTCTCCGAGAACACGCCGCAGGATATCAATCATCGGATTGATCGCCTCCGTGGCACGGTCTCCGAGCAGAACCACGCCCCCGTGGCAATCAAGATTTTCTTCGCGCGGGCGCAGCGCCGCCAGTATGTGCAGCATTCGCCGTGCGAAGGATGCAGATAGTCAAACGACAGTCCCGCACACGCATCCTCTCGCCTGAGGAGCTCGCTGCCGTATATGCGGCTGCGTCCGAGGTGGGGTATCCGTTTGGCACCATCGTGCAGCTCTGCATACTCACCGGCCAGCGTCGCGGTGAGATCGTGCAGCTTCGCCGCAGCTACCTATCAGATACTGTTACGCTTCCGCCTTCGATCACGAAGAACAATCGCACGCATACGTTCCCGATTGGAAACATGGCGCGGAGCATCATCGAGAATATTCGAGGCGAGGATGACTTGCTGTTTATCGGGACGCACGGAAGAGGCATCTTCAGCAATTGGTCGAAGGAAAAGACCGCACTCGATCTCCTGCTATCGAAAAGTGGTCTCGAAGTGCAGCCGTGGACGCTTCATGATCTGCGGCGCACCTTCGCCTCTGGCCTAGCAATGCTCGGCGTCCGGCTCGAGGTTGTCGAGAAAATGCTCAACCACGTCTCGGGGAGCTTCGCCGGCGTCGCCGGCATCTACCAGCGCCACACGTATC	NA	NA	NA	NA
WP_166345981.1|4878356_4878917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345984.1|4879675_4880212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166340964.1|4880208_4880649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166353468.1|4880759_4881242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166345987.1|4881258_4882608_+	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_166345990.1|4882634_4883840_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	30.3	4.2e-27
WP_166345992.1|4883860_4884985_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_166345995.1|4885005_4885236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100214066.1|4886083_4887841_-|transposase	IS21-like element IS1631 family transposase	transposase	NA	NA	NA	NA
WP_166353469.1|4888440_4889742_-	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.0	8.9e-07
WP_166353263.1|4890384_4891686_-	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.0	8.9e-07
WP_166345998.1|4892241_4893564_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	8.1e-32
WP_166346001.1|4894251_4898124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166346004.1|4898174_4899206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166346007.1|4900520_4901192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346010.1|4901252_4901924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346013.1|4902159_4902669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346016.1|4902665_4903025_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166346019.1|4903576_4903987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166346022.1|4904324_4905596_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_085967151.1|4905631_4906761_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	7.2e-21
WP_166346025.1|4906960_4907908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166346028.1|4908253_4909636_-	hypothetical protein	NA	A0A1P8DJJ9	Virus_Rctr41k	29.7	5.9e-17
WP_166346031.1|4909878_4911609_-	recombinase family protein	NA	A0A2K9V2Y5	Faecalibacterium_phage	23.2	4.9e-13
WP_166346034.1|4911677_4911878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346037.1|4912358_4913384_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161536477.1|4913582_4914608_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166346040.1|4916007_4916430_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166346043.1|4916556_4917570_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	24.0	1.9e-12
WP_166346046.1|4917566_4917848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346049.1|4917907_4918480_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_166353471.1|4918479_4919718_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_166346052.1|4921434_4922298_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.8	1.0e-30
WP_166345998.1|4922786_4924109_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	8.1e-32
WP_166346055.1|4924316_4924754_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166353121.1|4925527_4926656_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166346060.1|4927734_4928337_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_166346063.1|4928463_4929732_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.4	1.6e-90
WP_166346066.1|4930169_4930559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166346069.1|4930574_4932845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346071.1|4932837_4933674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346074.1|4933880_4935818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346077.1|4936003_4936969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346080.1|4937110_4939699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346083.1|4939894_4940368_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_166346086.1|4940374_4941007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166346089.1|4941112_4942195_+	pyrophosphatase	NA	NA	NA	NA	NA
WP_166346092.1|4942191_4942875_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_166346095.1|4943491_4943965_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	60.5	2.1e-06
WP_166346098.1|4943945_4944362_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.9	5.0e-12
WP_166346101.1|4944970_4946131_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166353473.1|4947711_4948041_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166346104.1|4948693_4949458_+	porin family protein	NA	NA	NA	NA	NA
WP_166340966.1|4949521_4949917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166346107.1|4949969_4950344_+	hypothetical protein	NA	A0A2H4JDW3	uncultured_Caudovirales_phage	54.0	1.3e-14
WP_166346109.1|4950986_4951145_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_166346112.1|4951157_4952297_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	6484832	6510308	10444916	integrase,transposase	Acidithiobacillus_phage(22.22%)	24	6483683:6483697	6510676:6510690
6483683:6483697	attL	CGCGCGCCTGCGCCA	NA	NA	NA	NA
WP_166348574.1|6484832_6485870_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S7FYW5	Listeria_phage	26.1	9.2e-07
WP_085971921.1|6486214_6486975_-|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_018273742.1|6487504_6487861_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035681142.1|6487911_6489462_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|6489509_6490109_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_166348577.1|6490269_6490842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166348580.1|6490980_6492000_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_166348583.1|6491989_6494101_+	hypothetical protein	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	25.3	1.9e-30
WP_166348586.1|6494476_6494905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166348589.1|6495072_6495939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166348592.1|6496427_6497861_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.4	2.1e-65
WP_166348595.1|6497921_6498215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353581.1|6498329_6498575_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166348598.1|6498582_6498912_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_166348601.1|6498998_6499508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166348604.1|6499629_6500577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166348607.1|6500772_6501015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166348610.1|6501397_6502051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166348613.1|6503002_6503878_-	OmpA family protein	NA	NA	NA	NA	NA
WP_166348616.1|6504214_6504361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011090937.1|6504883_6505645_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166348619.1|6505663_6507205_-|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	4.6e-127
WP_166348622.1|6508245_6509547_+	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	23.0	8.3e-05
WP_166353583.1|6509714_6510308_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	38.4	5.1e-34
6510676:6510690	attR	TGGCGCAGGCGCGCG	NA	NA	NA	NA
>prophage 19
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	6564054	6571172	10444916		Salmonella_phage(16.67%)	6	NA	NA
WP_166348731.1|6564054_6564519_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.3	6.5e-45
WP_007597501.1|6564699_6565185_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.9	9.9e-20
WP_166348734.1|6565281_6565836_-	DUF924 domain-containing protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	28.8	1.3e-12
WP_166348737.1|6565852_6567538_-	long-chain fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	26.0	3.8e-42
WP_166348740.1|6567729_6569199_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.4	6.0e-28
WP_166348744.1|6569375_6571172_-	glucan ABC transporter ATP-binding protein/ permease	NA	W8CYL7	Bacillus_phage	24.3	2.1e-30
>prophage 20
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	6800686	6844556	10444916	holin,transposase	Acidithiobacillus_phage(44.44%)	26	NA	NA
WP_060913155.1|6800686_6802228_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_011090937.1|6802246_6803008_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166349122.1|6803084_6803543_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_166349125.1|6803693_6804596_-	ABC transporter ATP-binding protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	28.6	7.3e-08
WP_166353603.1|6804596_6805610_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	3.4e-14
WP_166349128.1|6805666_6807214_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166349131.1|6807462_6808962_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_166349134.1|6808981_6809782_+	phosphonate metabolism transcriptional regulator PhnF	NA	NA	NA	NA	NA
WP_166353605.1|6810033_6810825_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_028143493.1|6812450_6812663_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166353607.1|6813512_6813737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349137.1|6814654_6814876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349140.1|6815121_6815352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028143491.1|6816045_6816351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349143.1|6816350_6816734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349146.1|6816730_6818071_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_166349148.1|6818063_6819545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162603493.1|6819541_6820066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028143486.1|6825353_6827477_+	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	31.1	9.0e-41
WP_131233137.1|6828224_6828425_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	49.1	1.1e-09
WP_166353609.1|6829589_6830612_-	MFS transporter	NA	NA	NA	NA	NA
WP_166349151.1|6832103_6833660_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011090937.1|6833871_6834633_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166349154.1|6834651_6836193_-|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	7.8e-127
WP_166349157.1|6837551_6838312_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	1.0e-07
WP_026192128.1|6843491_6844556_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	6856645	7021270	10444916	protease,transposase	Paenibacillus_phage(17.65%)	105	NA	NA
WP_166349163.1|6856645_6857710_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011084715.1|6857727_6858564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349166.1|6858984_6859744_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	2.1e-08
WP_026192128.1|6859767_6860832_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166349169.1|6862047_6864501_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_014497849.1|6864518_6864710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049808069.1|6865204_6866527_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.1	1.8e-31
WP_166353263.1|6867083_6868385_+	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.0	8.9e-07
WP_166353263.1|6869027_6870329_+	group II intron reverse transcriptase/maturase	NA	H7BVN0	unidentified_phage	29.0	8.9e-07
WP_166349172.1|6871227_6872019_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_162130978.1|6872996_6873167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154694111.1|6873283_6873424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085967575.1|6874483_6875612_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166349175.1|6876479_6876920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349178.1|6877793_6880274_+	porin family protein	NA	NA	NA	NA	NA
WP_156149859.1|6880308_6880449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349181.1|6884707_6885634_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_166349184.1|6885964_6887032_-	DNA primase	NA	NA	NA	NA	NA
WP_166349187.1|6891628_6892042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349190.1|6892144_6894283_-	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	30.2	1.4e-28
WP_011084732.1|6894456_6895653_-	hypothetical protein	NA	A0A1V0DX75	Synechococcus_virus	43.7	2.6e-77
WP_131234255.1|6895898_6896126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349193.1|6899718_6900438_+	DCL family protein	NA	NA	NA	NA	NA
WP_026312796.1|6900651_6901272_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_166349196.1|6901261_6902182_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_166349199.1|6902259_6903564_+	fibronectin-binding protein (FBP)	NA	NA	NA	NA	NA
WP_166349202.1|6903571_6905680_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_110115977.1|6905688_6906921_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_085964990.1|6908504_6909264_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	1.0e-07
WP_018273862.1|6909339_6910689_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_018648597.1|6913594_6914026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349205.1|6914137_6914842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349208.1|6914964_6915783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273862.1|6915728_6917078_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_085964990.1|6917152_6917913_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	1.0e-07
WP_085967575.1|6918095_6919224_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166349211.1|6920188_6922507_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_011084772.1|6922712_6923012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166349214.1|6923092_6923248_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_018273742.1|6924376_6924733_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035681142.1|6924783_6926334_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|6926381_6926981_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_011084776.1|6928521_6928749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084777.1|6929062_6931042_-	RiPP maturation radical SAM protein 1	NA	NA	NA	NA	NA
WP_011084781.1|6933356_6933722_-	Nif11 family protein	NA	NA	NA	NA	NA
WP_011084785.1|6935181_6936501_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011084786.1|6936500_6936752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_028143997.1|6937196_6938753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084789.1|6938742_6939381_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_166349217.1|6942816_6943986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084792.1|6944473_6944791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349220.1|6945508_6947041_+	polygalacturonase	NA	NA	NA	NA	NA
WP_166349223.1|6947259_6948300_+	pectin esterase	NA	NA	NA	NA	NA
WP_026192128.1|6950062_6951127_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_018647405.1|6951610_6952555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041482620.1|6953882_6955508_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_011090953.1|6955561_6955918_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041483034.1|6955914_6956193_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080586886.1|6957421_6958057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084799.1|6958064_6958445_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038945536.1|6958576_6960247_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_162131007.1|6960690_6961047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084803.1|6961460_6961979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084804.1|6962387_6963725_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_011084514.1|6963976_6965041_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_108914088.1|6968460_6968586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014497822.1|6968933_6969659_-	porin family protein	NA	NA	NA	NA	NA
WP_011084811.1|6970481_6970727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014497821.1|6971690_6972053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071916446.1|6973531_6974158_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166349226.1|6974231_6974522_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166353611.1|6974946_6975624_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014497819.1|6975782_6975992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349229.1|6976318_6977662_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_011084818.1|6978214_6979207_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018646994.1|6979840_6980785_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011084822.1|6981578_6982211_+	NodA family N-acyltransferase	NA	NA	NA	NA	NA
WP_166349232.1|6982207_6982867_+	chitooligosaccharide deacetylase NodB	NA	NA	NA	NA	NA
WP_166349236.1|6982881_6984339_+	chitooligosaccharide synthase NodC	NA	NA	NA	NA	NA
WP_014497813.1|6984265_6984895_+	methyltransferase	NA	NA	NA	NA	NA
WP_014497812.1|6984908_6986618_+	nodulation protein NodU	NA	M1ICZ5	Pelagibacter_phage	29.3	1.2e-27
WP_011084827.1|6986619_6987540_+	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	5.5e-27
WP_011084828.1|6987543_6988332_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035667843.1|6988576_6988972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349239.1|6988968_6990615_+	nodulation protein	NA	A0A222YXH1	Synechococcus_phage	31.9	8.0e-45
WP_026312623.1|6990906_6991893_+	nodulation protein NodZ	NA	NA	NA	NA	NA
WP_011084514.1|6992213_6993278_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011084833.1|6993741_6994578_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_166349242.1|6994761_6996579_+	nif-specific transcriptional activator NifA	NA	NA	NA	NA	NA
WP_011084835.1|6997096_6997963_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_166349245.1|6999102_7000326_+	GFA family protein	NA	NA	NA	NA	NA
WP_014497804.1|7000310_7000988_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_166349248.1|7001532_7002000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349251.1|7002469_7003780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133415003.1|7004583_7004844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349253.1|7005716_7005950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014497800.1|7006141_7007155_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.5	5.0e-50
WP_011084846.1|7007584_7007884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018273742.1|7008714_7009071_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035681142.1|7009121_7010672_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|7010719_7011319_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_014497799.1|7011520_7011754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273734.1|7014802_7015822_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166349256.1|7019200_7019362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084854.1|7020373_7021270_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
>prophage 22
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	7042282	7122053	10444916	integrase,transposase	Shigella_phage(18.75%)	54	7059781:7059840	7100652:7102015
WP_035681142.1|7042282_7043833_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273740.1|7043880_7044480_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_076829490.1|7045422_7045608_+	hypothetical protein	NA	A0A1X9SH55	Bradyrhizobium_phage	63.8	2.1e-10
WP_166349262.1|7050378_7051437_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011084876.1|7051433_7052249_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_080584265.1|7055581_7057279_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
7059781:7059840	attL	AGAGCTGGCCCCGCAAATTCGGACAGTAGCTTGAGTGGATTTTCTGCCTGACAGCGGCGA	NA	NA	NA	NA
WP_109866565.1|7059868_7060997_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_014497760.1|7061268_7061472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028154427.1|7062878_7063265_+	ectoine synthase	NA	NA	NA	NA	NA
WP_014497754.1|7068893_7069577_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018648598.1|7070113_7070380_+	DUF3551 domain-containing protein	NA	NA	NA	NA	NA
WP_166353613.1|7070827_7071058_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014497752.1|7071482_7071857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084909.1|7071853_7072174_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_141379388.1|7073252_7073948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109866565.1|7075042_7076171_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_018272321.1|7077744_7079088_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166349265.1|7079676_7080234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349268.1|7080230_7081694_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_166349271.1|7081807_7082377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349274.1|7082422_7082971_+	cation transporter	NA	NA	NA	NA	NA
WP_041482620.1|7083252_7084878_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_011090953.1|7084931_7085288_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_026192391.1|7085284_7085683_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_166349277.1|7085759_7087313_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.6	3.9e-126
WP_011090937.1|7087331_7088093_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166349280.1|7088232_7088901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349283.1|7088965_7090273_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	34.2	1.4e-39
WP_166353615.1|7090293_7091133_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.8	1.9e-58
WP_166340969.1|7091127_7091355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349286.1|7091646_7092930_+|integrase	tyrosine-type recombinase/integrase	integrase	H6WRW7	Salmonella_phage	27.2	5.3e-20
WP_049808068.1|7093600_7094092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157790395.1|7094165_7094336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|7095433_7096498_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011090958.1|7096702_7096987_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_154694125.1|7097842_7098067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014498624.1|7098617_7098848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028182460.1|7099227_7099431_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	49.2	1.7e-10
WP_166349289.1|7099728_7099995_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_109866565.1|7100739_7101868_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_166349292.1|7104621_7104846_-	hypothetical protein	NA	NA	NA	NA	NA
7100652:7102015	attR	AGAGCTGGCCCCGCAAATTCGGACAGTAGCTTGAGTGGATTTTCTGCCTGACAGCGGCGAGGATTCTTGCTGCGAATCAGGAGCGAAGATGACGAAGAAGAGCCGCCGGACGCATTCTCCGGCATTCAAGGCGAAGGTTGCTTTGGCTGCGGTCAAAGGAGACAAGACACTGGCGGAGCTGGCGCAACTGTTTGATGTTCATCCGAACCAGATCACGATCTGGAAAAACCAGCTCCTGGAAGGCGCCGCCGGCGTGTTTGGGCATGACAAGACATCGGCCGAGACGCCGGTCGATTTGAAGGCGTTGCATGCCAAGATCGGCGAGCTGGCGTTGGAAAACGATTTTTTGTCCGGCGCGCTCACCAAGGCGGGCCTGCTGAGCGCAAAGCGATGATCGACCGCGGTCATGATCTTTCTATCGTGCGCCAGGCGAAGGTCCTGAAGCTGGCTCGCAGCACGGTCTACTATGAACCTCGGCCAGTTTCGGCCGAGGACCTTGCCTTGATGCGTCGGCTCGATGAGCTGCATCTCGATTATCCCTTCGCGGGAGCGCGTATGCTGCGATCGTTGCTGCGGCGGGAGGGGGTATACGCCGGTCGCCGCCACATCGCGACGCTGATGAAGCGCATGGGGATCGAGGCGGTCTATCGTCGCCCGAACACGAGCAAGCCGGCTCCGGGTCACAAGATCTACCCGTACCTGTTGCGCGGATTGAAGATCGAGCGGCCCGACCATGCGTGGGCAATGGACATCACCTACATTCCGATGCGGCGTGGCTTCGTCTATCTCGCGGCGGTCGTCGATGTGTTCAGCCGACGGGTCCTGGCCCATCGCGTCTCGATCACAATGGAGGCGGCCTTCTGCGTCGAAGCGGTCCAGGAGGCGTTGGCGAAGCACGGCAGGCCCGCGATTTTCAACACGGACCAGGGCAGCCAGTTCACCAGCCTCGAGTTCACCGATGTGCTGCTGGACGCGAAGATCGCCATCAGCATGGACGGCAAGGGCGCCTGGCGCGACAACGTGTTTGTCGAGCGGCTCTGGCGCACGGTCAAATACGAAGAAGTTTATCTCCGCGCCTACGACAGCGTGTCCGAGGCGCGAGCGTCAATTGCCAAGTATCTGGCCTTCTACAATCAGGGACGCCCTCACTCGAGCCTTGACGGGCGCACGCCCGACGAGGCTTACTTCGGCACGCAAGCTATGGTGATGGCCGCATGACCGTCGCCGACGATTTTGTCGTCGCTCTGGTCGGGCTACGCCCTCCCGACGCAACGACAAAATCGTAAAGCCCCGCGTTCAGCATAACCCGGCAGGAATCCACTTAAATCCAGCGGGGCGCTGTCCAAACAACCGGGGCCAGCTCT	NA	NA	NA	NA
WP_085967392.1|7106706_7107466_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	4.7e-08
WP_026192128.1|7107606_7108671_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166349295.1|7108750_7109841_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	1.3e-48
WP_018273859.1|7111225_7112269_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166349298.1|7113252_7113456_-	hypothetical protein	NA	A0A0S2SY70	Pseudomonas_phage	64.2	2.8e-16
WP_166349301.1|7115096_7116317_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166353617.1|7116316_7117132_-	virulence-associated protein E	NA	NA	NA	NA	NA
WP_166349304.1|7117256_7117520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166340971.1|7117567_7118026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349307.1|7118791_7119079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349309.1|7119078_7119393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349312.1|7119389_7119653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014497719.1|7120847_7122053_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	34.8	1.1e-48
>prophage 23
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	7129774	7182081	10444916	transposase	Shigella_phage(18.18%)	44	NA	NA
WP_011084514.1|7129774_7130839_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_028153675.1|7132164_7133067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026312707.1|7133063_7134614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028144010.1|7134756_7135755_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_018647447.1|7135909_7137253_-	cytochrome P450	NA	S4VQU1	Pandoravirus	34.1	1.2e-11
WP_166349321.1|7137252_7138098_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.7	8.3e-14
WP_018647445.1|7138102_7138393_-	ferredoxin	NA	NA	NA	NA	NA
WP_018647444.1|7138394_7139684_-	cytochrome P450	NA	NA	NA	NA	NA
WP_166349324.1|7139767_7140973_-	cytochrome P450	NA	NA	NA	NA	NA
WP_026192128.1|7141675_7142740_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_026192128.1|7142795_7143860_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038945511.1|7144929_7145214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084919.1|7146076_7146994_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_011084918.1|7147903_7148686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035715530.1|7148682_7149282_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_166353121.1|7149719_7150848_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166349326.1|7151143_7151662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084914.1|7152918_7153125_+	cold-shock protein	NA	NA	NA	NA	NA
WP_011090937.1|7153528_7154290_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166349154.1|7154308_7155850_-|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	7.8e-127
WP_166349329.1|7156438_7157905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349331.1|7157981_7158431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353173.1|7159519_7160649_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	7.2e-21
WP_166349334.1|7161596_7162184_+	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_166349337.1|7162204_7163149_-	AEC family transporter	NA	NA	NA	NA	NA
WP_085400415.1|7163521_7163857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028150667.1|7164288_7164966_+	ParA family protein	NA	A0A1B3B0Z9	Gordonia_phage	29.9	1.4e-11
WP_014492080.1|7165041_7165188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161495798.1|7165530_7165701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166349340.1|7165815_7166724_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_027534296.1|7167188_7168112_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063985507.1|7168117_7169083_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	41.8	4.6e-61
WP_166349343.1|7169348_7169828_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007596674.1|7169948_7170422_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_038942752.1|7170632_7174097_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_166349346.1|7174241_7175411_-	MFS transporter	NA	NA	NA	NA	NA
WP_028150674.1|7175523_7175895_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166349348.1|7176157_7176859_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166349351.1|7176974_7177499_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_166349353.1|7177622_7178150_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_063985501.1|7178305_7179496_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	7.0e-43
WP_166349356.1|7179642_7180371_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071909609.1|7180404_7180860_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	43.8	2.4e-20
WP_071916215.1|7181148_7182081_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	30.5	1.8e-25
>prophage 24
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	7877929	7994642	10444916	integrase,transposase	Shigella_phage(19.05%)	89	7932812:7932828	8005969:8005985
WP_166353185.1|7877929_7879058_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.1	2.8e-17
WP_166350330.1|7879886_7880447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350332.1|7881241_7881526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350334.1|7882570_7883857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350336.1|7884261_7884657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350338.1|7884659_7884863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273740.1|7885169_7885769_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_166350340.1|7885816_7887367_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273742.1|7887417_7887774_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166350342.1|7889473_7889773_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_166353686.1|7889773_7890316_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_166353688.1|7890475_7891714_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_166350344.1|7891710_7892586_+	SDR family oxidoreductase	NA	A0A2L2DJC0	Acanthamoeba_polyphaga_mimivirus	30.1	1.5e-29
WP_166350346.1|7892615_7893626_+	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	36.4	9.5e-41
WP_166350348.1|7893618_7894746_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	47.6	1.1e-98
WP_166350350.1|7894950_7896312_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	25.6	2.6e-09
WP_166350352.1|7896308_7897718_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_166350354.1|7897669_7898668_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_166350356.1|7898664_7899861_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_166350358.1|7899862_7900756_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.2e-08
WP_166350360.1|7900791_7902453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350362.1|7902592_7902853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350364.1|7903151_7904240_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_166350366.1|7904376_7905897_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_166350368.1|7906139_7906433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038952271.1|7907264_7908533_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_166350370.1|7909078_7909525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350372.1|7909749_7911138_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_166350374.1|7911106_7911808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350376.1|7911817_7912228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350378.1|7912791_7913328_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_166340975.1|7913210_7914605_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_166350380.1|7914601_7914949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018272321.1|7915355_7916699_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166350382.1|7916892_7919964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166341218.1|7920207_7921749_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_011090937.1|7921767_7922529_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_038952109.1|7922824_7923592_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	27.4	2.7e-19
WP_018273888.1|7924483_7926637_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	2.0e-43
WP_018273889.1|7926667_7927753_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
7932812:7932828	attL	AACACATCCGCGCCGCC	NA	NA	NA	NA
WP_060907863.1|7933790_7934099_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166353690.1|7934095_7934374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129557537.1|7934699_7934915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273892.1|7935010_7935163_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166353692.1|7936774_7937903_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166353693.1|7938001_7938205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350384.1|7939708_7940887_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	34.8	1.1e-48
WP_166350386.1|7941543_7942584_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_028154397.1|7944330_7944657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350388.1|7944859_7945084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350390.1|7945295_7945556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350392.1|7946430_7947909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350394.1|7948293_7948596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353695.1|7949014_7949239_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_166350396.1|7949689_7950295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350398.1|7950704_7951370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350400.1|7951366_7951576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350402.1|7951572_7952715_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	26.2	9.5e-21
WP_166350404.1|7952773_7953397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350406.1|7953412_7955467_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_166350408.1|7956901_7957081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350410.1|7957205_7957592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350411.1|7957600_7958257_-	recombinase family protein	NA	A0A0F7L6S1	uncultured_marine_virus	38.9	9.6e-26
WP_166350413.1|7958574_7959099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350415.1|7959297_7959624_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_166353173.1|7960161_7961290_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.3	7.2e-21
WP_166350417.1|7961881_7962907_-	methyltransferase	NA	NA	NA	NA	NA
WP_166350419.1|7963265_7964246_+	catalase family peroxidase	NA	NA	NA	NA	NA
WP_166350421.1|7964656_7965100_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_166350423.1|7966870_7968679_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	35.7	2.0e-73
WP_166350425.1|7969035_7969623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350427.1|7969710_7970925_+	PQQ-binding-like beta-propeller repeat protein	NA	S4VXT0	Pandoravirus	40.7	7.7e-05
WP_166350429.1|7970906_7971521_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_166353696.1|7971575_7972961_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_166350431.1|7976043_7976259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166340977.1|7976371_7976611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350433.1|7977027_7977291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350435.1|7977615_7977786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350437.1|7978053_7978518_-	Phasin protein	NA	NA	NA	NA	NA
WP_166350439.1|7978693_7979002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350441.1|7980267_7980516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129557324.1|7981085_7982214_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.3	7.2e-21
WP_166350443.1|7983038_7983269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350445.1|7983481_7984174_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_166353698.1|7984996_7985527_+	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_166350447.1|7987873_7988056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353700.1|7988321_7988678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350449.1|7989722_7992905_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_166353702.1|7993241_7994642_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9SGU9	Bradyrhizobium_phage	31.7	4.1e-42
8005969:8005985	attR	AACACATCCGCGCCGCC	NA	NA	NA	NA
>prophage 25
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	8382420	8410544	10444916	transposase	Stx2-converting_phage(25.0%)	30	NA	NA
WP_060909066.1|8382420_8384046_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_011090953.1|8384099_8384456_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041483034.1|8384452_8384731_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039152009.1|8385034_8385808_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_166340979.1|8385906_8386074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039152006.1|8386060_8387080_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	9.6e-25
WP_080703955.1|8387145_8388405_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166353730.1|8388451_8389372_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_063982691.1|8389368_8390178_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_039151999.1|8390177_8391017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039151997.1|8391018_8391396_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_166350906.1|8391607_8392927_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_063982694.1|8393013_8393964_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039151990.1|8393965_8394886_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039151988.1|8394895_8395657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166350907.1|8395653_8397189_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_039151984.1|8397190_8397991_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_080703954.1|8398029_8398935_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_051664704.1|8398931_8400386_+	xylulokinase	NA	NA	NA	NA	NA
WP_039151980.1|8400474_8401491_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	26.0	4.1e-15
WP_166350908.1|8401514_8401673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084514.1|8401659_8402724_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166350909.1|8402697_8403300_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_039157419.1|8403903_8405025_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_158332908.1|8405463_8405838_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039151977.1|8405772_8406609_+	nickel-transport family protein	NA	NA	NA	NA	NA
WP_166350910.1|8406761_8407190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085967575.1|8407276_8408405_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
WP_166350911.1|8408737_8409493_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_026192128.1|8409479_8410544_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	8585043	8592766	10444916	transposase	Acidithiobacillus_phage(33.33%)	8	NA	NA
WP_109866565.1|8585043_8586173_-|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	1.1e-18
WP_035681142.1|8586452_8588003_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_166353746.1|8588050_8588707_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_166351003.1|8588812_8590354_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.5	1.2e-127
WP_011090937.1|8590372_8591134_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166353748.1|8591731_8591929_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	49.2	1.3e-10
WP_166351005.1|8592036_8592207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166351007.1|8592583_8592766_-	hypothetical protein	NA	A0A1X9SH55	Bradyrhizobium_phage	61.7	1.2e-10
>prophage 27
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	8648291	8710020	10444916	transposase	Staphylococcus_phage(18.75%)	54	NA	NA
WP_026192128.1|8648291_8649356_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166351101.1|8650474_8650648_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_166351103.1|8650638_8650935_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166351105.1|8650922_8651372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166351107.1|8651716_8652826_+	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_166351109.1|8652822_8653278_+	response regulator	NA	NA	NA	NA	NA
WP_166351111.1|8653274_8655707_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_166350340.1|8657602_8659153_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273742.1|8659203_8659560_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166351114.1|8660179_8662144_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.5	1.4e-88
WP_166351116.1|8662203_8662785_+	adenylate kinase	NA	NA	NA	NA	NA
WP_166351118.1|8662962_8663442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071915789.1|8663777_8664026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166351120.1|8664230_8664497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166351122.1|8664715_8665558_-	metallophosphoesterase	NA	A0A067XQN2	Caulobacter_phage	35.7	1.8e-32
WP_166351124.1|8666411_8666603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166351126.1|8667466_8668039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060913155.1|8668167_8669709_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_011090937.1|8669727_8670489_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166351128.1|8670655_8672797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166351130.1|8672812_8673160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166351132.1|8673056_8673449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273742.1|8673807_8674164_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166350340.1|8674214_8675765_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_166351134.1|8676436_8677057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166351136.1|8677116_8678037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166351138.1|8678170_8680120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166351140.1|8680751_8681399_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166351142.1|8681395_8682034_-	arylsulfatase	NA	NA	NA	NA	NA
WP_063984716.1|8682193_8683207_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	40.5	1.5e-65
WP_166351144.1|8683219_8684569_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_166351146.1|8684572_8685445_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071915770.1|8685532_8686720_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_166351148.1|8686722_8687832_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166351150.1|8688262_8689681_-	amidase	NA	NA	NA	NA	NA
WP_166351152.1|8689797_8690574_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_166351154.1|8690733_8691807_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_166351156.1|8692008_8692650_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_028146878.1|8692817_8693891_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_166351158.1|8693902_8694814_-	3-phosphoglycerate dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	31.8	2.1e-23
WP_041955820.1|8694826_8696077_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_063984703.1|8696109_8697027_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.5	4.2e-11
WP_166351160.1|8697146_8697962_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_166351162.1|8698051_8699293_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063984700.1|8699459_8700338_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_063984699.1|8700337_8701321_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166351164.1|8701317_8702049_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.0e-11
WP_166351166.1|8702032_8702737_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	3.8e-12
WP_166351167.1|8702921_8703596_-	aldolase	NA	A0A077SK32	Escherichia_phage	48.3	1.7e-46
WP_014496893.1|8703701_8704619_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	49.8	1.1e-67
WP_166351169.1|8704634_8705417_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_166351171.1|8705413_8706691_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	41.0	6.5e-71
WP_166351173.1|8706861_8708553_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	2.8e-13
WP_086023025.1|8708891_8710020_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.7	2.0e-18
>prophage 28
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	9609490	9666933	10444916	tRNA,integrase,protease,transposase,plate	Prochlorococcus_phage(15.38%)	53	9639464:9639482	9672305:9672323
WP_085971921.1|9609490_9610251_-|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_166352102.1|9610905_9611226_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_166352104.1|9611654_9612095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352105.1|9612255_9612456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352107.1|9612586_9613351_-	porin family protein	NA	NA	NA	NA	NA
WP_166352109.1|9613901_9614129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352111.1|9614841_9616434_-	DUF4118 domain-containing protein	NA	W8CYF6	Bacillus_phage	25.0	1.6e-10
WP_166352113.1|9616880_9617456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352115.1|9617898_9619521_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_166352117.1|9619616_9620336_+	porin family protein	NA	NA	NA	NA	NA
WP_166353870.1|9625324_9626659_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_166352119.1|9626686_9626944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352121.1|9627746_9628610_+	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_166352123.1|9628715_9629681_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_166352125.1|9630103_9631099_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_166352127.1|9631151_9631820_-	porin family protein	NA	NA	NA	NA	NA
WP_085404882.1|9632186_9632726_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_166352129.1|9632754_9632958_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_166352131.1|9633002_9634598_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.4	1.3e-20
WP_071915184.1|9634735_9636013_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_166352133.1|9636035_9636908_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071915182.1|9637097_9637535_+	glyoxalase	NA	NA	NA	NA	NA
WP_166352135.1|9637643_9638786_+	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_014496209.1|9638979_9640071_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
9639464:9639482	attL	GCAAGGAGATCAAGACCGT	NA	NA	NA	NA
WP_166352137.1|9640595_9640943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166353872.1|9641047_9641509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063984030.1|9642688_9643546_-	hypothetical protein	NA	A0A2I2L3U5	Orpheovirus	44.8	1.0e-51
WP_063984029.1|9644011_9645775_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_071915177.1|9645906_9646860_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_028146749.1|9647021_9647696_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_166352139.1|9647697_9649098_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_166352141.1|9649395_9650727_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	30.7	7.4e-41
WP_035679974.1|9651029_9651452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049831746.1|9651823_9652309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352143.1|9652339_9653149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050995108.1|9653253_9653676_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	39.3	2.4e-14
WP_028154551.1|9653672_9654014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352145.1|9654010_9654325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352147.1|9654317_9654497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352148.1|9654821_9655583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|9655959_9657024_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_018273913.1|9657700_9658954_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	51.3	1.9e-102
WP_166352149.1|9658994_9659216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352151.1|9659851_9660031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352153.1|9660034_9660232_-	hypothetical protein	NA	A0A0K0KVS2	Prochlorococcus_phage	62.2	3.9e-07
WP_166352155.1|9660231_9662106_-	hypothetical protein	NA	L7Y6V2	Megavirus	34.4	7.2e-10
WP_166352157.1|9662102_9662447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352159.1|9662446_9662734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352161.1|9662726_9664076_-	hypothetical protein	NA	A0A068CE15	Rhizobium_phage	43.2	3.1e-10
WP_166352163.1|9664148_9664928_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_166352165.1|9664920_9665358_-	hypothetical protein	NA	M1PXE7	Prochlorococcus_phage	38.0	7.1e-09
WP_166352167.1|9665358_9666429_-|plate	baseplate J/gp47 family protein	plate	A0A068CC89	Rhizobium_phage	32.2	2.0e-36
WP_166352169.1|9666429_9666933_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	36.7	1.8e-08
9672305:9672323	attR	ACGGTCTTGATCTCCTTGC	NA	NA	NA	NA
>prophage 29
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	9672624	9682573	10444916	protease,tail,head,portal,terminase,capsid	Shigella_phage(20.0%)	11	NA	NA
WP_166352181.1|9672624_9672942_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_028152434.1|9672971_9673334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352183.1|9673415_9674939_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	45.2	4.7e-108
WP_166352185.1|9675122_9675827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352187.1|9675823_9676168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353874.1|9676192_9677212_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	37.6	4.7e-56
WP_166352188.1|9677324_9677693_-|head	head decoration protein	head	NA	NA	NA	NA
WP_166352190.1|9677718_9678735_-|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	42.5	2.5e-41
WP_166352192.1|9678745_9680335_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	50.3	9.2e-123
WP_166352194.1|9680338_9680563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352196.1|9680566_9682573_-|terminase	terminase	terminase	D6PFE7	uncultured_phage	27.6	3.5e-34
>prophage 30
NZ_CP049699	Bradyrhizobium sp. 4(2017) strain 323S2 chromosome, complete genome	10444916	10302672	10344260	10444916	integrase,terminase,transposase	Bradyrhizobium_phage(18.18%)	51	10327168:10327184	10352341:10352357
WP_166352931.1|10302672_10304016_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166352933.1|10304565_10305771_+	acyltransferase	NA	NA	NA	NA	NA
WP_166352935.1|10305936_10306422_+	hypothetical protein	NA	M4R207	Salicola_phage	39.6	7.6e-12
WP_038945789.1|10307684_10307909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352937.1|10307915_10308239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129557324.1|10308420_10309549_+|transposase	IS3-like element ISRj2 family transposase	transposase	U5P429	Shigella_phage	33.3	7.2e-21
WP_157790361.1|10309878_10310301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038945786.1|10310406_10310589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038976528.1|10310756_10310978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038945784.1|10310970_10311276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352939.1|10311279_10311441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352941.1|10311437_10311641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352943.1|10311637_10312102_+	DUF2493 domain-containing protein	NA	A0A1I9SEW9	Klebsiella_phage	49.1	1.3e-21
WP_166352945.1|10312011_10313328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155257990.1|10313302_10313521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352947.1|10313753_10313915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166352949.1|10313913_10315359_+|terminase	phage terminase large subunit	terminase	X2CY37	Brucella_phage	37.0	1.1e-16
WP_166352951.1|10315355_10315778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352953.1|10315755_10317441_+	hypothetical protein	NA	I6NV36	Burkholderia_virus	23.8	2.2e-10
WP_166352955.1|10317666_10318536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352957.1|10318572_10319760_+	DUF4043 family protein	NA	NA	NA	NA	NA
WP_166352959.1|10319832_10320258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028152241.1|10320326_10320590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352961.1|10320657_10321026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352963.1|10321025_10321367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352965.1|10321366_10322785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028152237.1|10322781_10323024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352967.1|10323025_10323838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352969.1|10323848_10325822_+	hypothetical protein	NA	A0A2H5BM72	Streptomyces_phage	41.3	1.1e-19
WP_166352971.1|10325824_10327381_+	hypothetical protein	NA	A0A1B1INQ3	uncultured_Mediterranean_phage	33.7	1.0e-54
10327168:10327184	attL	CGCGCTCGGCGATCTCG	NA	NA	NA	NA
WP_166352973.1|10327414_10328392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038953507.1|10328398_10328740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352975.1|10328736_10329930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352977.1|10329923_10330955_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_166352979.1|10330951_10331755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352981.1|10331770_10332673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352983.1|10332681_10332915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|10332946_10334011_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166353940.1|10334091_10334706_-	DNA ligase	NA	A0A1X9SH33	Bradyrhizobium_phage	58.0	7.5e-57
WP_166352985.1|10335759_10336017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352987.1|10336401_10337004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166352989.1|10337033_10337282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060909066.1|10337729_10339355_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	38.7	9.8e-88
WP_011090953.1|10339408_10339765_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_026192391.1|10339761_10340160_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_166352991.1|10340232_10340862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038943583.1|10340880_10341228_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038943582.1|10341227_10341491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085965769.1|10341487_10341766_-	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	52.7	4.6e-06
WP_166352993.1|10342125_10342524_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166352995.1|10342853_10344260_-|integrase	integrase family protein	integrase	A0A1X9SGU9	Bradyrhizobium_phage	28.9	5.2e-29
10352341:10352357	attR	CGCGCTCGGCGATCTCG	NA	NA	NA	NA
>prophage 1
NZ_CP049700	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2a, complete sequence	462705	28409	77530	462705	transposase,integrase	Mycobacterium_phage(60.0%)	40	28273:28305	31692:31724
28273:28305	attL	TTGGATTTATGTGCAGCACGCAGTGATGTGGAG	NA	NA	NA	NA
WP_026193374.1|28409_29627_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.5	6.8e-09
WP_166353992.1|29623_30601_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_028154610.1|30597_31623_+|integrase	tyrosine-type recombinase/integrase	integrase	B3GAN2	uncultured_virus	26.6	4.1e-07
WP_166354268.1|33921_34857_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	31.1	1.2e-18
31692:31724	attR	CTCCACATCACTGCGTGCTGCACATAAATCCAA	NA	NA	NA	NA
WP_166354270.1|34837_35967_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.6	3.1e-16
WP_166353993.1|36054_36789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353995.1|36841_37813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028153929.1|38033_38312_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166353997.1|38308_39586_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_166353999.1|39558_40287_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_166354001.1|40375_40564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354003.1|40676_41408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028153925.1|41413_42109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354005.1|42279_43239_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_166354007.1|43250_44507_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_166354009.1|44533_45106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354011.1|45840_46458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028154271.1|46635_48045_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_109866565.1|48397_49526_+|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	1.2e-15
WP_038952271.1|49793_51062_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_080587066.1|51249_51402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354013.1|51558_51753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354015.1|51749_54212_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_166344276.1|54535_55804_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.2	7.1e-94
WP_166354017.1|56009_56819_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_166354272.1|58312_59590_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.3	4.2e-102
WP_080650451.1|59616_60306_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_080650449.1|61181_61520_-|transposase	transposase	transposase	A0A2P1JR32	Mycobacterium_phage	33.0	8.2e-05
WP_018273657.1|62241_62397_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_080650447.1|62887_63379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273655.1|63430_64567_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_026193370.1|64563_64803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354019.1|65146_66490_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166354021.1|67018_68077_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_166354274.1|68417_69546_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	33.0	5.7e-18
WP_166354023.1|70291_71497_-	SCO family protein	NA	NA	NA	NA	NA
WP_166354025.1|71507_72359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354275.1|72394_73039_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_166354027.1|74734_76408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|76465_77530_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP049700	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2a, complete sequence	462705	100455	244375	462705	transposase	Mycobacterium_phage(16.67%)	111	NA	NA
WP_018273869.1|100455_100761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354046.1|100891_101047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060909066.1|101155_102781_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.1	5.5e-91
WP_011090953.1|102834_103191_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041483034.1|103187_103466_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354049.1|103699_103894_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_018273867.1|105534_106125_+	YecA family protein	NA	NA	NA	NA	NA
WP_041483025.1|106742_107108_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.5	3.2e-15
WP_157183496.1|107542_108259_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_026192391.1|108479_108878_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011090953.1|108874_109231_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060909066.1|109284_110910_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.1	5.5e-91
WP_085965834.1|111074_111834_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	2.1e-08
WP_018273862.1|111909_113259_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_018273859.1|114120_115164_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_018273858.1|115602_116622_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354279.1|118107_119433_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.4	2.4e-108
WP_166354051.1|121584_122763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354053.1|122746_124693_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_018273651.1|124658_125690_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_166354056.1|125686_126832_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_018273647.1|128394_130080_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_166354058.1|130172_130649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109866565.1|131166_132295_+|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	1.2e-15
WP_166354060.1|132924_133338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038975252.1|133735_134323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273626.1|138436_139771_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	43.2	8.1e-48
WP_018272321.1|142120_143464_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_018273628.1|145026_145464_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_166354062.1|145907_147467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353173.1|148061_149190_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	33.0	5.7e-18
WP_041482974.1|149836_150076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080650490.1|150672_151461_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_166354064.1|151453_152086_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_166354066.1|152326_153445_-	hypothetical protein	NA	K7Y9W2	Megavirus	30.7	1.4e-16
WP_026193427.1|153462_154458_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_018273959.1|155262_156945_+	nodulation protein NodU	NA	M1ICZ5	Pelagibacter_phage	27.1	2.1e-29
WP_018273626.1|157511_158846_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	43.2	8.1e-48
WP_041482973.1|159039_159303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018272321.1|160543_161887_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166354068.1|162189_162393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141382157.1|163011_163194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354070.1|163307_164231_+	radical SAM protein	NA	H6SUD9	Campylobacter_virus	25.8	7.0e-06
WP_157183508.1|164232_165165_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_018273951.1|168697_168946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354072.1|169564_170647_+	Tat pathway signal protein	NA	NA	NA	NA	NA
WP_157183507.1|170857_171022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018273947.1|171398_172667_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.4	3.3e-91
WP_166354074.1|172696_173740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018273942.1|174435_174942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080650487.1|174938_175295_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018272321.1|175725_177069_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_051110224.1|178824_180006_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_018273704.1|180045_180336_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018273703.1|180437_180974_+	peptidoglycan-binding protein	NA	A0A2L0HNW5	Microbacterium_phage	36.3	1.3e-07
WP_018273699.1|182564_183725_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354076.1|184874_185165_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.5	1.2e-07
WP_166354078.1|185145_185619_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	58.1	3.0e-05
WP_018273727.1|187030_187624_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_166354080.1|188782_189073_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_166354082.1|189636_190299_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_080660085.1|190295_190943_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166342308.1|191011_191881_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035677891.1|191931_192666_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	5.3e-33
WP_166354084.1|192698_193715_-	DUF4392 domain-containing protein	NA	NA	NA	NA	NA
WP_166342310.1|193711_195025_-	selenocysteine synthase	NA	NA	NA	NA	NA
WP_166342311.1|195231_196278_-	DUF4392 domain-containing protein	NA	NA	NA	NA	NA
WP_081494222.1|196304_197837_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_038975121.1|197833_198805_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	26.9	1.1e-14
WP_028181902.1|198915_199833_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166342313.1|199956_200805_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_018273723.1|200829_201495_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_028181903.1|201491_202142_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_166354086.1|202150_202957_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	3.8e-32
WP_166353121.1|204708_205838_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	7.0e-16
WP_026192128.1|205991_207056_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354280.1|208617_209490_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_166345060.1|210035_211100_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354088.1|211732_212716_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_166354282.1|212705_213470_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	26.2	4.7e-08
WP_018273734.1|214300_215320_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	3.3e-09
WP_166354090.1|215819_216233_-	DNA-binding protein	NA	Q1MVE8	Enterobacteria_phage	58.7	2.4e-35
WP_166354092.1|216460_216718_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_166354094.1|216690_216867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018273795.1|216928_217240_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_166354096.1|218254_219487_-	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	27.2	2.4e-22
WP_166354098.1|219750_220782_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	41.0	1.4e-60
WP_166354284.1|220766_221960_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	60.5	5.3e-131
WP_166354100.1|222327_222678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100213571.1|223134_224076_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	25.4	9.6e-11
WP_166354102.1|224180_224339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354104.1|224478_224724_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_166354106.1|224723_225119_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_166354108.1|225646_226768_+	DUF1612 and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_166354110.1|227057_227378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354112.1|227537_227726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354114.1|227749_227929_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_166354116.1|227983_230464_+	DEAD/DEAH box helicase family protein	NA	A0A2K9R7J3	Dishui_lake_phycodnavirus	30.6	1.1e-32
WP_166354118.1|230864_232019_-	TniQ family protein	NA	NA	NA	NA	NA
WP_166354120.1|232015_232873_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_166354122.1|232874_234524_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354124.1|234619_235714_+	DUF1612 and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_028152779.1|235720_235999_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_028152778.1|236240_236978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038953874.1|236974_237889_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_028152777.1|238092_238410_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_166354126.1|239064_239991_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	49.8	9.2e-75
WP_144030572.1|240073_240295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028152775.1|240329_240917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354128.1|241311_241725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166353121.1|243246_244375_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	7.0e-16
>prophage 3
NZ_CP049700	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2a, complete sequence	462705	304468	329096	462705	transposase	Mycobacterium_phage(40.0%)	20	NA	NA
WP_026192128.1|304468_305533_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354187.1|305699_307838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085967151.1|308550_309680_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	33.0	5.7e-18
WP_166354189.1|310444_311896_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_166354191.1|311892_313017_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_166354193.1|313079_313325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354195.1|313408_314866_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_038952271.1|314969_316238_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_166353985.1|316972_317293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273859.1|317671_318715_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354197.1|320248_321283_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_166354199.1|321332_322049_-	sugar transferase	NA	NA	NA	NA	NA
WP_166354201.1|322223_322418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354203.1|322507_322750_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354290.1|322730_322871_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354205.1|323136_324366_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_166354207.1|324942_326388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354209.1|326623_327064_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	41.8	3.7e-05
WP_166354211.1|327127_327397_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.9	1.0e-13
WP_166354213.1|327497_329096_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	2.3e-65
>prophage 1
NZ_CP049701	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2b, complete sequence	420539	3682	69722	420539	transposase,integrase	Ochrobactrum_phage(22.22%)	49	7236:7253	63065:63082
WP_166354311.1|3682_4711_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354313.1|4996_6025_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
7236:7253	attL	TCCACACGTCATCGACGA	NA	NA	NA	NA
WP_166354493.1|11363_13742_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_166354495.1|13803_14874_-	AAA family ATPase	NA	G8DDJ2	Micromonas_pusilla_virus	31.1	1.5e-15
WP_166354315.1|15760_16702_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_038381008.1|17011_17266_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_166354317.1|17265_17673_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_028153009.1|17783_18038_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_035696746.1|18037_18424_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_166354319.1|18426_19500_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_166354321.1|20049_20955_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_050995298.1|21112_22390_-	plasmid replication protein RepCa2	NA	NA	NA	NA	NA
WP_028180948.1|22627_23689_-	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	33.2	4.3e-36
WP_035696734.1|23673_24897_-	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	44.7	7.9e-90
WP_166354323.1|25294_25921_+	autoinducer synthesis protein	NA	NA	NA	NA	NA
WP_166354325.1|25926_26895_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_166354327.1|26884_27253_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_166354329.1|27245_27545_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_060907882.1|29978_30776_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_060907883.1|30772_30955_+	entry exclusion protein TrbK	NA	NA	NA	NA	NA
WP_166354331.1|30972_32133_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_060909066.1|32248_33874_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.1	5.5e-91
WP_011090953.1|33927_34284_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041483034.1|34280_34559_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011084467.1|35960_36164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354333.1|36877_38404_-	DUF1521 domain-containing protein	NA	NA	NA	NA	NA
WP_166354335.1|39456_39627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014498042.1|39656_39848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354337.1|40184_41414_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_038381030.1|41781_42024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038381029.1|42033_42231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038381037.1|42227_42515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354339.1|45168_46233_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_028182304.1|46242_46767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028154529.1|47031_48441_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_035680878.1|48539_49313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011084668.1|49585_50128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080586306.1|51912_52185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354341.1|52250_53669_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_109866565.1|53845_54974_+|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	1.2e-15
WP_026192128.1|55599_56664_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354343.1|56988_58620_-	EAL domain-containing protein	NA	A0A1B0Z064	Pseudomonas_phage	32.5	1.5e-06
WP_038381032.1|59168_60254_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354497.1|60520_61924_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.7	4.4e-20
WP_166353263.1|63305_64607_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.4	1.5e-33
63065:63082	attR	TCCACACGTCATCGACGA	NA	NA	NA	NA
WP_166354345.1|65391_65664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028154199.1|65864_66722_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.9	5.0e-51
WP_166354347.1|66923_67451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354349.1|68645_69722_-|transposase	IS630-like element ISRj1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP049701	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2b, complete sequence	420539	83996	173911	420539	transposase	Mycobacterium_phage(28.57%)	52	NA	NA
WP_166341375.1|83996_85061_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_018273921.1|85429_85807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354359.1|87567_88680_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038952271.1|88987_90256_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.9	3.9e-92
WP_166353121.1|90639_91769_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	7.0e-16
WP_166354361.1|92589_94236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354363.1|94347_94503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354501.1|96087_96753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354365.1|96758_98321_+	peptidase S53	NA	A0A1V0SLL0	Klosneuvirus	35.2	9.5e-56
WP_011090937.1|99064_99826_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166349154.1|99844_101386_-|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	7.8e-127
WP_166354306.1|103346_103634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129557650.1|103901_105031_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	33.0	9.7e-18
WP_166346112.1|105126_106266_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354367.1|106555_106876_-	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_166354369.1|107237_107546_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_166354371.1|109619_110087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354373.1|111595_113665_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	21.8	6.3e-07
WP_161536881.1|113657_113837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354375.1|115759_116629_-	porin family protein	NA	NA	NA	NA	NA
WP_011090916.1|117072_117741_+	AAA family ATPase	NA	A2I303	Vibrio_virus	32.7	1.5e-10
WP_014498616.1|117928_118741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161536880.1|119104_119707_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_161536881.1|120210_120390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166349160.1|120382_122458_+	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	21.8	6.4e-07
WP_166354503.1|125641_127354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273740.1|129360_129960_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_035681142.1|130007_131558_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	38.9	9.0e-83
WP_018273742.1|131608_131965_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	41.7	7.0e-15
WP_166354377.1|132580_133375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166350342.1|134318_134618_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_166354308.1|135014_135266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354379.1|135275_136559_-	cystathionine gamma-synthase family protein	NA	NA	NA	NA	NA
WP_018272321.1|140094_141438_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_011090960.1|143091_143295_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	48.4	3.9e-10
WP_014498624.1|143680_143911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|144652_145717_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014498626.1|147112_147391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354381.1|147709_147952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035680720.1|153661_153919_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_014497999.1|154488_154710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011084509.1|155231_155576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011090953.1|156121_156478_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011084514.1|159110_160175_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354505.1|161526_163278_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_060909225.1|163274_164138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011090946.1|164128_165175_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_166354383.1|166658_167009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162130962.1|167352_167679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060909220.1|167905_169039_+	FAD-dependent oxidoreductase	NA	A0A2K9L3K5	Tupanvirus	24.4	2.4e-08
WP_109866565.1|169656_170786_-|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	1.2e-15
WP_014498651.1|173455_173911_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP049701	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2b, complete sequence	420539	185884	269041	420539	transposase	Caulobacter_phage(22.22%)	53	NA	NA
WP_166342054.1|185884_187228_+|transposase	IS1380-like element ISBdi2 family transposase	transposase	NA	NA	NA	NA
WP_018272321.1|187506_188850_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_011091022.1|190669_190966_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_018273862.1|195221_196571_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_085971921.1|196620_197381_-|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_014490241.1|200058_200310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011082837.1|202941_203265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036046798.1|203486_204551_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	55.9	4.1e-103
WP_166354507.1|204550_206734_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	66.3	5.5e-227
WP_043900134.1|207474_208116_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011084514.1|208588_209653_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354385.1|211432_211600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014490253.1|213709_214021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011082852.1|215415_216648_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011082853.1|216774_218775_-	cytochrome c	NA	NA	NA	NA	NA
WP_011082854.1|219802_220093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016841328.1|220663_220804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354387.1|221816_223577_-	oleate hydratase	NA	NA	NA	NA	NA
WP_011082858.1|223622_224381_-	glucose 1-dehydrogenase	NA	W8CYX9	Bacillus_phage	36.6	2.5e-09
WP_166354389.1|225563_226406_+	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_011082861.1|226502_226790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071916957.1|228516_228768_+	hypothetical protein	NA	R9TP69	Rhizobium_phage	51.5	2.5e-11
WP_011082864.1|228850_229036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011082865.1|229330_229564_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_166354509.1|229988_230402_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354391.1|230398_230695_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_018273862.1|230731_232081_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_166354511.1|233073_234633_-	beta-(1-6) glucans synthase	NA	NA	NA	NA	NA
WP_166354393.1|235287_236322_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354395.1|237012_237912_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_166354397.1|237901_238639_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	9.8e-19
WP_166354399.1|238678_239803_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_166354401.1|241311_241752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354403.1|241890_242061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354405.1|242810_243878_-	DNA primase	NA	A0A0H5AWB1	Pseudomonas_phage	33.3	2.1e-06
WP_166354407.1|248476_248890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354409.1|251286_252483_-	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	41.4	3.8e-73
WP_166354411.1|252958_253198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354413.1|253946_254249_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_166354415.1|254593_254878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354417.1|255465_256479_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_166354419.1|256529_257999_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_166354421.1|258008_258629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354423.1|258376_258880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354425.1|258883_260335_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_166354427.1|260331_260799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354429.1|260795_261836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026192128.1|262255_263320_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354431.1|264261_264711_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_166354433.1|264707_265007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354435.1|265359_265554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354437.1|265566_267225_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	38.1	1.1e-89
WP_018272321.1|267697_269041_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP049701	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2b, complete sequence	420539	282572	374200	420539	transposase,integrase	uncultured_virus(15.79%)	52	333495:333554	390105:390588
WP_166354447.1|282572_282920_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354515.1|283454_284102_-|integrase	tyrosine-type recombinase/integrase	integrase	B3GAN2	uncultured_virus	25.6	3.7e-06
WP_011084514.1|284150_285215_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_166354449.1|285234_285600_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_035680914.1|285596_286574_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_026193374.1|286570_287788_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.5	6.8e-09
WP_166354451.1|292257_292737_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_166354309.1|295191_296349_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_166354311.1|298595_299624_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354313.1|299909_300938_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_166354493.1|306276_308655_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_166354495.1|308716_309787_-	AAA family ATPase	NA	G8DDJ2	Micromonas_pusilla_virus	31.1	1.5e-15
WP_166354315.1|310673_311615_-	DUF1403 family protein	NA	NA	NA	NA	NA
WP_166354453.1|312343_313606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354455.1|318252_318648_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_035697117.1|319084_320176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354457.1|320189_321362_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_166354459.1|321787_322729_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	25.4	1.6e-10
WP_050995343.1|322921_324127_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	56.4	4.4e-117
WP_035678959.1|324129_325149_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	38.9	8.4e-53
WP_166354461.1|325365_326598_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	27.8	4.9e-23
WP_166354463.1|328138_328459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038976728.1|328511_328778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129557693.1|330042_330387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028154587.1|330453_330750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354465.1|331293_332046_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_049810453.1|332642_333203_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.2	1.4e-41
333495:333554	attL	GGACACTCGAGGTTCTCGGGTTCGATCACCTGCTCGATGCGCGGCAGGTGCGCGGGAAAG	NA	NA	NA	NA
WP_011090953.1|333978_334335_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_060913184.1|334331_334610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354296.1|341871_343089_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_018273895.1|344774_345656_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157785840.1|347588_347753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129557320.1|347910_348033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354467.1|348178_348322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129557670.1|349253_350383_-|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	5.3e-16
WP_018273742.1|352463_352820_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	41.7	7.0e-15
WP_011090937.1|353000_353762_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.1	1.3e-66
WP_166341218.1|353780_355322_-|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_166354469.1|355521_357021_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.0	1.9e-82
WP_018273740.1|357068_357668_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_166354517.1|357833_358223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014490254.1|358219_358525_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_166341218.1|358731_360273_+|transposase	IS21-like element ISFK1 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.3	6.0e-127
WP_028154610.1|360887_361913_-|integrase	tyrosine-type recombinase/integrase	integrase	B3GAN2	uncultured_virus	26.6	4.1e-07
WP_166353992.1|361909_362887_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_026193374.1|362883_364101_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	27.5	6.8e-09
WP_080586907.1|366318_366684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_166354471.1|367381_368620_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1I9SC88	Mycobacterium_phage	28.3	1.8e-09
WP_166354473.1|368619_369534_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_035696431.1|369530_370544_+|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	30.3	6.7e-10
WP_166354475.1|371208_372552_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_166354477.1|372766_374200_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	35.6	5.4e-66
390105:390588	attR	GGACACTCGAGGTTCTCGGGTTCGATCACCTGCTCGATGCGCGGCAGGTGCGCGGGAAAGGCACGGGCAGCGCGCCTGGTCCGGCGGCTGGACGGCGCCGTGCCGGCGCGGCGCGCACGATCGTCCTGGCGTTCCTGGACTTCGGCGATGGCAATCTCGATGTCCTCGAGAACCAGTTGCATCTGATCGGGATTGAACTTCTCCGAGCGTTTACCGAAACGTGCGCGCTCGTACTCCTTCACGAGCAGTTCGAGGCGTTCGACGCTCTCTTTGGACGCAGCCAGTTCACTCTCGACATGAAGGCGCGCCGAGCATTCATCGTCTGCGCGACGACGCTCGGCTTCAATCATCGCTTCCTGCGCGCGGAAGAGCGCGCGCAAATCGGCGGGCAGCGCTGCAAGACGGGCGGGATCAATGGGGGACGGCGGCACATCCGCAAGCTATCATCCCAAAGCCCCGCGCGAAACAGGTTGTCGGGTCTGAG	NA	NA	NA	NA
>prophage 1
NZ_CP049702	Bradyrhizobium sp. 4(2017) strain 323S2 plasmid pB323S2c, complete sequence	198976	23590	62133	198976	integrase,transposase	Mycobacterium_phage(37.5%)	26	14172:14187	52234:52249
14172:14187	attL	CGTCAGCGGCATCATT	NA	NA	NA	NA
WP_166354563.1|23590_24673_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_166354565.1|24669_25077_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_028153011.1|25076_25331_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_166354315.1|25639_26581_+	DUF1403 family protein	NA	NA	NA	NA	NA
WP_166354567.1|26582_27269_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_035681562.1|27698_28052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060910107.1|28513_29857_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_155252163.1|30214_30388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157790585.1|31096_31261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_166354569.1|31426_33628_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	31.2	2.7e-56
WP_018273921.1|33637_34015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273922.1|34102_36805_+	DEAD/DEAH box helicase	NA	A0A160DDK8	Gordonia_phage	27.4	1.2e-37
WP_086023025.1|37516_38645_+|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	5.3e-16
WP_155258298.1|39118_39469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018273925.1|39446_39716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166354571.1|41626_43573_+	glycosyltransferase	NA	M1GYM3	Paramecium_bursaria_Chlorella_virus	33.8	1.5e-29
WP_166354700.1|43936_45065_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	33.7	2.0e-15
WP_060913273.1|47647_47836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038975248.1|47857_48448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028154428.1|48801_50034_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_018273862.1|50168_51518_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_085971921.1|51592_52353_-|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
52234:52249	attR	AATGATGCCGCTGACG	NA	NA	NA	NA
WP_028154658.1|54750_55059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085971921.1|57342_58102_+|transposase	IS5-like element ISBj2 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	35.5	3.6e-08
WP_166354573.1|58095_58683_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_086023025.1|61004_62133_+|transposase	IS3-like element ISRj2 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	34.2	5.3e-16
