The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	157488	175463	5337408	portal,tRNA,tail,capsid,terminase,protease,head	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_004900709.1|157488_158502_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
WP_001144069.1|158739_158955_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004149864.1|159066_160812_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|161030_162872_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|162971_163478_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_048292169.1|164007_164940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040177087.1|164936_165488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048292170.1|165707_167369_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	96.2	0.0e+00
WP_048292171.1|167352_167709_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	97.4	3.6e-59
WP_048271590.1|167984_168428_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	62.6	1.4e-49
WP_016160668.1|168427_168721_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
WP_048292172.1|168713_169052_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	45.9	1.1e-20
WP_048292173.1|169048_170284_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.4	1.9e-232
WP_004174254.1|170285_170846_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.3e-100
WP_048292174.1|170897_172058_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.6	4.5e-204
WP_048292175.1|172312_173086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048292176.1|173138_173384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048292177.1|173663_175463_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	1.4e-130
>prophage 2
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	2187877	2235525	5337408	terminase,integrase,tRNA,head	Salmonella_phage(19.3%)	71	2190761:2190807	2240012:2240058
WP_023302225.1|2187877_2189263_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	2.7e-46
WP_004143016.1|2189308_2189521_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2189522_2190389_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2190761:2190807	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_165430066.1|2190820_2191984_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	1.0e-203
WP_074188849.1|2191860_2192196_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012542647.1|2192208_2192448_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_165430067.1|2192447_2192669_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	58.0	2.8e-14
WP_165430068.1|2192665_2192857_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	61.0	1.3e-12
WP_087847398.1|2192853_2193339_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	1.2e-30
WP_009483862.1|2193335_2193560_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	9.2e-21
WP_023283320.1|2193556_2193778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141444227.1|2193774_2194896_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	52.3	3.7e-102
WP_023283323.1|2194892_2195051_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_165430069.1|2195047_2195728_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.6	1.6e-121
WP_165430070.1|2195724_2196570_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_048986756.1|2196585_2196870_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_165430071.1|2196877_2197849_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	2.9e-39
WP_100097684.1|2197852_2198371_-	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	44.7	2.9e-33
WP_008807814.1|2198429_2198636_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_165430072.1|2198628_2198754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542634.1|2199058_2199235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542633.1|2199339_2199744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041165401.1|2199927_2200638_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.0	1.1e-91
WP_165430073.1|2200742_2200934_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	58.9	1.1e-09
WP_116954341.1|2201014_2201299_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	57.4	1.1e-21
WP_165430074.1|2201333_2202353_+	phage replication protein	NA	S4TNJ9	Salmonella_phage	71.8	5.8e-62
WP_040206708.1|2202352_2202943_+	hypothetical protein	NA	I3PUZ9	Vibrio_phage	40.5	7.0e-36
WP_165430075.1|2202942_2203242_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165430076.1|2203809_2204502_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	47.6	6.3e-28
WP_023283338.1|2204501_2204714_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	2.4e-10
WP_009308005.1|2205656_2205971_+	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	35.6	4.4e-05
WP_165430077.1|2206127_2206724_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.8	4.3e-57
WP_165430078.1|2206729_2206897_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_165430079.1|2206893_2207562_+	serine/threonine protein phosphatase	NA	M9P0E4	Enterobacteria_phage	78.4	6.8e-104
WP_009483889.1|2207554_2208193_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	3.2e-74
WP_009483890.1|2208189_2208330_+	YlcG family protein	NA	NA	NA	NA	NA
WP_165430080.1|2208326_2209016_+	antiterminator	NA	I6PDF8	Cronobacter_phage	55.4	2.7e-63
WP_004151282.1|2210038_2210287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017898848.1|2210289_2210820_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	78.9	9.3e-80
WP_165430081.1|2210816_2211206_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	2.6e-23
WP_165430082.1|2211420_2211543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072040663.1|2211664_2212297_+	hypothetical protein	NA	A0A2I7RHH8	Vibrio_phage	48.5	5.4e-42
WP_023304875.1|2212298_2213975_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_165430083.1|2213975_2215496_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.2	1.5e-106
WP_165430084.1|2215548_2216256_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	46.9	1.3e-52
WP_064172633.1|2216290_2217460_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	3.4e-58
WP_040218280.1|2217461_2217944_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.7	1.7e-32
WP_009308036.1|2217943_2218981_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	6.5e-85
WP_040218278.1|2218982_2219309_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	4.8e-10
WP_040218276.1|2219308_2219752_+	DUF4054 domain-containing protein	NA	E2GLV0	Acinetobacter_phage	41.7	1.3e-13
WP_064190368.1|2219754_2220318_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	3.0e-20
WP_048279608.1|2220314_2220683_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	9.5e-07
WP_064190367.1|2220664_2221216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099451436.1|2221219_2222701_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	3.0e-59
WP_023304864.1|2222700_2223144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110230517.1|2223325_2224081_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	52.2	1.2e-61
WP_094326520.1|2224224_2224701_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.1	2.1e-06
WP_073568712.1|2224778_2224922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430085.1|2224902_2226819_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.8	1.6e-41
WP_004196852.1|2226822_2227665_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	2.2e-27
WP_004177055.1|2227666_2227972_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	46.5	6.2e-20
WP_071646971.1|2227968_2228823_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	30.1	1.4e-29
WP_165430086.1|2228824_2229415_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	27.5	6.4e-05
WP_101881436.1|2230057_2230420_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	48.2	8.4e-16
WP_004151257.1|2230519_2230690_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_020804687.1|2230679_2231381_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	46.2	2.3e-49
WP_087836132.1|2231464_2232220_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	59.3	5.6e-70
WP_001518114.1|2232303_2232660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430087.1|2232667_2233900_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	51.0	1.3e-105
WP_165430088.1|2233892_2234480_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
WP_102024863.1|2234481_2235525_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
2240012:2240058	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	2726465	2735940	5337408	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|2726465_2727581_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_032429904.1|2727577_2729518_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.4	2.9e-38
WP_002896516.1|2729594_2729816_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|2730141_2730459_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|2730489_2732769_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|2732900_2733119_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_072145323.1|2733472_2734192_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004224003.1|2734218_2735940_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	2973009	3041542	5337408	portal,tRNA,plate,tail,capsid,terminase,integrase,head	Enterobacteria_phage(51.43%)	85	3000205:3000222	3036298:3036315
WP_165430095.1|2973009_2974116_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2974172_2974631_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2974647_2975298_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2975538_2976789_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004213085.1|2977061_2977775_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2977771_2978164_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2978156_2978480_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_048263900.1|2978568_2978775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704434.1|2978722_2978908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2978928_2979156_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|2979268_2980462_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_137013050.1|2980677_2980866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2981085_2981271_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2981361_2981856_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|2981882_2982389_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2982405_2983293_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2983348_2984755_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|2984751_2985762_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2985877_2986075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2986641_2987274_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032409986.1|2987313_2987493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2987890_2988577_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020804938.1|2988689_2988854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302066.1|2988887_2990396_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_021313530.1|2990516_2991407_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213090.1|2991413_2993198_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_135718536.1|2993271_2994480_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2994782_2995826_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148037.1|2995906_2996026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302064.1|2996487_2997402_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2997491_2998130_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2998260_2998524_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2998583_2998709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892898.1|2998826_2998901_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2998900_2999002_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|2999059_3000073_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3000205:3000222	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_065907439.1|3000338_3001322_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.7	3.8e-151
WP_048024533.1|3001437_3001737_-	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
WP_023339925.1|3001858_3002137_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.8	2.4e-42
WP_165430096.1|3002157_3002376_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_040181449.1|3002391_3002769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430097.1|3002784_3003057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430098.1|3003125_3003350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040229546.1|3003346_3003913_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
WP_165430099.1|3004145_3005102_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.1	2.5e-83
WP_165430100.1|3005119_3007675_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.5	2.6e-188
WP_165430101.1|3007671_3008073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430102.1|3008130_3008982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099751686.1|3009678_3010740_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.3	2.4e-143
WP_165430103.1|3010733_3012461_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.9	3.9e-228
WP_108418903.1|3012617_3013457_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	3.3e-95
WP_004213107.1|3013466_3014501_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_165430104.1|3014550_3015408_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	3.7e-70
WP_004213109.1|3015520_3016036_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_004131559.1|3016035_3016236_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_165430105.1|3016226_3016511_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_165430106.1|3016507_3017053_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.7	9.7e-32
WP_165430048.1|3017239_3017575_+	peptidase	NA	NA	NA	NA	NA
WP_040228476.1|3017575_3018043_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.2	9.1e-47
WP_020316957.1|3018039_3018675_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_165430107.1|3018671_3019259_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_040229558.1|3019255_3019606_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	1.6e-27
WP_040171963.1|3019607_3020531_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.3	1.5e-53
WP_165430108.1|3020520_3023547_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_165430109.1|3023543_3023756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430110.1|3023755_3024853_+|tail	phage tail protein	tail	A0A1J0GW57	Streptomyces_phage	44.1	3.4e-07
WP_165430111.1|3024931_3025771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165430112.1|3025772_3028016_-	AAA family ATPase	NA	Q7Y4B3	Escherichia_virus	25.6	7.8e-11
WP_165430113.1|3028125_3028617_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.6	1.5e-52
WP_165430114.1|3028631_3031607_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.7	9.8e-219
WP_077270439.1|3031593_3031746_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.3	1.2e-11
WP_004131585.1|3031751_3032069_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_165430115.1|3032114_3032630_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	1.4e-56
WP_165430116.1|3032629_3033802_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	2.5e-157
WP_165430117.1|3033956_3035096_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	6.1e-145
WP_004213128.1|3035139_3035391_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_023289244.1|3035556_3036147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004176548.1|3036466_3036706_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3036298:3036315	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_014343000.1|3036695_3037034_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_020802835.1|3037038_3037548_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|3037693_3038386_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|3038417_3039593_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|3039700_3040495_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|3040478_3040925_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004892876.1|3041041_3041542_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	3160917	3218754	5337408	terminase,holin,integrase,tail	Klebsiella_phage(21.31%)	75	3156082:3156097	3179974:3179989
3156082:3156097	attL	TTCTTTTTCAGAATGG	NA	NA	NA	NA
WP_004140269.1|3160917_3161727_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|3161728_3162721_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|3162720_3163611_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_012542039.1|3163757_3164975_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.3e-120
WP_004190725.1|3164871_3165186_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_016831904.1|3165442_3165751_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	1.6e-23
WP_016831905.1|3165747_3166404_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	63.1	3.5e-68
WP_017898877.1|3166400_3166622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048291998.1|3166618_3167689_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.9	3.4e-145
WP_048291999.1|3167685_3168342_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	1.3e-112
WP_023283323.1|3168338_3168497_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_048292000.1|3168493_3169174_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	1.3e-123
WP_048292001.1|3169170_3170016_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	1.5e-68
WP_048292002.1|3170031_3170316_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	1.2e-28
WP_019704100.1|3170404_3170599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074403789.1|3170591_3170717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178796.1|3171100_3172033_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	55.5	1.9e-91
WP_004178798.1|3172029_3172503_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	58.5	1.1e-52
WP_086075425.1|3172752_3173475_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	2.1e-74
WP_004194000.1|3173543_3173771_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|3173811_3174033_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_048292003.1|3174118_3174973_+	replication protein	NA	K7PGT1	Enterobacteria_phage	55.7	5.7e-63
WP_032427729.1|3174957_3175827_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	3.4e-95
WP_048292004.1|3175823_3176117_+	protein ren	NA	O48423	Enterobacteria_phage	64.5	5.6e-26
WP_048292005.1|3176113_3176578_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	80.0	4.2e-28
WP_053065607.1|3176570_3177182_+	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	36.6	9.9e-25
WP_029602865.1|3177185_3177479_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_004223227.1|3178395_3178599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831925.1|3178757_3179354_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_048292008.1|3179562_3179982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048292009.1|3179966_3180560_+	protein ninG	NA	E7C9S3	Salmonella_phage	49.8	2.1e-40
3179974:3179989	attR	CCATTCTGAAAAAGAA	NA	NA	NA	NA
WP_032723549.1|3180556_3180787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048292010.1|3180783_3180924_+	YlcG family protein	NA	NA	NA	NA	NA
WP_048292011.1|3180920_3181610_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.8e-57
WP_071888089.1|3182462_3183230_+	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	75.9	8.9e-108
WP_032692691.1|3183232_3183382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048334541.1|3183419_3183539_-	small membrane protein	NA	NA	NA	NA	NA
WP_123229826.1|3184249_3184549_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	9.9e-47
WP_025713969.1|3184545_3185085_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|3185081_3185426_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|3185422_3185698_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190669.1|3186656_3186902_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	6.7e-33
WP_023325165.1|3187764_3188760_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.1e-38
WP_016946682.1|3188743_3190057_+|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
WP_047694609.1|3190058_3191459_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	4.1e-127
WP_048292012.1|3191442_3192555_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.2	1.6e-110
WP_016946679.1|3192639_3193425_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_032427966.1|3193435_3194389_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.4e-131
WP_151391665.1|3194397_3194670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048292013.1|3194710_3195106_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	7.3e-13
WP_048292014.1|3195107_3195362_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.8e-20
WP_004184451.1|3195371_3195605_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_029602988.1|3195591_3195975_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
WP_048292015.1|3195976_3196528_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.4	1.0e-28
WP_004146196.1|3196524_3196917_+	hypothetical protein	NA	M4SMU9	Cyanophage	30.9	7.3e-05
WP_048292016.1|3196940_3198113_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.2e-24
WP_040244185.1|3198166_3198649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|3198786_3198993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|3199069_3199426_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_032416607.1|3199536_3199905_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_048292017.1|3199978_3202879_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.6	2.3e-103
WP_032429439.1|3202878_3203352_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.2	1.0e-61
WP_048292018.1|3203338_3203821_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	8.2e-83
WP_048292019.1|3203830_3204211_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.8	6.2e-70
WP_048292020.1|3204207_3207276_+	kinase	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
WP_048292021.1|3207353_3209546_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	36.4	1.3e-98
WP_048292235.1|3209689_3210310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053065609.1|3210498_3211623_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	46.9	6.6e-83
WP_053065608.1|3211635_3213624_-	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	53.6	5.7e-21
WP_048292022.1|3213715_3214264_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.8	7.6e-93
WP_032428262.1|3214341_3214764_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_002901812.1|3215313_3215733_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_039110604.1|3215734_3217000_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	7.6e-205
WP_072041214.1|3217178_3217988_+	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	94.1	1.8e-154
WP_039110606.1|3218085_3218754_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.0e-80
>prophage 6
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	3477345	3486760	5337408		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|3477345_3477966_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_032423485.1|3477958_3479224_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|3479235_3480138_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|3480399_3481161_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|3481181_3482042_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|3482339_3482600_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|3482686_3483775_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|3483805_3485071_-	MFS transporter	NA	NA	NA	NA	NA
WP_162557934.1|3485125_3486760_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	56.0	3.6e-183
>prophage 7
NZ_CP049604	Klebsiella pneumoniae strain Kp8701 chromosome, complete genome	5337408	4496737	4503642	5337408	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|4496737_4498216_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|4498212_4498935_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|4499253_4500615_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|4500857_4501754_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_047669696.1|4501994_4502768_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_032429748.1|4502778_4503642_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP049605	Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence	224442	68618	132263	224442	integrase,transposase,protease	Bacillus_phage(30.77%)	54	58378:58392	90645:90659
58378:58392	attL	CGGCACGACGGGCTT	NA	NA	NA	NA
WP_001515717.1|68618_69359_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_077269298.1|71476_73360_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_139788384.1|73889_74012_+	small membrane protein	NA	NA	NA	NA	NA
WP_064185732.1|74302_74938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131863819.1|75237_75711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328269.1|76237_76495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071836382.1|77099_78554_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004176137.1|79301_80333_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_023328272.1|80824_81175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|81734_81965_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|81961_82378_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|82451_84014_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_165430150.1|83998_85021_+	DNA helicase UvrD	NA	NA	NA	NA	NA
WP_014343466.1|85092_85215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032411229.1|85564_86473_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004187110.1|86658_87009_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_004187113.1|87156_87588_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_032437967.1|87837_89313_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_032437987.1|89305_89986_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	3.5e-31
WP_023280925.1|90175_91561_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
90645:90659	attR	AAGCCCGTCGTGCCG	NA	NA	NA	NA
WP_004213578.1|91589_91952_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_048270279.1|92065_93358_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_049183829.1|93368_96515_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	8.0e-62
WP_000758228.1|96601_97042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049183833.1|97168_99616_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
WP_000843497.1|99656_99854_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|99887_100625_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023257.1|100913_101363_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|101591_103409_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|103408_104305_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|104344_104725_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|104729_105659_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|105713_106394_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_009309895.1|106390_107791_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_004118347.1|108006_108441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049183851.1|108737_109718_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.9	1.3e-183
WP_015065578.1|110130_110520_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_000654805.1|110801_111770_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_032413314.1|111977_112985_+	DUF1611 domain-containing protein	NA	NA	NA	NA	NA
WP_023328925.1|112986_113952_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_049183621.1|113967_115833_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.7e-14
WP_015065582.1|115855_117397_+	glutathione ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015065583.1|117478_118411_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023328923.1|118407_119292_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023328922.1|119294_120338_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_015065586.1|120334_121156_+	M55 family metallopeptidase	NA	NA	NA	NA	NA
WP_032413424.1|121727_122636_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162889636.1|123771_124740_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.2	2.0e-181
WP_049183345.1|125229_125739_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_049183348.1|125761_127429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013609503.1|127442_128642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|129063_129330_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|129317_129800_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152113.1|131300_132263_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP049605	Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence	224442	137758	202940	224442	integrase,transposase	Planktothrix_phage(23.53%)	53	150470:150489	162312:162331
WP_004118209.1|137758_138022_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004181997.1|139172_140180_-	formamidase	NA	NA	NA	NA	NA
WP_004181996.1|140215_140905_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
WP_004181995.1|140915_141665_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
WP_004181994.1|141661_142777_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_004181993.1|142786_143713_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_004197507.1|143769_144960_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004181991.1|145264_148645_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
WP_004181990.1|148607_149528_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
150470:150489	attL	GGCTTTGTTGAATAAATCAG	NA	NA	NA	NA
WP_072143344.1|150524_151493_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
WP_049182134.1|153403_155137_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|155144_156092_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|156136_157741_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|157753_158674_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|158673_159522_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|159518_160112_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|160108_161236_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|161520_161688_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004197062.1|162790_163312_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
162312:162331	attR	CTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_004118237.1|163308_164262_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_020325014.1|164348_166673_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004182127.1|166717_167620_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_049182130.1|167616_168615_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_049182128.1|168611_169568_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|169568_170336_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|170434_170728_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_074420616.1|171058_171310_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_016528990.1|171548_172631_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.1	2.0e-185
WP_065520837.1|172752_175827_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
WP_004098904.1|175878_177132_+	lactose permease	NA	NA	NA	NA	NA
WP_074420608.1|177188_177359_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_024623136.1|178576_179155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049181506.1|179157_179517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087796248.1|179667_180817_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.6	9.1e-173
WP_032432508.1|181871_182471_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032432506.1|182516_183218_-	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_032432505.1|183214_184468_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_032432532.1|184464_185250_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.5e-29
WP_032432503.1|185281_185923_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032432501.1|185919_186579_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032432500.1|186589_187435_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087788032.1|189793_191001_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	9.8e-101
WP_003031962.1|191566_192637_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_003031960.1|193049_194147_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_049182672.1|194377_195415_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_032432493.1|195420_196251_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_003031956.1|196316_197072_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_165430151.1|197115_197778_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003031954.1|197777_198518_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	4.7e-29
WP_016947508.1|198517_199348_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_020803678.1|199368_200235_+	DMT family transporter	NA	NA	NA	NA	NA
WP_101977911.1|200802_201327_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	31.0	6.7e-22
WP_049183940.1|201701_202940_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.1	6.2e-10
