The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	0	21518	5241093	tRNA	Tupanvirus(25.0%)	21	NA	NA
WP_015365997.1|1122_1992_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015365996.1|2117_3560_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_045390317.1|3809_4781_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_045376156.1|4907_6227_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.0	2.6e-14
WP_045390494.1|6242_7187_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_015705955.1|7265_8018_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.4	3.0e-15
WP_045390315.1|8017_8803_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_015365990.1|8842_9853_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	1.2e-06
WP_015365989.1|9861_10473_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_015365988.1|10554_11076_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_015365987.1|11121_11862_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015365986.1|11911_12355_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_047045571.1|12356_14144_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	24.7	5.6e-12
WP_047045567.1|14410_14977_+	hydrolase	NA	NA	NA	NA	NA
WP_047045564.1|14973_15792_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	2.2e-56
WP_015365982.1|15845_16241_+	membrane protein	NA	NA	NA	NA	NA
WP_015365981.1|16280_17024_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	28.7	1.7e-23
WP_045390306.1|17020_18037_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_047045561.1|18165_18906_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_047045558.1|18985_19555_-	VOC family protein	NA	NA	NA	NA	NA
WP_047045556.1|19784_21518_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	8.8e-87
>prophage 2
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	28482	29997	5241093		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_047045549.1|28482_29997_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	6.9e-11
>prophage 3
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	46586	47339	5241093		Cedratvirus(100.0%)	1	NA	NA
WP_045390250.1|46586_47339_-	L-cystine ABC transporter ATP-binding protein YecC	NA	A0A1M7XV31	Cedratvirus	34.4	2.9e-18
>prophage 4
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	54055	62715	5241093		Burkholderia_phage(40.0%)	9	NA	NA
WP_047045512.1|54055_55723_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	32.1	6.0e-16
WP_045390229.1|55822_56002_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_045390227.1|56078_56990_-	DUF808 family protein	NA	NA	NA	NA	NA
WP_045390224.1|57173_58085_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_045390221.1|58059_58545_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	52.2	3.5e-33
WP_047045510.1|58525_59950_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.5	3.4e-100
WP_045390215.1|60007_60703_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.1	8.6e-09
WP_045390212.1|60745_61027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045390209.1|61572_62715_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.8	2.0e-119
>prophage 5
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	97852	104272	5241093		Stx2-converting_phage(33.33%)	4	NA	NA
WP_015365831.1|97852_99019_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.6	4.3e-186
WP_047045923.1|99405_100554_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	32.2	8.6e-38
WP_059355882.1|100709_102131_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_047045925.1|102169_104272_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	2.6e-64
>prophage 6
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	108688	109588	5241093		Cellulophaga_phage(100.0%)	1	NA	NA
WP_045379285.1|108688_109588_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.8e-11
>prophage 7
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	117707	121595	5241093		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_072058220.1|117707_118886_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	28.9	1.6e-26
WP_052766190.1|118936_120421_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_047045955.1|120425_121595_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.3	1.4e-06
>prophage 8
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	125567	136376	5241093		Streptococcus_phage(25.0%)	8	NA	NA
WP_047045968.1|125567_126719_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.1	8.0e-76
WP_045391802.1|126730_127471_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.3	1.9e-09
WP_045391805.1|127470_128238_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_045391808.1|129189_130194_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
WP_045391811.1|130450_131617_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.8	7.0e-112
WP_045391814.1|131840_133214_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_047078091.1|133216_134548_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045391820.1|134600_136376_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	32.6	3.2e-15
>prophage 9
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	140959	146631	5241093		Ostreococcus_lucimarinus_virus(33.33%)	4	NA	NA
WP_045391829.1|140959_142366_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_047046491.1|142585_143737_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_047046488.1|143819_145196_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.0	1.5e-33
WP_047046485.1|145209_146631_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	7.3e-55
>prophage 10
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	152580	153945	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047046473.1|152580_153945_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0A0RN35	Bacillus_phage	30.2	1.6e-27
>prophage 11
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	162781	169351	5241093		Bacillus_phage(25.0%)	5	NA	NA
WP_015706060.1|162781_163672_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.2	1.7e-46
WP_047046458.1|164527_166114_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	2.9e-36
WP_047046455.1|166161_168009_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_015365790.1|168036_168618_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_015365789.1|168709_169351_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	5.8e-36
>prophage 12
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	181073	185905	5241093	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_045391887.1|181073_182528_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	1.2e-28
WP_045391890.1|182524_183247_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	3.2e-30
WP_032714942.1|183392_184754_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.6	5.9e-203
WP_015706070.1|185011_185905_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.8	1.1e-11
>prophage 13
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	200722	205570	5241093		Tetraselmis_virus(100.0%)	3	NA	NA
WP_047044843.1|200722_202699_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.7	7.3e-162
WP_047044846.1|202742_203378_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_047044849.1|203593_205570_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	5.2e-160
>prophage 14
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	213414	221767	5241093	tRNA	Enterobacteria_phage(60.0%)	9	NA	NA
WP_045377042.1|213414_215448_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.8	6.8e-54
WP_047044866.1|215588_216053_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_015706088.1|216096_216564_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	6.1e-67
WP_045391229.1|216617_217337_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_045391232.1|217330_219019_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	2.6e-256
WP_047044868.1|219218_219950_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.3	1.0e-76
WP_015365743.1|220009_220123_+	protein YohO	NA	NA	NA	NA	NA
WP_047044871.1|220097_220835_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047044874.1|220831_221767_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.9e-19
>prophage 15
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	228312	228867	5241093		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015365736.1|228312_228867_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.0e-20
>prophage 16
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	232962	233697	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_047044892.1|232962_233697_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.7	8.1e-50
>prophage 17
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	249409	250930	5241093		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_015365712.1|249409_250930_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	6.9e-11
>prophage 18
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	254694	260829	5241093		uncultured_Caudovirales_phage(60.0%)	6	NA	NA
WP_015365708.1|254694_255363_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	1.2e-55
WP_047044925.1|255706_256543_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_047044926.1|256694_257015_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	1.5e-21
WP_047044929.1|257049_258339_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.0	1.0e-164
WP_047044933.1|258351_258786_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	1.4e-49
WP_047044936.1|258855_260829_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	8.1e-12
>prophage 19
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	265166	266021	5241093		Catovirus(100.0%)	1	NA	NA
WP_047044939.1|265166_266021_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	6.8e-24
>prophage 20
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	274134	278446	5241093		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_047044948.1|274134_275601_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_059342127.1|275722_276700_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_047043195.1|276742_277450_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_047043201.1|277876_278446_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	36.8	3.1e-12
>prophage 21
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	284205	290292	5241093		Planktothrix_phage(33.33%)	5	NA	NA
WP_047043211.1|284205_285795_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	2.7e-18
WP_045391356.1|285798_286143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045391357.1|286474_287671_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.6	8.1e-23
WP_047043216.1|287667_288387_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_047043219.1|288534_290292_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.2	3.4e-102
>prophage 22
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	294548	295556	5241093		Vibrio_phage(100.0%)	1	NA	NA
WP_015365669.1|294548_295556_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	50.2	6.3e-85
>prophage 23
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	303906	312461	5241093		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
WP_047043234.1|303906_305115_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.6	2.4e-67
WP_045391390.1|305077_306514_-	magnesium transporter	NA	NA	NA	NA	NA
WP_047043236.1|306678_308322_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	5.4e-09
WP_047043239.1|308390_309050_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_045391396.1|309049_310120_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.2	8.3e-19
WP_047043241.1|310192_311245_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_045391399.1|311348_312461_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.5	1.1e-117
>prophage 24
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	316673	328445	5241093		Pseudomonas_phage(33.33%)	7	NA	NA
WP_047043244.1|316673_319526_-	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	3.8e-34
WP_045391405.1|319657_322291_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.5	1.6e-92
WP_045391407.1|322437_323166_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_015365619.1|323512_325798_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_047043245.1|325898_327029_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_015365617.1|327028_327283_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_047043247.1|327377_328445_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
>prophage 25
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	336248	337166	5241093	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_047043255.1|336248_337166_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.1	3.4e-69
>prophage 26
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	370418	371018	5241093		Salmonella_phage(100.0%)	1	NA	NA
WP_047043285.1|370418_371018_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 27
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	383018	384958	5241093		Salmonella_phage(50.0%)	3	NA	NA
WP_165430573.1|383018_383573_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	52.2	6.6e-44
WP_047043314.1|383648_384146_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015365566.1|384184_384958_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	30.2	5.1e-10
>prophage 28
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	389251	390769	5241093		Mollivirus(100.0%)	1	NA	NA
WP_047043320.1|389251_390769_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.1e-88
>prophage 29
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	397243	398380	5241093		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_045391501.1|397243_398380_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	1.2e-20
>prophage 30
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	407064	408150	5241093		Pandoravirus(100.0%)	1	NA	NA
WP_165430574.1|407064_408150_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	5.9e-89
>prophage 31
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	417228	418140	5241093		Enterobacteria_phage(100.0%)	1	NA	NA
WP_047078316.1|417228_418140_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	76.8	6.4e-121
>prophage 32
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	422452	424158	5241093		Enterobacteria_phage(50.0%)	2	NA	NA
WP_088389892.1|422452_423697_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	62.0	7.0e-78
WP_088389891.1|423759_424158_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	47.8	1.9e-05
>prophage 33
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	431153	433691	5241093		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_088389885.1|431153_433691_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	22.1	1.1e-13
>prophage 34
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	443409	443865	5241093		Pandoravirus(100.0%)	1	NA	NA
WP_088389881.1|443409_443865_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.6	7.1e-12
>prophage 35
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	447160	449613	5241093		Enterobacteria_phage(50.0%)	2	NA	NA
WP_047045749.1|447160_448858_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	5.1e-47
WP_047066271.1|448869_449613_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.8	5.6e-14
>prophage 36
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	466150	476102	5241093		Lactobacillus_phage(25.0%)	9	NA	NA
WP_045392579.1|466150_467077_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	9.7e-08
WP_045392582.1|467166_468165_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_013878164.1|468161_468380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045392584.1|468381_470397_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	6.8e-147
WP_045392587.1|470471_471551_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_047043535.1|471781_472543_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_045362238.1|472721_473693_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
WP_000487600.1|474072_474330_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_015365498.1|474374_476102_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 37
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	479944	482049	5241093		Streptococcus_phage(50.0%)	2	NA	NA
WP_047043515.1|479944_480856_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.1	8.5e-57
WP_047043512.1|480954_482049_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
>prophage 38
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	485542	489118	5241093		Pandoravirus(50.0%)	5	NA	NA
WP_047043506.1|485542_486442_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.2	1.9e-24
WP_047043503.1|486536_487112_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_047043500.1|487172_487622_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_045392622.1|487608_488034_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_045392625.1|488245_489118_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.9	2.5e-13
>prophage 39
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	509214	509928	5241093		Cyanophage(100.0%)	1	NA	NA
WP_047043477.1|509214_509928_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.2e-37
>prophage 40
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	516518	523800	5241093	transposase	Prochlorococcus_phage(50.0%)	7	NA	NA
WP_047043467.1|516518_517442_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.9	1.1e-72
WP_026612247.1|517438_518140_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_045379877.1|518238_519525_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.1e-65
WP_015370402.1|519621_520248_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047043464.1|520444_521875_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_047043459.1|522124_523162_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	3.7e-72
WP_045392675.1|523158_523800_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.8	3.3e-31
>prophage 41
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	536220	541326	5241093		Escherichia_phage(33.33%)	4	NA	NA
WP_045392697.1|536220_536412_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	75.9	8.1e-18
WP_015703162.1|536680_538258_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_015370334.1|538327_539794_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	8.8e-88
WP_047043444.1|539952_541326_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.9e-40
>prophage 42
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	551836	552268	5241093		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004866348.1|551836_552268_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.3e-18
>prophage 43
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	563456	569780	5241093		Mycoplasma_phage(20.0%)	8	NA	NA
WP_045392740.1|563456_564743_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	4.9e-34
WP_002913954.1|564814_565015_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_012540871.1|565016_565352_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_047043413.1|565353_567204_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.7	2.9e-104
WP_047043410.1|567219_567735_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_012540868.1|567809_568133_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
WP_004866383.1|568152_568539_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.0e-52
WP_015703173.1|568565_569780_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
>prophage 44
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	577331	600330	5241093	tRNA	Bacillus_phage(25.0%)	21	NA	NA
WP_015370305.1|577331_578585_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_047043395.1|578910_580101_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|580243_580582_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_045377589.1|580647_581985_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	36.3	2.0e-09
WP_047043539.1|581971_582664_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_072251588.1|582681_584118_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.1e-13
WP_047043389.1|584687_588575_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.1	3.0e-127
WP_047043386.1|588748_590368_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_045392764.1|590364_590868_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.9e-06
WP_045392766.1|590947_591583_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_047043382.1|591797_592646_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045392770.1|592680_592977_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045392772.1|593043_593361_-	toxin HigB-2	NA	NA	NA	NA	NA
WP_047043379.1|593564_593825_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_045392774.1|593833_594214_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_032715172.1|594213_594945_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015370291.1|594956_595694_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_015370290.1|595705_596611_-	GTPase Era	NA	NA	NA	NA	NA
WP_020078171.1|596607_597288_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.3e-20
WP_045392778.1|597541_598516_-	signal peptidase I	NA	NA	NA	NA	NA
WP_008803765.1|598530_600330_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
>prophage 45
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	606100	610619	5241093	tRNA	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
WP_045392789.1|606100_607432_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	9.0e-47
WP_002914084.1|607477_607861_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_047043370.1|608173_608863_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	2.9e-57
WP_015703188.1|608918_609989_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_015370277.1|610193_610619_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	3.5e-13
>prophage 46
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	615916	617215	5241093		Burkholderia_virus(100.0%)	1	NA	NA
WP_047043360.1|615916_617215_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.8	6.9e-44
>prophage 47
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	623390	625964	5241093		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015703191.1|623390_625964_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	3.4e-127
>prophage 48
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	632770	633841	5241093		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_015370264.1|632770_633841_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	5.3e-90
>prophage 49
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	651189	657122	5241093		Staphylococcus_phage(50.0%)	5	NA	NA
WP_015370247.1|651189_651672_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
WP_047044416.1|652706_653531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047044412.1|653499_653823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047044410.1|654034_654421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045378289.1|654599_657122_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.7	1.9e-85
>prophage 50
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	664480	665104	5241093		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_045395142.1|664480_665104_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	9.1e-10
>prophage 51
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	671812	674920	5241093		Escherichia_phage(50.0%)	4	NA	NA
WP_047044390.1|671812_673027_-	acyltransferase	NA	G9L6E5	Escherichia_phage	29.4	1.3e-23
WP_047044388.1|673141_673978_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_045395158.1|673988_674315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047044385.1|674356_674920_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	46.7	9.4e-30
>prophage 52
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	683980	685907	5241093		Planktothrix_phage(50.0%)	2	NA	NA
WP_047044369.1|683980_684970_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.6e-16
WP_165430579.1|684962_685907_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	1.7e-15
>prophage 53
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	693220	704475	5241093		Ostreococcus_tauri_virus(14.29%)	13	NA	NA
WP_047044349.1|693220_694123_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.5	3.3e-37
WP_045395194.1|694331_694511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161801908.1|694551_694971_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_015370082.1|695670_696120_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_015370081.1|696184_696547_-	YgaC family protein	NA	NA	NA	NA	NA
WP_015370080.1|696696_697044_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_047044346.1|697120_698479_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.3	2.2e-16
WP_047044343.1|698569_699001_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_047044340.1|699184_699430_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	43.8	1.5e-11
WP_045395202.1|699426_699837_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	42.3	2.5e-16
WP_047044337.1|699809_701954_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.0	3.6e-191
WP_015370074.1|701964_702927_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	5.0e-132
WP_045395207.1|703272_704475_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.9	9.9e-29
>prophage 54
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	718285	726524	5241093	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|718285_718471_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_045395419.1|718834_721462_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_047044138.1|721713_722214_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_015370055.1|722284_723343_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.8	8.8e-114
WP_020078118.1|723432_723930_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.6	4.5e-28
WP_047044137.1|724067_724946_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015370052.1|724953_725817_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_165430580.1|725813_726524_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	26.2	8.2e-07
>prophage 55
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	732728	733694	5241093		Tetraselmis_virus(100.0%)	1	NA	NA
WP_047044133.1|732728_733694_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	8.0e-37
>prophage 56
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	762114	762936	5241093		Pithovirus(100.0%)	1	NA	NA
WP_047044102.1|762114_762936_+	manganese/iron ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.5	4.0e-13
>prophage 57
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	774896	788440	5241093		uncultured_Mediterranean_phage(28.57%)	15	NA	NA
WP_047044298.1|774896_775676_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	5.5e-12
WP_047044296.1|776031_776514_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_072056492.1|776525_776975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088389772.1|776959_777307_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_042895300.1|777700_780262_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	7.8e-31
WP_047039048.1|780343_780580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045361374.1|780590_782018_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_047041933.1|782020_782611_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_047044293.1|782784_783204_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047044291.1|783200_784088_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.1	1.0e-06
WP_047044290.1|784211_784589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015369990.1|784641_785634_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	3.6e-32
WP_047044288.1|785791_786934_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_015369988.1|787058_787685_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	8.2e-35
WP_015369987.1|787678_788440_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.3e-58
>prophage 58
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	791502	793535	5241093		Tupanvirus(50.0%)	2	NA	NA
WP_047044279.1|791502_792108_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	2.3e-26
WP_047044277.1|792107_793535_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.3	1.0e-35
>prophage 59
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	822360	828716	5241093		Trichoplusia_ni_ascovirus(25.0%)	5	NA	NA
WP_072251457.1|822360_823149_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.8e-18
WP_047044321.1|823339_824011_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	1.9e-13
WP_045395337.1|824523_825633_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_015369968.1|825699_826998_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
WP_015703305.1|827078_828716_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	3.0e-153
>prophage 60
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	832714	838177	5241093		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_047044242.1|832714_834019_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.4	5.7e-38
WP_047044241.1|834129_836880_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.1e-49
WP_045397589.1|837037_838177_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.1	1.0e-46
>prophage 61
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	845588	846434	5241093		Vibrio_phage(100.0%)	1	NA	NA
WP_047044232.1|845588_846434_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	2.1e-41
>prophage 62
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	851283	860541	5241093	tRNA	Bacillus_phage(25.0%)	9	NA	NA
WP_047044226.1|851283_852042_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.7	1.7e-10
WP_015369947.1|852085_853186_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_015369946.1|853178_853574_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015369945.1|853617_854535_-	glycine cleavage system transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_047044224.1|854967_856173_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.8	3.6e-71
WP_047044222.1|856172_856604_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_047044220.1|856681_857491_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	5.5e-15
WP_045377497.1|857570_858668_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_015703319.1|859287_860541_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	9.4e-14
>prophage 63
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	863957	865793	5241093		Virus_Rctr197k(100.0%)	1	NA	NA
WP_047044214.1|863957_865793_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.5	6.6e-24
>prophage 64
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	869331	872217	5241093		Hokovirus(100.0%)	1	NA	NA
WP_047044210.1|869331_872217_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.5	1.6e-40
>prophage 65
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	877681	884763	5241093		Cronobacter_phage(33.33%)	6	NA	NA
WP_045398131.1|877681_878476_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	64.1	1.1e-119
WP_015369928.1|878482_879358_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_015369927.1|879818_882065_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.8	4.3e-09
WP_015703328.1|882077_882608_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_047044200.1|883290_883986_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_045396707.1|884049_884763_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
>prophage 66
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	887780	893216	5241093		Staphylococcus_phage(50.0%)	4	NA	NA
WP_047044196.1|887780_889940_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_165430581.1|890561_891578_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_047044194.1|891538_892018_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_161801907.1|892214_893216_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.0	2.2e-29
>prophage 67
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	901666	904142	5241093		Aichi_virus(50.0%)	2	NA	NA
WP_015369908.1|901666_903085_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.7	3.9e-24
WP_047044182.1|903380_904142_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	7.0e-20
>prophage 68
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	931368	933154	5241093	integrase	Escherichia_phage(100.0%)	2	928156:928169	938769:938782
928156:928169	attL	CCGGCGGTCACCGG	NA	NA	NA	NA
WP_045396578.1|931368_931974_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.3	1.9e-52
WP_045373908.1|932557_933154_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.5	9.2e-52
938769:938782	attR	CCGGTGACCGCCGG	NA	NA	NA	NA
>prophage 69
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	947923	949474	5241093		Acinetobacter_phage(100.0%)	1	NA	NA
WP_045391925.1|947923_949474_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.9	6.6e-158
>prophage 70
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	967560	970082	5241093	tRNA	Tetraselmis_virus(50.0%)	2	NA	NA
WP_015369839.1|967560_968697_+	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	36.5	2.3e-59
WP_045373961.1|968813_970082_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	27.6	2.8e-21
>prophage 71
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	984854	985574	5241093		Clostridium_phage(100.0%)	1	NA	NA
WP_045391979.1|984854_985574_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.2	3.3e-11
>prophage 72
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	990315	996398	5241093	tRNA	Catovirus(25.0%)	5	NA	NA
WP_015369798.1|990315_991833_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.3	1.7e-86
WP_108418699.1|991842_992941_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_047044021.1|993026_994760_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	3.2e-60
WP_045374003.1|994765_995479_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_032715787.1|995501_996398_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	2.7e-31
>prophage 73
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1001231	1002665	5241093		Pandoravirus(100.0%)	1	NA	NA
WP_032712496.1|1001231_1002665_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	6.7e-32
>prophage 74
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1007856	1010730	5241093		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_047044031.1|1007856_1010730_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.2	2.0e-261
>prophage 75
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1018598	1019831	5241093		Catovirus(100.0%)	1	NA	NA
WP_015369774.1|1018598_1019831_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	9.0e-102
>prophage 76
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1044305	1045100	5241093		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_047044061.1|1044305_1045100_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.1	1.7e-08
>prophage 77
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1059448	1062389	5241093		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004149807.1|1059448_1060603_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
WP_045379571.1|1060994_1062389_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	2.4e-26
>prophage 78
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1073889	1074699	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_004181271.1|1073889_1074699_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.9e-18
>prophage 79
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1079357	1080443	5241093		Geobacillus_virus(100.0%)	1	NA	NA
WP_072047969.1|1079357_1080443_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	1.0e-11
>prophage 80
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1089604	1091740	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_052766958.1|1089604_1091740_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.4	2.2e-23
>prophage 81
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1133332	1143235	5241093		Staphylococcus_phage(25.0%)	8	NA	NA
WP_015369664.1|1133332_1134160_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	1.2e-60
WP_047043031.1|1134194_1134722_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047043034.1|1134785_1136969_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	3.4e-104
WP_045392156.1|1137092_1138505_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_045377717.1|1138588_1139326_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_045392162.1|1139512_1141771_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	6.3e-85
WP_047043037.1|1141892_1142762_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015369658.1|1142839_1143235_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	40.9	3.7e-17
>prophage 82
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1146539	1159009	5241093		Bacillus_virus(16.67%)	14	NA	NA
WP_015369653.1|1146539_1148435_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	2.5e-90
WP_045392174.1|1148465_1149041_-	esterase YqiA	NA	NA	NA	NA	NA
WP_045392177.1|1149040_1149868_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_045392180.1|1149892_1150315_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_015369649.1|1150316_1150946_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.7	2.0e-20
WP_047043046.1|1151141_1152596_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_047043048.1|1152761_1153433_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	46.8	3.5e-39
WP_045392189.1|1153438_1154599_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.1e-88
WP_045392192.1|1154655_1155450_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_015703517.1|1155656_1156310_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.8e-45
WP_045392195.1|1156694_1156964_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_045392198.1|1157159_1157357_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_165430588.1|1157348_1157498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047043052.1|1157575_1159009_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
>prophage 83
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1164116	1165358	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_047043059.1|1164116_1165358_+	multifunctional CCA addition/repair protein	NA	V5KSX2	Escherichia_phage	42.9	1.3e-84
>prophage 84
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1169267	1206515	5241093	head,terminase,tRNA,portal,capsid,tail,lysis,integrase,holin,plate	Erwinia_phage(40.0%)	44	1175386:1175434	1207602:1207650
WP_032712539.1|1169267_1170281_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
WP_001144069.1|1170519_1170735_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_045392225.1|1170912_1172658_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	2.4e-76
WP_015369628.1|1172808_1174653_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_047043068.1|1174723_1175230_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
1175386:1175434	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAAT	NA	NA	NA	NA
WP_072059347.1|1175589_1175808_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	2.1e-38
WP_165430589.1|1175877_1177047_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	96.1	1.2e-204
WP_165430590.1|1177043_1177529_-|tail	phage tail protein	tail	O80317	Escherichia_phage	94.3	8.5e-80
WP_165430591.1|1177543_1179985_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	92.0	0.0e+00
WP_015370160.1|1179977_1180097_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.4	8.8e-15
WP_165430592.1|1180129_1180465_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	85.3	8.8e-44
WP_165430593.1|1180527_1181046_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	98.8	2.1e-92
WP_165430594.1|1181061_1182240_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.9	3.2e-213
WP_165430595.1|1182371_1182989_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	55.2	3.9e-53
WP_165430688.1|1182988_1183927_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	57.4	7.2e-35
WP_165430596.1|1184859_1185468_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	93.1	1.6e-107
WP_165430597.1|1185460_1186369_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	95.7	8.3e-153
WP_165430598.1|1186375_1186723_-|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	93.9	1.3e-53
WP_165430599.1|1186719_1187361_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	94.4	6.8e-109
WP_126033243.1|1187429_1187879_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	95.3	1.6e-69
WP_047045389.1|1187871_1188339_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
WP_001384078.1|1188301_1188475_-	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_165430600.1|1188446_1188860_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	93.4	2.8e-63
WP_165430601.1|1188856_1189354_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	92.7	1.9e-87
WP_032413163.1|1189340_1189637_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	96.9	2.9e-46
WP_015370176.1|1189639_1189843_-|tail	tail protein	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
WP_165430602.1|1189842_1190352_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	95.3	5.2e-88
WP_165430603.1|1190445_1191195_-|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	90.4	2.9e-111
WP_101705473.1|1191199_1192267_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.6	3.5e-179
WP_165430604.1|1192343_1193198_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	90.5	3.9e-144
WP_032723321.1|1193363_1195133_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	97.5	0.0e+00
WP_135717576.1|1195134_1196181_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.5	2.8e-189
WP_032618970.1|1196618_1198577_+	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_165430605.1|1198620_1199670_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.6	7.4e-105
WP_165430606.1|1199794_1199992_-	Tum protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.2e-11
WP_165430607.1|1202355_1202949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430608.1|1202970_1203195_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.6	4.7e-33
WP_114456361.1|1203194_1203428_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	54.5	4.0e-11
WP_015959029.1|1203495_1203834_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_165430609.1|1203797_1203998_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	1.3e-29
WP_142472839.1|1204005_1204515_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.2	2.8e-89
WP_023327785.1|1204535_1204811_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.4	4.5e-38
WP_142472859.1|1204941_1205514_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	89.4	1.7e-95
WP_142472838.1|1205513_1206515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	7.6e-192
1207602:1207650	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAAT	NA	NA	NA	NA
>prophage 85
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1220821	1221862	5241093		Enterobacteria_phage(100.0%)	1	NA	NA
WP_045392243.1|1220821_1221862_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	2.9e-16
>prophage 86
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1225210	1226785	5241093		Tetraselmis_virus(100.0%)	1	NA	NA
WP_045377786.1|1225210_1226785_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	51.7	4.6e-135
>prophage 87
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1236624	1238313	5241093		Tetraselmis_virus(100.0%)	1	NA	NA
WP_047043139.1|1236624_1238313_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	33.1	1.3e-58
>prophage 88
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1249989	1257154	5241093	tRNA	Klosneuvirus(50.0%)	5	NA	NA
WP_047043175.1|1249989_1251369_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.0	5.8e-33
WP_047043178.1|1251411_1251744_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_009485173.1|1251951_1252935_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_141097053.1|1252885_1253908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047043181.1|1254055_1257154_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	3.8e-157
>prophage 89
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1268958	1270446	5241093		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_047044829.1|1268958_1270446_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	27.0	1.8e-08
>prophage 90
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1279154	1280123	5241093		Enterobacteria_phage(100.0%)	1	NA	NA
WP_045394902.1|1279154_1280123_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.6	9.8e-35
>prophage 91
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1313153	1323384	5241093		Escherichia_phage(16.67%)	13	NA	NA
WP_047044748.1|1313153_1313927_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	6.2e-24
WP_165430689.1|1313971_1314862_-	Fic family protein	NA	NA	NA	NA	NA
WP_047044743.1|1314976_1315840_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
WP_165430611.1|1315903_1318009_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_045394928.1|1317966_1318353_+	YraN family protein	NA	NA	NA	NA	NA
WP_015369544.1|1318378_1318969_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_045394929.1|1318978_1319554_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_047044737.1|1319720_1320764_-	permease	NA	NA	NA	NA	NA
WP_045394931.1|1320836_1321484_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_015703592.1|1321612_1322131_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	26.4	1.2e-10
WP_047044733.1|1322110_1322554_-	YhbP family protein	NA	NA	NA	NA	NA
WP_026612209.1|1322603_1322894_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	51.3	9.1e-13
WP_047044731.1|1322880_1323384_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	33.3	2.6e-15
>prophage 92
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1328532	1330467	5241093		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_015369531.1|1328532_1330467_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 93
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1335881	1342497	5241093		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_015703597.1|1335881_1338572_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.0e-25
WP_015369524.1|1338596_1340084_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_015703598.1|1340111_1340564_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_015369521.1|1341153_1342497_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	1.2e-62
>prophage 94
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1346587	1349712	5241093	protease	Pandoravirus(50.0%)	2	NA	NA
WP_047044714.1|1346587_1347436_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.1	3.0e-19
WP_015369514.1|1347777_1349712_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	5.4e-117
>prophage 95
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1356306	1357746	5241093		Indivirus(50.0%)	2	NA	NA
WP_045394958.1|1356306_1357278_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	5.4e-09
WP_015369506.1|1357473_1357746_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	66.7	8.3e-16
>prophage 96
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1361803	1374676	5241093		Bacillus_virus(16.67%)	15	NA	NA
WP_015369499.1|1361803_1362616_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.9	4.8e-19
WP_047044703.1|1362822_1363800_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_162184074.1|1363796_1364801_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	1.8e-39
WP_015369496.1|1364815_1365382_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.1	3.1e-57
WP_047044700.1|1365378_1365954_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_015369494.1|1365922_1366468_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004206203.1|1366474_1367200_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_047044697.1|1367247_1368681_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004125711.1|1368703_1368991_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_015369492.1|1369049_1369538_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_015369491.1|1369583_1370438_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_002918431.1|1370434_1370707_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_045394973.1|1370729_1371455_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_045394975.1|1371451_1372105_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_045394977.1|1372339_1374676_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.3e-40
>prophage 97
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1383161	1383659	5241093	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_045394985.1|1383161_1383659_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	6.6e-27
>prophage 98
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1387587	1388955	5241093	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_045394989.1|1387587_1388955_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.2	4.3e-20
>prophage 99
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1396667	1397936	5241093		Oenococcus_phage(100.0%)	1	NA	NA
WP_047047149.1|1396667_1397936_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.3	3.7e-58
>prophage 100
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1416207	1417251	5241093		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|1416207_1417251_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 101
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1441564	1443154	5241093		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_045397317.1|1441564_1443154_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	1.2e-69
>prophage 102
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1448564	1450328	5241093		Bacillus_phage(50.0%)	3	NA	NA
WP_002884342.1|1448564_1448837_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_045397326.1|1449023_1449614_-	YjaG family protein	NA	NA	NA	NA	NA
WP_045413593.1|1449656_1450328_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	8.0e-20
>prophage 103
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1458889	1471333	5241093		Bacillus_phage(33.33%)	6	NA	NA
WP_047047091.1|1458889_1460422_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.5	1.8e-11
WP_045397351.1|1460597_1460903_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_045397355.1|1460906_1461224_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_045397357.1|1461266_1462607_-	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_045397360.1|1463004_1467228_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	6.5e-67
WP_015704004.1|1467304_1471333_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 104
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1475392	1478515	5241093		Tupanvirus(50.0%)	2	NA	NA
WP_015368828.1|1475392_1476577_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.0e-13
WP_045422237.1|1477558_1478515_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.8e-28
>prophage 105
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1487492	1489340	5241093		Acinetobacter_phage(100.0%)	1	NA	NA
WP_015368904.1|1487492_1489340_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.2	4.2e-10
>prophage 106
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1503966	1506675	5241093		Cyanophage(50.0%)	3	NA	NA
WP_004203684.1|1503966_1504629_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	33.5	3.0e-27
WP_047047243.1|1504683_1505787_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_045395317.1|1505925_1506675_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.9	1.1e-22
>prophage 107
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1512342	1514355	5241093		Vibrio_phage(100.0%)	1	NA	NA
WP_047047228.1|1512342_1514355_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.0	3.3e-08
>prophage 108
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1529189	1530524	5241093		Erwinia_phage(100.0%)	1	NA	NA
WP_045395296.1|1529189_1530524_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.1	9.3e-44
>prophage 109
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1535767	1539266	5241093		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_015368937.1|1535767_1536466_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_015368938.1|1536462_1537836_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_047045444.1|1537898_1538573_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_015368940.1|1538645_1539266_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.2e-62
>prophage 110
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1560743	1561661	5241093		Tupanvirus(100.0%)	1	NA	NA
WP_047045478.1|1560743_1561661_+	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	53.8	4.8e-07
>prophage 111
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1571761	1574229	5241093		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_015368972.1|1571761_1572811_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	4.5e-09
WP_015368973.1|1572819_1574229_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	29.1	3.7e-06
>prophage 112
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1577913	1580694	5241093		uncultured_virus(100.0%)	1	NA	NA
WP_045395250.1|1577913_1580694_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	9.9e-72
>prophage 113
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1593233	1593848	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_047045735.1|1593233_1593848_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.3	1.8e-18
>prophage 114
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1602566	1608797	5241093		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_015368842.1|1602566_1603340_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.2	7.3e-25
WP_045395609.1|1603343_1603880_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_015368844.1|1603883_1604135_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_047045717.1|1604266_1605907_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.3	5.0e-39
WP_045395607.1|1605903_1606509_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_045395605.1|1606522_1607278_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_047045713.1|1607348_1608797_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
>prophage 115
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1617877	1621342	5241093	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_047045699.1|1617877_1618786_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	1.0e-65
WP_045395590.1|1618833_1619454_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_015368858.1|1619515_1621342_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.6e-83
>prophage 116
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1625236	1629081	5241093		Bacillus_phage(50.0%)	3	NA	NA
WP_032709535.1|1625236_1627399_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	4.6e-117
WP_047045695.1|1627462_1628179_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_045395583.1|1628178_1629081_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	3.8e-17
>prophage 117
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1645436	1651577	5241093		uncultured_marine_virus(20.0%)	6	NA	NA
WP_045395563.1|1645436_1646567_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	39.4	4.8e-17
WP_047045688.1|1646571_1647246_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_015368880.1|1647223_1648105_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.4e-109
WP_047045685.1|1648123_1649191_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	9.6e-100
WP_045395557.1|1649187_1650450_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.7	1.1e-22
WP_072048022.1|1650446_1651577_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.6	4.1e-24
>prophage 118
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1655628	1657567	5241093		Indivirus(50.0%)	2	NA	NA
WP_002883224.1|1655628_1655958_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
WP_015368886.1|1656301_1657567_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	2.4e-41
>prophage 119
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1662043	1664065	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_015368891.1|1662043_1664065_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	8.4e-113
>prophage 120
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1672069	1673716	5241093		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_047045664.1|1672069_1673716_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.2	3.1e-65
>prophage 121
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1687293	1693173	5241093		Enterobacteria_phage(33.33%)	5	NA	NA
WP_045396020.1|1687293_1688184_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	7.4e-05
WP_015368991.1|1688211_1689177_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_015368992.1|1689182_1690688_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.7	6.2e-20
WP_045396015.1|1690698_1691118_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_045396012.1|1691304_1693173_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.9e-67
>prophage 122
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1696338	1697331	5241093		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_047044566.1|1696338_1697331_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	2.5e-49
>prophage 123
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1712710	1721930	5241093		Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
WP_045396006.1|1712710_1714081_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	3.6e-35
WP_015703916.1|1714266_1716096_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.1	6.6e-125
WP_047044582.1|1716327_1717293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045396002.1|1717289_1717868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015369012.1|1718094_1719135_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.3	5.7e-49
WP_045396000.1|1719260_1720220_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_045395998.1|1720219_1721110_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_015369015.1|1721156_1721930_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.7	1.3e-13
>prophage 124
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1727700	1729038	5241093		Moraxella_phage(100.0%)	1	NA	NA
WP_072206473.1|1727700_1729038_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.4e-63
>prophage 125
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1736044	1743630	5241093		Staphylococcus_phage(33.33%)	7	NA	NA
WP_015703903.1|1736044_1736302_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	5.4e-17
WP_015703902.1|1736265_1736625_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_015369029.1|1736640_1736781_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_015703901.1|1737400_1738801_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_045378110.1|1738805_1739906_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	3.1e-53
WP_045378107.1|1740113_1741187_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_032706564.1|1741215_1743630_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	2.4e-114
>prophage 126
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1749504	1750653	5241093		Oenococcus_phage(100.0%)	1	NA	NA
WP_016946147.1|1749504_1750653_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	3.6e-52
>prophage 127
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1754075	1755034	5241093		Synechococcus_phage(100.0%)	2	NA	NA
WP_015703892.1|1754075_1754489_+	heat shock chaperone IbpA	NA	M1UG22	Synechococcus_phage	38.3	4.6e-18
WP_015369047.1|1754605_1755034_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.5e-14
>prophage 128
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1767701	1773058	5241093		Salmonella_phage(50.0%)	6	NA	NA
WP_047044642.1|1767701_1768886_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.0	7.5e-13
WP_047044645.1|1769061_1769895_-	EamA family transporter	NA	NA	NA	NA	NA
WP_047044648.1|1769962_1770409_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004145059.1|1770498_1770618_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_016162016.1|1771169_1771265_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_047044651.1|1771369_1773058_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	32.0	1.3e-58
>prophage 129
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1786453	1787566	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047044677.1|1786453_1787566_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	2.5e-26
>prophage 130
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1814721	1815771	5241093		Tupanvirus(100.0%)	1	NA	NA
WP_047047612.1|1814721_1815771_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	1.7e-72
>prophage 131
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1819217	1820255	5241093		Wolbachia_phage(100.0%)	1	NA	NA
WP_047047620.1|1819217_1820255_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.1	5.5e-68
>prophage 132
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1833099	1834491	5241093		environmental_Halophage(100.0%)	1	NA	NA
WP_015369129.1|1833099_1834491_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	94.5	3.1e-66
>prophage 133
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1837628	1838477	5241093		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_015369132.1|1837628_1838477_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.8	1.7e-14
>prophage 134
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1849572	1854597	5241093		Bordetella_phage(33.33%)	4	NA	NA
WP_015369143.1|1849572_1851693_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1851711_1851987_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_015369144.1|1852041_1852665_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.8e-19
WP_047047647.1|1852923_1854597_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	24.1	4.2e-25
>prophage 135
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1858745	1863425	5241093		Xanthomonas_phage(25.0%)	7	NA	NA
WP_020077682.1|1858745_1859204_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	2.1e-48
WP_064572224.1|1859181_1860396_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.2	2.4e-46
WP_045390599.1|1860570_1861236_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002436699.1|1861453_1861690_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002922510.1|1861710_1861878_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_015369156.1|1862057_1862867_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.1	1.0e-24
WP_015703808.1|1862945_1863425_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 136
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1871052	1871694	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_045386549.1|1871052_1871694_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	44.2	2.0e-44
>prophage 137
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1875907	1879284	5241093		Prochlorococcus_phage(33.33%)	3	NA	NA
WP_045390625.1|1875907_1876840_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	35.7	1.5e-35
WP_015703795.1|1877052_1878246_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.2e-37
WP_015369171.1|1878258_1879284_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
>prophage 138
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1885711	1885963	5241093		Rhizobium_phage(100.0%)	1	NA	NA
WP_015369179.1|1885711_1885963_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 139
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1902041	1903898	5241093		Tupanvirus(100.0%)	1	NA	NA
WP_045390675.1|1902041_1903898_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	9.1e-13
>prophage 140
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1926063	1927605	5241093		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045390714.1|1926063_1927605_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.0e-17
>prophage 141
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1932965	1933961	5241093		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_047047740.1|1932965_1933961_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	1.7e-10
>prophage 142
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1937805	1940179	5241093		Hokovirus(50.0%)	3	NA	NA
WP_047047746.1|1937805_1939425_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	24.6	5.8e-16
WP_072058237.1|1939511_1939916_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_000014594.1|1939966_1940179_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 143
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1949676	1952007	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_047047766.1|1949676_1952007_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.7	8.6e-69
>prophage 144
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	1962122	1964116	5241093		Planktothrix_phage(50.0%)	2	NA	NA
WP_045390786.1|1962122_1963106_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	1.8e-15
WP_047047786.1|1963102_1964116_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
>prophage 145
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2001986	2004029	5241093		Indivirus(100.0%)	1	NA	NA
WP_045397157.1|2001986_2004029_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.5	1.9e-43
>prophage 146
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2013483	2014275	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047047848.1|2013483_2014275_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.3	3.7e-16
>prophage 147
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2020352	2024459	5241093		Tupanvirus(66.67%)	3	NA	NA
WP_045397116.1|2020352_2021492_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.0	4.2e-29
WP_045397114.1|2021493_2022477_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
WP_047047860.1|2022473_2024459_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	9.7e-21
>prophage 148
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2045563	2050401	5241093		Dickeya_phage(50.0%)	4	NA	NA
WP_045375765.1|2045563_2046229_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.8e-57
WP_015703711.1|2046436_2046682_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	3.9e-09
WP_047047912.1|2047488_2049696_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.8	4.0e-116
WP_015369312.1|2049774_2050401_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	2.5e-31
>prophage 149
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2053528	2056355	5241093		Staphylococcus_phage(50.0%)	3	NA	NA
WP_015369317.1|2053528_2054197_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.5e-13
WP_015369318.1|2054189_2055245_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002920815.1|2055500_2056355_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
>prophage 150
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2062258	2064507	5241093		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
WP_015369325.1|2062258_2063026_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.0	2.2e-13
WP_086538103.1|2063043_2063757_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	1.1e-11
WP_004174006.1|2063920_2064142_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_047047927.1|2064138_2064507_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	28.5	3.0e-08
>prophage 151
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2067952	2069760	5241093		Planktothrix_phage(50.0%)	2	NA	NA
WP_047047932.1|2067952_2069023_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
WP_020077771.1|2069019_2069760_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.7	2.2e-10
>prophage 152
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2087690	2090138	5241093		Dickeya_phage(100.0%)	1	NA	NA
WP_047047942.1|2087690_2090138_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 153
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2093180	2093939	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_015369351.1|2093180_2093939_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.0	1.4e-23
>prophage 154
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2097272	2099663	5241093		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_047047945.1|2097272_2099663_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	2.1e-14
>prophage 155
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2120128	2124047	5241093		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|2120128_2120848_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_015369373.1|2120844_2122206_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.3	5.6e-12
WP_045375850.1|2122427_2124047_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.7	6.9e-142
>prophage 156
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2140646	2141474	5241093		Vibrio_phage(100.0%)	1	NA	NA
WP_045394863.1|2140646_2141474_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.7	3.2e-71
>prophage 157
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2152839	2162529	5241093		Acinetobacter_phage(25.0%)	9	NA	NA
WP_047048025.1|2152839_2153403_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.8	2.0e-56
WP_047048027.1|2153492_2154713_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_047048030.1|2154702_2156781_-	membrane protein	NA	H9YQA8	environmental_Halophage	87.7	2.2e-63
WP_000242758.1|2156831_2157464_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_015703648.1|2157768_2158173_+	OsmC family protein	NA	NA	NA	NA	NA
WP_015369404.1|2158235_2159105_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_015369405.1|2159177_2159396_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	8.9e-05
WP_047048033.1|2159392_2160415_-	hydrolase	NA	NA	NA	NA	NA
WP_047048035.1|2160624_2162529_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	4.2e-74
>prophage 158
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2170364	2173733	5241093		Streptococcus_phage(50.0%)	2	NA	NA
WP_045375915.1|2170364_2172479_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	2.3e-57
WP_015369418.1|2172548_2173733_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 159
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2193624	2195096	5241093	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_047047075.1|2193624_2194572_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	4.9e-07
WP_045397945.1|2194586_2195096_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.7	7.4e-18
>prophage 160
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2212544	2216228	5241093		Dickeya_phage(100.0%)	1	NA	NA
WP_047045827.1|2212544_2216228_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	91.8	1.7e-26
>prophage 161
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2235118	2236228	5241093		Mycoplasma_phage(100.0%)	1	NA	NA
WP_015368770.1|2235118_2236228_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 162
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2243345	2243954	5241093		Lactococcus_phage(100.0%)	1	NA	NA
WP_015704040.1|2243345_2243954_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	6.0e-14
>prophage 163
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2249648	2252175	5241093		Escherichia_phage(50.0%)	2	NA	NA
WP_015368755.1|2249648_2251064_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_047045858.1|2251095_2252175_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	7.6e-28
>prophage 164
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2256298	2261563	5241093		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_045396741.1|2256298_2259124_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	0.0e+00
WP_015368746.1|2259378_2259903_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.3e-54
WP_047045871.1|2259982_2261563_-	lytic transglycosylase F	NA	A0A1P8CWQ1	Bacillus_phage	40.2	6.7e-09
>prophage 165
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2267044	2268394	5241093		Moraxella_phage(100.0%)	1	NA	NA
WP_015704058.1|2267044_2268394_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	7.5e-158
>prophage 166
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2281084	2288107	5241093		Staphylococcus_phage(50.0%)	4	NA	NA
WP_045398142.1|2281084_2283043_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.8	2.5e-90
WP_047047489.1|2283457_2284768_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_026612428.1|2284803_2285487_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598920.1|2285959_2288107_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	3.5e-32
>prophage 167
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2291111	2292632	5241093		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_045367893.1|2291111_2292632_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	3.8e-09
>prophage 168
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2298022	2299569	5241093		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_045396513.1|2298022_2298703_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
WP_047046370.1|2298810_2299569_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	3.7e-13
>prophage 169
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2304976	2306479	5241093		Burkholderia_virus(100.0%)	1	NA	NA
WP_020079848.1|2304976_2306479_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	2.2e-57
>prophage 170
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2310842	2317161	5241093		Escherichia_phage(40.0%)	8	NA	NA
WP_015368687.1|2310842_2311799_+	plasmid stability protein StbA	NA	A0A222YXF2	Escherichia_phage	78.9	5.1e-145
WP_015704087.1|2311808_2312180_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	52.0	1.1e-21
WP_047046357.1|2312281_2312587_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_047046356.1|2312586_2313504_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	2.1e-07
WP_047046353.1|2313645_2314329_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	39.9	1.2e-31
WP_015704089.1|2314549_2315341_+	DsbA family protein	NA	NA	NA	NA	NA
WP_047046349.1|2315398_2315833_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_047046346.1|2315829_2317161_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	35.9	5.9e-06
>prophage 171
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2335340	2340839	5241093		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|2335340_2335634_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_015368665.1|2335671_2337318_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	2.6e-189
WP_015368664.1|2337445_2337799_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_047046324.1|2337841_2338705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047046322.1|2338715_2340839_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.0	2.9e-31
>prophage 172
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2351950	2357143	5241093		Morganella_phage(33.33%)	6	NA	NA
WP_047046300.1|2351950_2352481_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.9e-42
WP_015368650.1|2352594_2352954_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_045396402.1|2352964_2353360_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_045362546.1|2353370_2354105_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_032713498.1|2354097_2355888_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.5	1.1e-15
WP_045380118.1|2356165_2357143_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.5e-27
>prophage 173
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2364511	2365057	5241093		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_015704162.1|2364511_2365057_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	3.4e-29
>prophage 174
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2369897	2373129	5241093		Vibrio_phage(50.0%)	2	NA	NA
WP_032715470.1|2369897_2371250_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	2.0e-17
WP_047046285.1|2371260_2373129_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	2.2e-59
>prophage 175
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2378654	2383071	5241093		Pithovirus(50.0%)	3	NA	NA
WP_045396875.1|2378654_2379953_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.3e-66
WP_045379682.1|2380103_2380538_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_045396877.1|2380629_2383071_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.0	1.3e-67
>prophage 176
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2421697	2428257	5241093		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_015368588.1|2421697_2422228_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.2e-56
WP_047046248.1|2422632_2423589_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045394681.1|2423692_2425195_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	9.9e-10
WP_047046244.1|2425205_2426231_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_015368584.1|2426217_2427216_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_015368583.1|2427258_2428257_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	7.4e-70
>prophage 177
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2442488	2445913	5241093		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_047046230.1|2442488_2442773_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.8	5.8e-28
WP_045386772.1|2442776_2443241_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	2.5e-52
WP_032713553.1|2443774_2445913_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.9	7.2e-264
>prophage 178
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2453672	2457710	5241093		Enterobacteria_phage(50.0%)	2	NA	NA
WP_045394704.1|2453672_2454620_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.3	3.0e-12
WP_045394705.1|2455001_2457710_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.2	2.0e-45
>prophage 179
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2461254	2462190	5241093		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_047046213.1|2461254_2462190_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	1.3e-52
>prophage 180
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2467602	2476749	5241093	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_045394712.1|2467602_2470458_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	1.2e-141
WP_047046203.1|2470457_2470901_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_008807121.1|2471022_2472534_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	7.1e-48
WP_045394713.1|2472924_2474022_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_045394714.1|2474021_2475104_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_047046200.1|2475246_2476749_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	6.7e-83
>prophage 181
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2491771	2496597	5241093		Planktothrix_phage(50.0%)	5	NA	NA
WP_042894203.1|2491771_2492845_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	3.6e-22
WP_042894202.1|2492850_2493675_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_047046177.1|2493685_2494573_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015368525.1|2494562_2495435_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015368523.1|2495577_2496597_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	7.9e-43
>prophage 182
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2512228	2514211	5241093		Acidithiobacillus_phage(100.0%)	1	NA	NA
WP_047046149.1|2512228_2514211_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	41.2	1.3e-30
>prophage 183
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2518800	2521161	5241093		Liberibacter_phage(100.0%)	1	NA	NA
WP_047046390.1|2518800_2521161_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.0	8.8e-29
>prophage 184
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2533959	2537109	5241093		Leptospira_phage(100.0%)	1	NA	NA
WP_047046113.1|2533959_2537109_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.3	3.1e-61
>prophage 185
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2540348	2542464	5241093		Bacillus_phage(50.0%)	2	NA	NA
WP_047046104.1|2540348_2541032_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	3.9e-30
WP_045394791.1|2541021_2542464_+	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.0	7.0e-13
>prophage 186
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2552419	2558007	5241093		Staphylococcus_phage(50.0%)	3	NA	NA
WP_047043806.1|2552419_2555179_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.6e-21
WP_045395428.1|2555175_2556240_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045395430.1|2556612_2558007_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.1	4.4e-20
>prophage 187
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2564700	2568087	5241093	holin	Serratia_phage(100.0%)	1	NA	NA
WP_045395446.1|2564700_2568087_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 188
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2574014	2574599	5241093		Moraxella_phage(100.0%)	1	NA	NA
WP_015704263.1|2574014_2574599_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	2.4e-12
>prophage 189
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2596299	2597250	5241093	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_047043836.1|2596299_2597250_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.0	1.3e-71
>prophage 190
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2635763	2637043	5241093		Shigella_phage(50.0%)	2	NA	NA
WP_026612409.1|2635763_2636501_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	52.1	4.0e-65
WP_047043888.1|2636503_2637043_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	59.6	1.2e-26
>prophage 191
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2650230	2652934	5241093		Streptococcus_phage(50.0%)	3	NA	NA
WP_047043896.1|2650230_2651820_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.2	1.1e-30
WP_020079668.1|2652037_2652649_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_015368384.1|2652772_2652934_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	5.0e-13
>prophage 192
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2656242	2657565	5241093		Geobacillus_virus(100.0%)	1	NA	NA
WP_045395933.1|2656242_2657565_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	8.8e-79
>prophage 193
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2664039	2669190	5241093		Enterococcus_phage(33.33%)	3	NA	NA
WP_045395907.1|2664039_2665272_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	6.3e-87
WP_023291900.1|2665365_2667033_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.9e-41
WP_047043908.1|2667252_2669190_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 194
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2673116	2674541	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047043913.1|2673116_2674541_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	29.6	5.3e-21
>prophage 195
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2686111	2687065	5241093		Synechococcus_phage(100.0%)	1	NA	NA
WP_045395864.1|2686111_2687065_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	1.3e-10
>prophage 196
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2690231	2698516	5241093		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_045395850.1|2690231_2692148_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	8.4e-147
WP_020079653.1|2692235_2693378_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.7	1.2e-28
WP_047043928.1|2693546_2694491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047043930.1|2694616_2694961_+	phage protein	NA	NA	NA	NA	NA
WP_047043932.1|2695021_2695555_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	3.0e-54
WP_047043934.1|2695570_2696014_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_047043936.1|2696404_2698516_+	chitinase	NA	A0A0N7D5A5	Dasychira_pudibunda_nucleopolyhedrovirus	29.4	1.4e-33
>prophage 197
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2711000	2717618	5241093	tRNA	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_047043958.1|2711000_2712176_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	9.2e-88
WP_045395806.1|2712226_2713126_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001518655.1|2713223_2713487_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_045378895.1|2713817_2714756_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_047043960.1|2714801_2717618_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.4	3.5e-77
>prophage 198
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2744162	2745311	5241093		Halovirus(100.0%)	1	NA	NA
WP_015368301.1|2744162_2745311_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	5.4e-48
>prophage 199
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2754838	2756292	5241093		Bacillus_phage(50.0%)	2	NA	NA
WP_015368294.1|2754838_2755318_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	41.5	2.3e-29
WP_015368293.1|2755443_2756292_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	50.7	6.8e-08
>prophage 200
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2768972	2774368	5241093		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_045376408.1|2768972_2771879_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
WP_047047446.1|2772010_2774368_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	1.0e-05
>prophage 201
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2780911	2781613	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047042721.1|2780911_2781613_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.7	1.5e-21
>prophage 202
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2790218	2790974	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_047042706.1|2790218_2790974_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	4.2e-25
>prophage 203
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2802331	2804056	5241093		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_032706640.1|2802331_2804056_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.5	1.2e-35
>prophage 204
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2830274	2831318	5241093		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_047042678.1|2830274_2831318_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	1.2e-102
>prophage 205
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2835582	2836146	5241093		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_047042669.1|2835582_2836146_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	34.6	5.5e-14
>prophage 206
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2847412	2848837	5241093		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_015368220.1|2847412_2848837_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	1.6e-41
>prophage 207
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2859630	2866314	5241093		Mamastrovirus(33.33%)	6	NA	NA
WP_047042648.1|2859630_2861232_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	53.3	1.1e-22
WP_045390074.1|2861307_2863698_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_161801955.1|2863776_2863881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015368206.1|2863900_2864437_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
WP_045390077.1|2864494_2865157_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_015368204.1|2865387_2866314_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.9	8.2e-23
>prophage 208
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2871703	2873101	5241093		unidentified_phage(100.0%)	1	NA	NA
WP_072058187.1|2871703_2873101_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.4	1.6e-25
>prophage 209
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2876106	2878536	5241093		Niemeyer_virus(100.0%)	1	NA	NA
WP_047042630.1|2876106_2878536_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	32.2	3.9e-40
>prophage 210
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2883957	2884755	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_045390112.1|2883957_2884755_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.1e-14
>prophage 211
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2890894	2891239	5241093		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_008807363.1|2890894_2891239_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	7.0e-28
>prophage 212
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2895209	2901001	5241093	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_045390127.1|2895209_2896643_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	3.9e-24
WP_045390129.1|2896818_2897976_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047046981.1|2898013_2901001_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.1	8.5e-37
>prophage 213
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2911347	2912109	5241093		Flavobacterium_phage(100.0%)	1	NA	NA
WP_045390181.1|2911347_2912109_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.6e-24
>prophage 214
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2920926	2925026	5241093		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_015368153.1|2920926_2921526_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	5.5e-28
WP_045390151.1|2921543_2925026_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.6	1.8e-208
>prophage 215
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2939005	2940037	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_045390179.1|2939005_2940037_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.4	8.8e-34
>prophage 216
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2946849	2947653	5241093		Indivirus(100.0%)	1	NA	NA
WP_047047176.1|2946849_2947653_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	7.6e-41
>prophage 217
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2951712	2968279	5241093		Lactobacillus_phage(25.0%)	7	NA	NA
WP_045397918.1|2951712_2953080_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	5.3e-10
WP_045397916.1|2953151_2953907_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_047047163.1|2953940_2954663_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015368126.1|2954659_2955127_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	57.4	5.2e-50
WP_020079566.1|2955182_2955923_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.5e-38
WP_047047158.1|2956609_2958271_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_088389816.1|2958283_2968279_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.9	6.3e-28
>prophage 218
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	2975282	2975864	5241093		Caulobacter_phage(100.0%)	1	NA	NA
WP_165430624.1|2975282_2975864_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	6.3e-13
>prophage 219
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3011416	3012700	5241093		Klosneuvirus(100.0%)	1	NA	NA
WP_045391082.1|3011416_3012700_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.5	9.3e-33
>prophage 220
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3025176	3035462	5241093	transposase	Erwinia_phage(50.0%)	12	NA	NA
WP_047046048.1|3025176_3025527_-	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	40.0	2.5e-09
WP_047046046.1|3025520_3025967_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	38.0	6.3e-21
WP_047046043.1|3026247_3026886_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032712691.1|3026994_3027309_-	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	66.7	9.5e-32
WP_032712692.1|3027311_3027749_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	56.2	1.9e-38
WP_088389818.1|3028033_3029133_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	8.2e-46
WP_015704508.1|3029371_3029698_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_015704509.1|3029691_3030156_-	membrane protein	NA	A0A218M4J4	Erwinia_phage	33.3	4.9e-08
WP_047046033.1|3031122_3032376_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	1.1e-91
WP_015368077.1|3032386_3033490_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.7	9.7e-63
WP_015368078.1|3033778_3034831_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.0	5.1e-114
WP_032707509.1|3034895_3035462_-	lipoprotein nlpC	NA	S5MM68	Bacillus_phage	38.9	2.2e-10
>prophage 221
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3040985	3041828	5241093		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_045391032.1|3040985_3041828_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	8.3e-14
>prophage 222
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3054249	3055068	5241093		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_045391007.1|3054249_3055068_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.9	2.9e-16
>prophage 223
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3060131	3060899	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_045380937.1|3060131_3060899_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.7	2.3e-26
>prophage 224
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3081309	3089829	5241093		Bacillus_phage(60.0%)	6	NA	NA
WP_047044545.1|3081309_3082221_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
WP_047044544.1|3082312_3083218_+	fructokinase	NA	NA	NA	NA	NA
WP_047044541.1|3083269_3086404_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	1.9e-10
WP_047044538.1|3086400_3087603_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	24.8	1.1e-08
WP_004099401.1|3087822_3088512_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_045390952.1|3088533_3089829_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.3	2.9e-26
>prophage 225
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3102243	3106582	5241093	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_015368001.1|3102243_3103371_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_003859109.1|3103393_3103726_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_015704558.1|3103752_3105600_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_015367999.1|3105610_3106582_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.7	4.7e-45
>prophage 226
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3110178	3114836	5241093		Indivirus(33.33%)	6	NA	NA
WP_045390921.1|3110178_3111282_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.9	1.3e-51
WP_001021161.1|3111368_3111839_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_015367993.1|3111859_3112279_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047044520.1|3112352_3113330_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_071647558.1|3113316_3113823_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_047044517.1|3113861_3114836_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	22.4	1.1e-06
>prophage 227
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3123068	3128595	5241093		Moraxella_phage(66.67%)	4	NA	NA
WP_047044502.1|3123068_3125729_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.4	2.5e-24
WP_047044499.1|3125787_3127434_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	21.2	2.8e-13
WP_088389819.1|3127452_3127821_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
WP_088389820.1|3127839_3128595_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.7	1.4e-12
>prophage 228
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3135476	3136193	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047044478.1|3135476_3136193_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	5.6e-19
>prophage 229
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3155046	3160096	5241093	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|3155046_3155670_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_015704591.1|3155804_3157079_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	1.9e-131
WP_015367948.1|3157262_3159617_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	2.1e-224
WP_002444653.1|3159823_3160096_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 230
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3164234	3164945	5241093		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020079468.1|3164234_3164945_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.5e-88
>prophage 231
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3169352	3172893	5241093		Bacillus_phage(100.0%)	2	NA	NA
WP_047047026.1|3169352_3171122_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.2e-48
WP_045393576.1|3171114_3172893_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	1.2e-41
>prophage 232
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3186672	3188127	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_047047053.1|3186672_3188127_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	6.4e-14
>prophage 233
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3200461	3205999	5241093		Klosneuvirus(33.33%)	5	NA	NA
WP_015367908.1|3200461_3201013_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_045393520.1|3201105_3203016_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	39.5	7.8e-44
WP_008805448.1|3203072_3203405_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_015367906.1|3203404_3204010_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_045393519.1|3204124_3205999_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	2.7e-113
>prophage 234
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3216230	3221434	5241093		uncultured_virus(50.0%)	5	NA	NA
WP_047049497.1|3216230_3218732_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.7	1.1e-114
WP_045393501.1|3218837_3219248_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_045393498.1|3219244_3219703_-	NfeD family protein	NA	NA	NA	NA	NA
WP_020079443.1|3219699_3220617_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_045393492.1|3220756_3221434_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	29.8	4.2e-16
>prophage 235
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3224600	3225287	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_047049495.1|3224600_3225287_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	3.8e-33
>prophage 236
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3233939	3238203	5241093	tRNA	Moumouvirus(50.0%)	5	NA	NA
WP_045393462.1|3233939_3235325_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	4.6e-46
WP_047049481.1|3235370_3236201_-	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_047049479.1|3236197_3236629_-	STM0539 family protein	NA	NA	NA	NA	NA
WP_015367876.1|3237122_3237335_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_015367875.1|3237336_3238203_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	5.0e-30
>prophage 237
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3241872	3243180	5241093		Burkholderia_virus(100.0%)	1	NA	NA
WP_047049470.1|3241872_3243180_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.8	1.8e-60
>prophage 238
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3246500	3248545	5241093		Mycobacterium_phage(50.0%)	2	NA	NA
WP_045393439.1|3246500_3247337_+	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	6.3e-14
WP_045393436.1|3247624_3248545_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.2	5.6e-56
>prophage 239
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3255866	3259191	5241093	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_045393424.1|3255866_3257342_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.8	1.1e-48
WP_015704650.1|3257673_3259191_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	7.2e-85
>prophage 240
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3282937	3284835	5241093		Tupanvirus(33.33%)	3	NA	NA
WP_047049433.1|3282937_3284053_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.4	4.4e-39
WP_045393363.1|3284169_3284472_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	45.6	5.7e-18
WP_045393595.1|3284475_3284835_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	89.8	3.4e-57
>prophage 241
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3307113	3309837	5241093		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_165430630.1|3307113_3309837_+	cation-transporting P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	26.8	2.5e-67
>prophage 242
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3312925	3321348	5241093	holin	Catovirus(33.33%)	5	NA	NA
WP_047049399.1|3312925_3314590_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	4.0e-60
WP_042893339.1|3314604_3316077_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_045392822.1|3316088_3316682_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_015704693.1|3316810_3318844_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	7.6e-21
WP_047049509.1|3319092_3321348_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.5	2.3e-26
>prophage 243
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3327042	3328587	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047049387.1|3327042_3328587_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	9.5e-16
>prophage 244
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3339469	3344224	5241093		Tupanvirus(50.0%)	2	NA	NA
WP_047049374.1|3339469_3343351_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	7.1e-60
WP_047049372.1|3343429_3344224_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.1	2.9e-08
>prophage 245
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3347629	3349762	5241093		Dasychira_pudibunda_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_047049363.1|3347629_3349762_-	chitinase	NA	A0A0N7D5A5	Dasychira_pudibunda_nucleopolyhedrovirus	28.1	1.9e-30
>prophage 246
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3359949	3361452	5241093		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047049341.1|3359949_3361452_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.4e-16
>prophage 247
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3369066	3370901	5241093		uncultured_marine_virus(50.0%)	2	NA	NA
WP_045392928.1|3369066_3369693_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	46.7	1.5e-49
WP_047049317.1|3369677_3370901_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.6	1.1e-59
>prophage 248
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3373995	3376076	5241093		Bacillus_virus(50.0%)	2	NA	NA
WP_045392939.1|3373995_3375561_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	4.9e-44
WP_015367746.1|3375647_3376076_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	8.7e-20
>prophage 249
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3380180	3381709	5241093		Morganella_phage(33.33%)	3	NA	NA
WP_012542460.1|3380180_3380390_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
WP_045381622.1|3380447_3380831_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	1.5e-23
WP_047049305.1|3380920_3381709_+	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	23.4	7.5e-09
>prophage 250
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3385616	3388101	5241093		Stx2-converting_phage(50.0%)	2	NA	NA
WP_015367735.1|3385616_3386816_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
WP_047049296.1|3386958_3388101_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 251
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3395123	3403032	5241093	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_015704739.1|3395123_3397706_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.4e-184
WP_045393055.1|3397932_3398415_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_047049278.1|3398459_3400253_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.7	1.6e-27
WP_047049275.1|3400292_3401966_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_015367722.1|3402306_3403032_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	2.7e-29
>prophage 252
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3409004	3410051	5241093		Pseudomonas_phage(100.0%)	1	NA	NA
WP_045392978.1|3409004_3410051_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	1.9e-47
>prophage 253
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3414084	3415749	5241093		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_015367711.1|3414084_3415749_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 254
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3420421	3434128	5241093	tRNA	Vibrio_phage(20.0%)	12	NA	NA
WP_047049264.1|3420421_3422374_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	45.9	7.1e-08
WP_045381516.1|3422551_3424219_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.0	0.0e+00
WP_045392987.1|3424653_3426054_+	chitoporin	NA	NA	NA	NA	NA
WP_045392989.1|3426101_3426434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047049261.1|3426486_3427782_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.2	1.2e-59
WP_047049259.1|3427837_3428977_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_047049255.1|3428963_3430367_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	6.0e-09
WP_045393001.1|3430463_3431390_-	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_015367698.1|3431502_3431955_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_015367697.1|3432247_3432778_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_015367696.1|3432927_3433221_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_045393004.1|3433354_3434128_-	esterase	NA	W0LK50	Mycobacterium_phage	39.0	1.3e-08
>prophage 255
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3441014	3448442	5241093		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_045381543.1|3441014_3443063_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	9.3e-27
WP_045393021.1|3443083_3444763_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_020079348.1|3444762_3444852_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_026612372.1|3445162_3445372_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_047049240.1|3445550_3446960_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.2	4.7e-54
WP_047049237.1|3446963_3448442_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.5e-47
>prophage 256
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3454245	3455037	5241093		Kaumoebavirus(100.0%)	1	NA	NA
WP_047049221.1|3454245_3455037_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.8	6.2e-11
>prophage 257
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3479192	3482702	5241093		Vibrio_phage(33.33%)	4	NA	NA
WP_015367656.1|3479192_3479912_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	1.7e-23
WP_047049203.1|3479908_3480847_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	9.5e-27
WP_047049202.1|3480962_3481334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367653.1|3481649_3482702_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 258
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3487065	3493572	5241093		Tupanvirus(33.33%)	7	NA	NA
WP_045364697.1|3487065_3488082_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.6	4.7e-80
WP_047049197.1|3488288_3489764_-	molybdate ABC transporter ATP-binding protein ModF	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	22.8	2.8e-09
WP_047049194.1|3489831_3490620_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_045395091.1|3490770_3490920_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_045395081.1|3491048_3491825_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015367643.1|3491821_3492511_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_045395080.1|3492513_3493572_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	1.4e-18
>prophage 259
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3498237	3500746	5241093		Enterobacteria_phage(50.0%)	4	NA	NA
WP_015704784.1|3498237_3498972_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	3.7e-50
WP_045395089.1|3499025_3499580_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045395075.1|3499608_3499821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047049185.1|3500212_3500746_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	62.1	1.1e-51
>prophage 260
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3509124	3514079	5241093		Catovirus(50.0%)	4	NA	NA
WP_015367622.1|3509124_3510660_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	36.9	1.1e-80
WP_015367620.1|3510759_3512142_+	amino acid permease	NA	NA	NA	NA	NA
WP_015367619.1|3512242_3512719_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_047049505.1|3512789_3514079_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	2.9e-18
>prophage 261
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3524126	3525032	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_045395054.1|3524126_3525032_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.4	2.0e-29
>prophage 262
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3534707	3547702	5241093		Anomala_cuprea_entomopoxvirus(16.67%)	12	NA	NA
WP_045395046.1|3534707_3536447_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	3.3e-17
WP_045395045.1|3536439_3537432_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_045395044.1|3537428_3538106_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_047049137.1|3538365_3539721_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.7	5.9e-46
WP_047049134.1|3539918_3542063_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	7.4e-43
WP_047049130.1|3542113_3543082_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_047049127.1|3543184_3543445_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_047049124.1|3543728_3543995_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	51.1	1.4e-15
WP_047049122.1|3544074_3544752_-	PKHD-type hydroxylase YbiX	NA	A0A127KMW2	Cyanophage	26.6	3.4e-18
WP_047049503.1|3544796_3547085_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_155958909.1|3547152_3547326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072251435.1|3547438_3547702_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	53.1	3.4e-06
>prophage 263
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3551793	3556932	5241093		Planktothrix_phage(33.33%)	6	NA	NA
WP_045395036.1|3551793_3552516_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	40.6	1.2e-34
WP_045364618.1|3552512_3553172_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_015367580.1|3553297_3554044_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_015367579.1|3554434_3554938_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	26.7	4.2e-05
WP_045364611.1|3555176_3556064_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_015367577.1|3556416_3556932_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	5.0e-14
>prophage 264
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3562040	3567964	5241093		Pandoravirus(50.0%)	5	NA	NA
WP_047049103.1|3562040_3563417_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.4	2.1e-22
WP_045395027.1|3563477_3564194_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015367569.1|3564296_3565211_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_047049100.1|3565409_3566192_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_015367567.1|3566371_3567964_+	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	28.8	7.2e-59
>prophage 265
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3576024	3578457	5241093		Citrobacter_phage(100.0%)	1	NA	NA
WP_047049089.1|3576024_3578457_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 266
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3582641	3584495	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_045395007.1|3582641_3584495_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.2	1.2e-12
>prophage 267
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3593335	3595325	5241093		Stx2-converting_phage(50.0%)	2	NA	NA
WP_045396363.1|3593335_3594538_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.9	8.0e-95
WP_047049071.1|3594566_3595325_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	26.8	2.0e-11
>prophage 268
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3604706	3616182	5241093		Bacillus_phage(33.33%)	13	NA	NA
WP_045396328.1|3604706_3604970_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	7.7e-27
WP_045396326.1|3605156_3605447_+	YbjC family protein	NA	NA	NA	NA	NA
WP_047049066.1|3605430_3606153_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_032714148.1|3606219_3607122_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.3	2.6e-34
WP_015367528.1|3607210_3607696_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_032711260.1|3608026_3609139_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_015367526.1|3609262_3610396_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	8.5e-30
WP_015367525.1|3610406_3611360_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_015367524.1|3611356_3612202_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_045396319.1|3612260_3612749_+	YbjO family protein	NA	NA	NA	NA	NA
WP_047049062.1|3612791_3613919_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	24.3	2.1e-20
WP_047049060.1|3613996_3614713_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.9e-37
WP_045396315.1|3614709_3616182_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	7.9e-28
>prophage 269
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3619297	3620026	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_015367515.1|3619297_3620026_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.2e-29
>prophage 270
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3624165	3625008	5241093		Roseobacter_phage(100.0%)	1	NA	NA
WP_045396293.1|3624165_3625008_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.2	1.4e-05
>prophage 271
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3639407	3668604	5241093	protease,tRNA	uncultured_Mediterranean_phage(14.29%)	21	NA	NA
WP_047049037.1|3639407_3641354_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	4.5e-39
WP_015367495.1|3641422_3641644_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	4.6e-17
WP_015367494.1|3641969_3642287_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	9.0e-14
WP_015367493.1|3642317_3644597_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.6e-165
WP_141097056.1|3644616_3645177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040187.1|3645254_3645473_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_045396250.1|3645832_3646537_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_047049032.1|3646579_3648301_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.8	2.0e-14
WP_047049029.1|3648301_3650068_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	A0A2H4UU96	Bodo_saltans_virus	24.6	9.8e-17
WP_045396241.1|3650182_3651151_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	2.1e-61
WP_000228469.1|3651683_3652178_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_059342033.1|3652313_3656213_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.1e-88
WP_015367486.1|3656335_3656947_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_045396235.1|3656955_3658299_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.3	1.1e-81
WP_047049024.1|3658391_3659684_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.2	6.2e-93
WP_047049022.1|3659878_3662317_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	2.8e-219
WP_142688894.1|3662327_3662945_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	1.3e-72
WP_047045580.1|3662946_3663810_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_015367480.1|3664083_3665232_+	MFS transporter	NA	NA	NA	NA	NA
WP_015367479.1|3665389_3666130_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.1e-21
WP_047045583.1|3666321_3668604_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.2e-161
>prophage 272
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3672468	3673557	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_045395743.1|3672468_3673557_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	1.0e-80
>prophage 273
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3677754	3682297	5241093		Bacillus_phage(100.0%)	3	NA	NA
WP_004100704.1|3677754_3678042_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_047045594.1|3678247_3680512_+	ComEC family protein	NA	NA	NA	NA	NA
WP_032707692.1|3680548_3682297_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	8.7e-58
>prophage 274
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3699643	3707974	5241093	tRNA	Enterobacteria_phage(20.0%)	5	NA	NA
WP_047045617.1|3699643_3700723_-	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	52.8	9.7e-100
WP_047045619.1|3701315_3702716_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.4	1.1e-79
WP_047045657.1|3702880_3704083_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	4.9e-44
WP_047045620.1|3704411_3707027_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.7	7.7e-18
WP_047045623.1|3707200_3707974_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
>prophage 275
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3716738	3718646	5241093		Tupanvirus(100.0%)	1	NA	NA
WP_045395648.1|3716738_3718646_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	2.5e-50
>prophage 276
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3731411	3733466	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047045647.1|3731411_3733466_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.3	1.4e-17
>prophage 277
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3737077	3740533	5241093	protease,integrase	uncultured_Caudovirales_phage(50.0%)	3	3734123:3734139	3747947:3747963
3734123:3734139	attL	ACGATATTGCCGGCATT	NA	NA	NA	NA
WP_015704916.1|3737077_3737737_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	6.4e-46
WP_047045655.1|3738002_3739631_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_080941167.1|3740287_3740533_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	64.3	2.7e-18
3747947:3747963	attR	AATGCCGGCAATATCGT	NA	NA	NA	NA
>prophage 278
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3750012	3751413	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047043708.1|3750012_3751413_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.6	4.6e-17
>prophage 279
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3760581	3766356	5241093		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_047043701.1|3760581_3762252_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.9	8.4e-10
WP_047043699.1|3762335_3763946_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	7.1e-14
WP_047043697.1|3763974_3764847_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_047043695.1|3764846_3765896_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	35.2	7.9e-06
WP_015367338.1|3765966_3766356_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.5e-05
>prophage 280
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3778953	3779898	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_046884163.1|3778953_3779898_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	Q9ZXE4	Bacillus_phage	35.6	2.4e-14
>prophage 281
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3792239	3793187	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_047043663.1|3792239_3793187_+	hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.4	1.3e-31
>prophage 282
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3824582	3825611	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047043625.1|3824582_3825611_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.0	2.8e-16
>prophage 283
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3828884	3835620	5241093		Serratia_phage(50.0%)	4	NA	NA
WP_047065408.1|3828884_3831182_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.3e-05
WP_032711368.1|3831391_3831712_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_047043613.1|3831732_3832809_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_165430636.1|3833118_3835620_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	5.1e-11
>prophage 284
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3843848	3845114	5241093		Klosneuvirus(100.0%)	1	NA	NA
WP_045386357.1|3843848_3845114_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	3.5e-24
>prophage 285
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3858286	3861427	5241093		Enterobacteria_phage(100.0%)	4	NA	NA
WP_015367250.1|3858286_3858460_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	7.1e-05
WP_161801900.1|3858665_3859544_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047043581.1|3859588_3860911_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	81.8	6.5e-191
WP_047043578.1|3860932_3861427_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	70.8	7.7e-36
>prophage 286
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3879274	3880339	5241093		Cronobacter_phage(100.0%)	1	NA	NA
WP_072056769.1|3879274_3880339_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	1.5e-92
>prophage 287
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3889286	3889811	5241093		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_045393619.1|3889286_3889811_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	7.4e-29
>prophage 288
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3897532	3898453	5241093		Morganella_phage(100.0%)	1	NA	NA
WP_047046907.1|3897532_3898453_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	1.5e-56
>prophage 289
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3901849	3902095	5241093		Enterobacteria_phage(100.0%)	1	NA	NA
WP_045393647.1|3901849_3902095_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	7.0e-14
>prophage 290
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3921331	3922513	5241093		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_015367190.1|3921331_3922066_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|3922276_3922513_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 291
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3925795	3926437	5241093		Pseudomonas_phage(100.0%)	1	NA	NA
WP_045393687.1|3925795_3926437_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.6	2.2e-27
>prophage 292
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3939696	3939954	5241093		Erwinia_phage(100.0%)	1	NA	NA
WP_045375056.1|3939696_3939954_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	8.1e-05
>prophage 293
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3946285	3950093	5241093		Planktothrix_phage(50.0%)	4	NA	NA
WP_015367168.1|3946285_3946987_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	4.1e-35
WP_047046850.1|3946986_3948231_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_047046847.1|3948336_3949248_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_047046845.1|3949262_3950093_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	6.2e-22
>prophage 294
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3954462	3955599	5241093		Mycoplasma_phage(100.0%)	1	NA	NA
WP_042892246.1|3954462_3955599_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	41.4	1.0e-30
>prophage 295
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3961571	3962942	5241093		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_045393751.1|3961571_3962942_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	5.5e-108
>prophage 296
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3966176	3970276	5241093		Phage_21(50.0%)	5	NA	NA
WP_015705065.1|3966176_3967427_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	2.3e-20
WP_047046967.1|3967621_3967921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015367133.1|3968055_3968403_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_047046820.1|3968437_3969397_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_047046819.1|3969547_3970276_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	7.8e-45
>prophage 297
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3986518	3987604	5241093		Thermus_virus(100.0%)	1	NA	NA
WP_047046791.1|3986518_3987604_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	32.6	7.6e-36
>prophage 298
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	3993209	3999158	5241093		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_047046776.1|3993209_3999158_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	30.7	3.4e-05
>prophage 299
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4006160	4008924	5241093		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_072047995.1|4006160_4007852_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.0	7.2e-25
WP_015367113.1|4007976_4008924_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
>prophage 300
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4012139	4017846	5241093		Pseudomonas_phage(33.33%)	7	NA	NA
WP_015367109.1|4012139_4013222_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_047046764.1|4013221_4014073_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015367107.1|4014069_4014462_+	SirB family protein	NA	NA	NA	NA	NA
WP_045393803.1|4014465_4015278_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_015367105.1|4015317_4016172_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	1.2e-47
WP_015367104.1|4016249_4017350_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_015367102.1|4017615_4017846_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	4.1e-08
>prophage 301
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4023177	4023966	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047078765.1|4023177_4023966_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	4.1e-31
>prophage 302
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4040417	4041953	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_045393813.1|4040417_4041953_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 303
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4045682	4050242	5241093		Synechococcus_phage(33.33%)	5	NA	NA
WP_045397565.1|4045682_4046525_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
WP_161801945.1|4046569_4047040_-	YchJ family protein	NA	NA	NA	NA	NA
WP_165430641.1|4047138_4048038_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_045397559.1|4048127_4049141_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	26.1	4.9e-05
WP_045397556.1|4049339_4050242_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	3.1e-59
>prophage 304
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4057757	4060104	5241093	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_004152342.1|4057757_4059026_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_045397553.1|4059483_4060104_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	6.0e-54
>prophage 305
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4068417	4071315	5241093		Planktothrix_phage(33.33%)	3	NA	NA
WP_047046733.1|4068417_4069431_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	7.6e-14
WP_015367066.1|4069427_4070432_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	6.8e-15
WP_045368707.1|4070448_4071315_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	38.8	9.1e-08
>prophage 306
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4078680	4085847	5241093	tRNA	Tupanvirus(50.0%)	8	NA	NA
WP_045397528.1|4078680_4080609_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	1.0e-128
WP_004189469.1|4080612_4081155_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_001124225.1|4081245_4081443_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004102963.1|4081493_4081850_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|4081973_4082018_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_015367044.1|4082156_4083140_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	3.8e-34
WP_045422920.1|4083155_4085543_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_015367042.1|4085547_4085847_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 307
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4092917	4100891	5241093		Cedratvirus(25.0%)	7	NA	NA
WP_047046710.1|4092917_4093667_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	30.8	2.1e-08
WP_045396070.1|4093748_4094213_+	endopeptidase	NA	NA	NA	NA	NA
WP_047046707.1|4094326_4095769_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.7	5.0e-59
WP_161799839.1|4095797_4095977_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_047046944.1|4096147_4097194_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	48.1	2.7e-83
WP_015367027.1|4097348_4098182_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_015367026.1|4098512_4100891_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.9	1.6e-171
>prophage 308
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4113776	4114997	5241093		Tupanvirus(100.0%)	1	NA	NA
WP_047046684.1|4113776_4114997_+	cysteine desulfurase SufS	NA	A0A2K9L2Y3	Tupanvirus	36.6	1.3e-76
>prophage 309
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4124925	4125675	5241093		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_047046668.1|4124925_4125675_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	30.4	8.1e-05
>prophage 310
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4138724	4142996	5241093		Bacillus_virus(50.0%)	3	NA	NA
WP_047046636.1|4138724_4139501_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.3	1.7e-29
WP_072251462.1|4139596_4141669_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_047046631.1|4142174_4142996_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	3.9e-16
>prophage 311
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4152654	4154161	5241093		Bacillus_phage(50.0%)	2	NA	NA
WP_047046617.1|4152654_4153401_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.7	3.0e-07
WP_047046614.1|4153471_4154161_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.6	8.3e-12
>prophage 312
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4180472	4181543	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047046582.1|4180472_4181543_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.1e-26
>prophage 313
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4203109	4203982	5241093		Lactobacillus_phage(100.0%)	1	NA	NA
WP_045397688.1|4203109_4203982_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.7	1.9e-05
>prophage 314
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4215771	4217741	5241093		Klosneuvirus(50.0%)	2	NA	NA
WP_047046522.1|4215771_4216764_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.4	5.5e-09
WP_047046519.1|4216760_4217741_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	6.7e-15
>prophage 315
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4222731	4231982	5241093		Escherichia_phage(40.0%)	5	NA	NA
WP_045397662.1|4222731_4223502_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	1.5e-14
WP_047046508.1|4223791_4227007_+	molybdopterin-dependent oxidoreductase	NA	A0A0P0IVM8	Acinetobacter_phage	24.7	1.1e-10
WP_015366918.1|4227050_4227509_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	38.5	3.3e-17
WP_165430645.1|4228222_4230370_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	5.3e-33
WP_015366914.1|4230512_4231982_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.5	2.1e-25
>prophage 316
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4258466	4270263	5241093		Enterococcus_phage(16.67%)	12	NA	NA
WP_047042772.1|4258466_4259036_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	37.0	6.8e-20
WP_047042775.1|4259121_4260495_-	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_015366888.1|4260725_4261361_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.5e-23
WP_045392498.1|4261413_4262562_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.8	1.0e-86
WP_047042780.1|4262860_4264045_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_047042783.1|4264157_4265069_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015366884.1|4265089_4266115_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	3.1e-31
WP_032705726.1|4266410_4266500_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_015366882.1|4266659_4267826_+	MFS transporter	NA	NA	NA	NA	NA
WP_015366881.1|4267876_4268458_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.2e-42
WP_047042789.1|4268935_4269391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047042791.1|4269387_4270263_-	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.3e-17
>prophage 317
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4274576	4276065	5241093		Indivirus(50.0%)	2	NA	NA
WP_045392474.1|4274576_4275473_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.2	3.6e-07
WP_015366871.1|4275543_4276065_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	1.8e-51
>prophage 318
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4279875	4281231	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047042794.1|4279875_4281231_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.5	1.1e-18
>prophage 319
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4284564	4285839	5241093	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_045392458.1|4284564_4285839_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	2.5e-86
>prophage 320
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4297097	4301594	5241093		Pandoravirus(50.0%)	5	NA	NA
WP_047042808.1|4297097_4298468_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	3.9e-69
WP_015366847.1|4298578_4298716_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_045392435.1|4298885_4299926_+	oxidoreductase	NA	NA	NA	NA	NA
WP_045392433.1|4299959_4300964_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_045392431.1|4301198_4301594_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	35.4	1.5e-13
>prophage 321
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4306079	4306283	5241093		Salmonella_phage(100.0%)	1	NA	NA
WP_015705242.1|4306079_4306283_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	68.7	1.6e-19
>prophage 322
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4317638	4321989	5241093		Bacillus_phage(33.33%)	4	NA	NA
WP_015705253.1|4317638_4318940_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.3	1.7e-18
WP_047042839.1|4319488_4319785_-	DUF4406 domain-containing protein	NA	A0A0K1LK36	Vibrio_phage	45.6	5.8e-15
WP_047042841.1|4319929_4320778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052766956.1|4321212_4321989_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	26.6	3.9e-10
>prophage 323
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4333157	4333673	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_045392390.1|4333157_4333673_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	55.4	2.4e-24
>prophage 324
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4352226	4355004	5241093		Lactobacillus_phage(100.0%)	1	NA	NA
WP_047042876.1|4352226_4355004_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	2.1e-66
>prophage 325
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4364053	4365013	5241093		Salmonella_phage(100.0%)	1	NA	NA
WP_004148291.1|4364053_4365013_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 326
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4372078	4374235	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_047042908.1|4372078_4374235_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.3	2.5e-14
>prophage 327
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4384321	4410364	5241093		Escherichia_phage(46.15%)	23	NA	NA
WP_045392302.1|4384321_4384930_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.2	7.8e-22
WP_047042927.1|4384972_4385830_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.3	6.4e-22
WP_101704515.1|4385831_4386449_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	2.2e-72
WP_047048069.1|4386459_4388895_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.8e-215
WP_047048073.1|4389043_4389316_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_045394624.1|4389419_4390130_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_015366764.1|4390123_4390684_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_015366763.1|4390735_4391077_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_015366762.1|4391225_4391552_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	4.9e-23
WP_047048077.1|4391684_4392968_+	MFS transporter	NA	NA	NA	NA	NA
WP_047048080.1|4393111_4394326_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	6.9e-46
WP_047048082.1|4394336_4395356_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047048083.1|4395398_4396781_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_047048084.1|4396987_4398451_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	8.6e-43
WP_047048088.1|4398700_4399132_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	41.4	1.2e-21
WP_045394600.1|4399177_4399864_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045394599.1|4399957_4400707_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_045394597.1|4400879_4402919_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.3	8.1e-15
WP_045394594.1|4403273_4403534_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	85.5	1.2e-32
WP_045394592.1|4403558_4404674_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	83.9	1.7e-179
WP_045394589.1|4404676_4405942_-	MFS transporter	NA	NA	NA	NA	NA
WP_165430696.1|4405983_4407564_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	54.2	1.1e-168
WP_047048093.1|4409299_4410364_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	45.8	9.3e-71
>prophage 328
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4414251	4415355	5241093		uncultured_virus(100.0%)	1	NA	NA
WP_015366738.1|4414251_4415355_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.1	1.1e-101
>prophage 329
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4418557	4418941	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_015366733.1|4418557_4418941_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.4e-08
>prophage 330
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4430857	4431619	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_047048141.1|4430857_4431619_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	4.7e-32
>prophage 331
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4435488	4436910	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_045394513.1|4435488_4436910_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.1	1.2e-17
>prophage 332
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4443064	4445954	5241093		Escherichia_phage(100.0%)	3	NA	NA
WP_045394494.1|4443064_4443694_-	aldolase	NA	A0A077SK32	Escherichia_phage	62.6	8.8e-69
WP_047048170.1|4443690_4444959_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	53.4	4.4e-112
WP_045394489.1|4445180_4445954_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	52.9	1.5e-65
>prophage 333
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4453985	4455314	5241093		Streptococcus_phage(100.0%)	1	NA	NA
WP_047048193.1|4453985_4455314_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.3	7.2e-12
>prophage 334
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4459304	4460096	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_072251602.1|4459304_4460096_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.5	2.5e-20
>prophage 335
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4467575	4469937	5241093		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_015366683.1|4467575_4468460_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.6	2.2e-81
WP_047048223.1|4468920_4469106_+	general stress protein	NA	NA	NA	NA	NA
WP_047048227.1|4469194_4469695_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_032705768.1|4469721_4469937_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	50.0	1.6e-06
>prophage 336
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4473747	4476901	5241093		Stx_converting_phage(50.0%)	4	NA	NA
WP_045394442.1|4473747_4474152_+	YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	32.6	1.6e-10
WP_072251600.1|4474167_4474332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047048246.1|4474369_4475515_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_165430647.1|4475524_4476901_-	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	37.3	1.1e-44
>prophage 337
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4490301	4491171	5241093		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_045394414.1|4490301_4491171_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	34.7	4.7e-20
>prophage 338
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4534942	4535680	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_045394384.1|4534942_4535680_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	1.8e-33
>prophage 339
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4568355	4575569	5241093		Ralstonia_phage(33.33%)	5	NA	NA
WP_047048440.1|4568355_4570614_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.5	2.7e-43
WP_015705446.1|4570652_4571027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047048443.1|4571023_4571413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047048446.1|4571507_4572932_-	serine/threonine protein kinase	NA	M1HV07	Acanthocystis_turfacea_Chlorella_virus	28.1	4.8e-14
WP_047048447.1|4572956_4575569_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.5	3.8e-81
>prophage 340
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4609598	4618639	5241093		Bacillus_phage(50.0%)	8	NA	NA
WP_047048502.1|4609598_4610324_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.6	5.8e-16
WP_047048505.1|4610320_4611061_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047048508.1|4611088_4612018_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047048511.1|4612325_4613711_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	5.7e-28
WP_163350955.1|4613720_4615202_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_047048515.1|4615270_4616461_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_047048518.1|4616549_4617902_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.1	1.4e-07
WP_045394241.1|4617901_4618639_-	response regulator	NA	W8CYM9	Bacillus_phage	36.8	3.2e-30
>prophage 341
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4636911	4639644	5241093		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_047048549.1|4636911_4639644_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.1	4.2e-43
>prophage 342
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4653699	4654644	5241093		Mollivirus(100.0%)	1	NA	NA
WP_045394192.1|4653699_4654644_-	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	27.3	8.4e-23
>prophage 343
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4667261	4671229	5241093		Streptococcus_phage(50.0%)	3	NA	NA
WP_047048594.1|4667261_4668977_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.7	7.8e-35
WP_047048599.1|4669023_4669965_-	bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015366486.1|4670218_4671229_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	26.5	4.6e-27
>prophage 344
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4674808	4676410	5241093		Planktothrix_phage(100.0%)	1	NA	NA
WP_047048613.1|4674808_4676410_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	3.7e-23
>prophage 345
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4679763	4680480	5241093		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047048625.1|4679763_4680480_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	5.6e-11
>prophage 346
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4693632	4694406	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047048657.1|4693632_4694406_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 347
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4700891	4702382	5241093		Mycobacterium_phage(100.0%)	1	NA	NA
WP_047048668.1|4700891_4702382_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.8	8.3e-33
>prophage 348
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4708498	4710043	5241093		Escherichia_phage(100.0%)	1	NA	NA
WP_047048682.1|4708498_4710043_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 349
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4723147	4723924	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_045394065.1|4723147_4723924_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.2e-19
>prophage 350
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4734242	4736354	5241093		Salmonella_phage(100.0%)	1	NA	NA
WP_047048732.1|4734242_4736354_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.5e-136
>prophage 351
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4749674	4750688	5241093		Mycoplasma_phage(100.0%)	1	NA	NA
WP_047048760.1|4749674_4750688_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	4.8e-24
>prophage 352
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4757379	4759341	5241093		Phage_TP(100.0%)	1	NA	NA
WP_047048769.1|4757379_4759341_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 353
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4772585	4773674	5241093		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_047048799.1|4772585_4773674_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.3	1.8e-24
>prophage 354
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4778985	4780494	5241093		Megavirus(100.0%)	1	NA	NA
WP_045393954.1|4778985_4780494_-	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	35.3	1.3e-30
>prophage 355
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4788074	4792281	5241093		Prochlorococcus_phage(50.0%)	5	NA	NA
WP_045393936.1|4788074_4789193_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.2	7.3e-34
WP_015705585.1|4789216_4789492_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_047048821.1|4789596_4790070_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047048824.1|4790086_4791469_-	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_047048825.1|4791753_4792281_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.0e-18
>prophage 356
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4802079	4803285	5241093		Klosneuvirus(100.0%)	1	NA	NA
WP_047048848.1|4802079_4803285_-	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	8.2e-23
>prophage 357
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4809846	4824206	5241093	protease	Caulobacter_phage(37.5%)	13	NA	NA
WP_072251519.1|4809846_4810521_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	7.8e-31
WP_047048859.1|4810581_4814484_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	3.8e-53
WP_045393899.1|4814686_4815292_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_047048861.1|4815339_4815915_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	4.8e-29
WP_045393893.1|4815974_4816553_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	36.8	1.9e-30
WP_088389860.1|4816599_4817640_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	46.6	4.5e-70
WP_045393888.1|4817662_4818118_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_047048868.1|4818139_4819279_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_047048871.1|4819278_4819869_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.3	2.3e-15
WP_165430648.1|4820152_4821238_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_045394633.1|4821237_4822365_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.4	1.4e-29
WP_045393878.1|4822357_4823131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047048876.1|4823132_4824206_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.9	2.9e-40
>prophage 358
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4849620	4850610	5241093		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_032711778.1|4849620_4850610_+	2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	42.5	6.2e-69
>prophage 359
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4855985	4860291	5241093	tRNA	Enterobacteria_phage(25.0%)	4	NA	NA
WP_047048936.1|4855985_4857140_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	2.3e-115
WP_047048939.1|4857284_4857719_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.3	5.2e-28
WP_015366315.1|4857933_4858869_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	92.2	5.0e-137
WP_047049019.1|4858917_4860291_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	3.9e-53
>prophage 360
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4869874	4872627	5241093		Planktothrix_phage(50.0%)	2	NA	NA
WP_047048959.1|4869874_4871692_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.7e-17
WP_045397495.1|4871880_4872627_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.9e-17
>prophage 361
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4887820	4890451	5241093		Cronobacter_phage(100.0%)	1	NA	NA
WP_047047424.1|4887820_4890451_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.2	9.9e-98
>prophage 362
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4898963	4899830	5241093		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047047287.1|4898963_4899830_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	6.7e-51
>prophage 363
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4928978	4930782	5241093		Planktothrix_phage(50.0%)	2	NA	NA
WP_015366243.1|4928978_4929971_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
WP_047044986.1|4929972_4930782_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.0	6.1e-14
>prophage 364
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4935465	4937400	5241093		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_047045001.1|4935465_4937400_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.7	9.1e-08
>prophage 365
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4942957	4943548	5241093		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015366227.1|4942957_4943548_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 366
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4948338	4953739	5241093	protease	Tupanvirus(50.0%)	4	NA	NA
WP_045393156.1|4948338_4950936_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.2	1.2e-87
WP_015366222.1|4951346_4951598_+	YciN family protein	NA	NA	NA	NA	NA
WP_047045013.1|4951679_4952726_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_047045014.1|4952977_4953739_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	3.6e-08
>prophage 367
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4965471	4966899	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_052766189.1|4965471_4966899_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.3	4.1e-21
>prophage 368
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4970399	4973357	5241093		Acinetobacter_phage(100.0%)	2	NA	NA
WP_047045032.1|4970399_4971995_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.9	2.1e-50
WP_047045034.1|4971998_4973357_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
>prophage 369
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4989762	4992021	5241093		Tupanvirus(100.0%)	1	NA	NA
WP_047045060.1|4989762_4992021_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.2	2.9e-146
>prophage 370
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	4998272	4999100	5241093		Bacillus_virus(100.0%)	1	NA	NA
WP_045393234.1|4998272_4999100_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	4.5e-73
>prophage 371
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5006994	5008215	5241093		Klosneuvirus(100.0%)	1	NA	NA
WP_047045085.1|5006994_5008215_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.9e-28
>prophage 372
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5014277	5014922	5241093		Bacillus_phage(100.0%)	1	NA	NA
WP_047045092.1|5014277_5014922_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.1	8.0e-09
>prophage 373
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5020910	5022630	5241093		Aeromonas_phage(50.0%)	2	NA	NA
WP_052766966.1|5020910_5021633_-	hypothetical protein	NA	A0A1I9KF49	Aeromonas_phage	33.1	6.0e-05
WP_165430653.1|5021769_5022630_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	30.7	2.2e-30
>prophage 374
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5029695	5031891	5241093		Tupanvirus(100.0%)	2	NA	NA
WP_045393282.1|5029695_5030337_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.8	1.3e-19
WP_047045116.1|5030634_5031891_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.2	2.9e-23
>prophage 375
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5038552	5042386	5241093		Bacillus_phage(100.0%)	3	NA	NA
WP_015366144.1|5038552_5039836_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	5.5e-09
WP_047045122.1|5040474_5040690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047045124.1|5040895_5042386_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.9	3.4e-10
>prophage 376
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5047356	5057097	5241093		Bacillus_phage(75.0%)	12	NA	NA
WP_047045139.1|5047356_5048379_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	1.0e-13
WP_045374857.1|5048426_5048531_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_100279139.1|5048527_5048602_+	protein YoaJ	NA	NA	NA	NA	NA
WP_072201265.1|5048734_5048854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015366132.1|5048901_5049165_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_047045141.1|5049279_5049918_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_047045144.1|5050009_5050924_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	3.8e-73
WP_047045147.1|5051848_5053036_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_047045149.1|5053110_5054895_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	6.9e-18
WP_047045152.1|5054938_5055367_-	membrane protein	NA	NA	NA	NA	NA
WP_072251527.1|5055442_5055853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059355860.1|5056068_5057097_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	6.5e-13
>prophage 377
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5065288	5069845	5241093		Ralstonia_phage(33.33%)	3	NA	NA
WP_047045170.1|5065288_5067505_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.0	6.1e-48
WP_015705808.1|5068157_5068577_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.6	6.5e-36
WP_047045172.1|5068579_5069845_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	80.3	2.0e-197
>prophage 378
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5082077	5084456	5241093		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_047045202.1|5082077_5084456_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	1.8e-18
>prophage 379
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5091082	5096494	5241093		Staphylococcus_phage(33.33%)	4	NA	NA
WP_047045370.1|5091082_5091805_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.3e-12
WP_047045221.1|5092057_5092744_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.9	4.0e-06
WP_047045224.1|5092748_5094113_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_047045227.1|5094199_5096494_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	2.0e-155
>prophage 380
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5109874	5110486	5241093		Geobacillus_virus(100.0%)	1	NA	NA
WP_015366071.1|5109874_5110486_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	37.9	8.7e-05
>prophage 381
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5123836	5124055	5241093		Morganella_phage(100.0%)	1	NA	NA
WP_023279058.1|5123836_5124055_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	64.7	1.2e-20
>prophage 382
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5133552	5180829	5241093	terminase,integrase,tail,holin	Escherichia_phage(29.17%)	64	5121795:5121819	5180860:5180884
5121795:5121819	attL	TGCGCCCAGTCTGGTTTGTTTAAGA	NA	NA	NA	NA
WP_004132711.1|5133552_5133786_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	56.6	1.1e-16
WP_047046410.1|5134297_5134486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047046413.1|5134667_5135576_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.4	7.2e-72
WP_080958028.1|5136007_5136328_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	84.6	3.4e-37
WP_165430656.1|5136293_5137277_+	hypothetical protein	NA	W6E8G0	Rhizobium_phage	32.5	3.4e-11
WP_047046423.1|5137316_5138015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047046425.1|5138011_5139778_-|tail	tail fiber protein	tail	A0A286S1P0	Klebsiella_phage	55.2	4.0e-26
WP_059355791.1|5139854_5142890_-	kinase	NA	A0A286S259	Klebsiella_phage	66.6	0.0e+00
WP_047047189.1|5142886_5143267_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	79.4	2.5e-58
WP_015705684.1|5143276_5143759_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	74.4	1.2e-62
WP_015705685.1|5143745_5144219_-	membrane protein	NA	A0A286S298	Klebsiella_phage	66.4	1.5e-57
WP_047047186.1|5144218_5147167_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	36.5	8.2e-101
WP_015705687.1|5147286_5147619_-	lipoprotein	NA	M1PRT9	Cellulophaga_phage	67.6	1.7e-31
WP_123273243.1|5147685_5147883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705689.1|5148020_5148503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087877415.1|5148557_5149730_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.2	1.9e-24
WP_015705691.1|5149753_5150146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705692.1|5150142_5150694_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.8	5.0e-28
WP_015705693.1|5150695_5151079_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	42.9	8.6e-19
WP_015705694.1|5151080_5151491_-	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	39.7	6.6e-09
WP_015705695.1|5151494_5151707_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	55.2	4.0e-10
WP_015705696.1|5151746_5152883_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.7	1.3e-158
WP_047041399.1|5152970_5153735_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.1	1.5e-75
WP_165430657.1|5153841_5154954_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.8	2.6e-108
WP_165430658.1|5154937_5156362_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.3	2.2e-192
WP_165430659.1|5156366_5157671_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	8.3e-146
WP_165430660.1|5157648_5158641_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.9	6.3e-29
WP_165430661.1|5158980_5159208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165430662.1|5160232_5160508_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	3.2e-15
WP_165430663.1|5160515_5161145_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	83.7	3.4e-97
WP_047047338.1|5161144_5161426_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.9	8.5e-32
WP_023282495.1|5161412_5161808_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	72.3	4.2e-45
WP_165430664.1|5163096_5163261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165430665.1|5163313_5164135_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	72.2	9.3e-111
WP_047063145.1|5164131_5164272_-	YlcG family protein	NA	NA	NA	NA	NA
WP_165430666.1|5164268_5164850_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	44.6	5.7e-38
WP_165430667.1|5164842_5165013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058674576.1|5165005_5165455_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.7	4.1e-36
WP_165430701.1|5165643_5165856_-	transcription factor	NA	NA	NA	NA	NA
WP_165430668.1|5166017_5166200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165430669.1|5166213_5166528_-	TonB family protein	NA	NA	NA	NA	NA
WP_165430670.1|5166658_5166853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165430671.1|5167144_5167402_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	54.7	1.2e-11
WP_165430672.1|5167437_5167704_-	hypothetical protein	NA	A0A0M4RD46	Salmonella_phage	69.6	2.5e-25
WP_165430673.1|5167755_5168064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165430674.1|5168455_5169157_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	79.1	8.8e-102
WP_165430675.1|5169153_5170086_-	replication protein	NA	A0A077KB11	Edwardsiella_phage	78.2	7.4e-56
WP_165430676.1|5170270_5170813_-	regulator	NA	M9NZI6	Enterobacteria_phage	85.6	8.6e-81
WP_165430677.1|5170909_5171158_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	52.7	2.6e-16
WP_165430702.1|5171285_5171978_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	54.5	3.7e-60
WP_165430678.1|5172720_5173101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015705909.1|5173384_5173591_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.5	2.5e-25
WP_015705910.1|5173595_5173910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705911.1|5174044_5174329_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	85.1	3.1e-42
WP_165430679.1|5174347_5175193_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.8	2.4e-69
WP_165430680.1|5175189_5175870_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	4.6e-124
WP_015705914.1|5175866_5176295_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	4.9e-63
WP_165430681.1|5176291_5176948_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	85.2	1.8e-109
WP_049061482.1|5176944_5178114_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	69.6	1.1e-152
WP_049061483.1|5178110_5178329_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.6e-09
WP_049061484.1|5178330_5178549_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	45.2	2.5e-07
WP_165430682.1|5178551_5178893_+	hypothetical protein	NA	I3PV00	Vibrio_phage	51.0	3.7e-21
WP_165430683.1|5179268_5179517_+	excisionase family protein	NA	S4TND0	Salmonella_phage	54.5	4.0e-17
WP_165430684.1|5179548_5180829_+|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	59.2	4.4e-144
5180860:5180884	attR	TGCGCCCAGTCTGGTTTGTTTAAGA	NA	NA	NA	NA
>prophage 383
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5185743	5193112	5241093	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_015705923.1|5185743_5187429_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	6.5e-34
WP_045390409.1|5187637_5188219_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_045390407.1|5188257_5188953_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_047045273.1|5189098_5191009_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.8	9.4e-90
WP_015366047.1|5191140_5191485_+	RidA family protein	NA	NA	NA	NA	NA
WP_015366046.1|5191485_5191671_-	YoaH family protein	NA	NA	NA	NA	NA
WP_047045276.1|5191756_5193112_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	4.7e-43
>prophage 384
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5196964	5198524	5241093		Moraxella_phage(100.0%)	1	NA	NA
WP_045390395.1|5196964_5198524_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.9	8.6e-41
>prophage 385
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5207082	5207292	5241093		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|5207082_5207292_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 386
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5212569	5214618	5241093		Moraxella_phage(100.0%)	1	NA	NA
WP_047045293.1|5212569_5214618_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	2.8e-84
>prophage 387
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5222107	5222752	5241093		Enterobacteria_phage(100.0%)	1	NA	NA
WP_047045310.1|5222107_5222752_-	protein-serine/threonine phosphatase	NA	K7P6H8	Enterobacteria_phage	53.0	8.1e-62
>prophage 388
NZ_CP049600	Klebsiella aerogenes strain 18-2341 chromosome, complete genome	5241093	5232011	5232981	5241093		Pectobacterium_phage(50.0%)	2	NA	NA
WP_015366007.1|5232011_5232242_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	3.5e-15
WP_047045331.1|5232321_5232981_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	4.5e-15
>prophage 1
NZ_CP049601	Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence	119990	35482	62174	119990	integrase,transposase	Escherichia_phage(30.0%)	24	30305:30322	67576:67593
30305:30322	attL	CGGAAGAACAGATCCGTT	NA	NA	NA	NA
WP_004152391.1|35482_37198_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|37307_40337_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|40443_41469_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|41465_42245_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|42532_43414_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|43663_44983_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|45259_46444_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|46947_47307_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152402.1|48472_49093_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|49181_52079_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_001067855.1|52151_52856_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152334.1|54556_55267_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|55340_55757_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|55753_55984_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072093212.1|55940_56402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|56636_56843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|56888_57197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|57224_57554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|57579_57978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|57984_58317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|58316_59099_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|59990_60221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|60312_60786_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|60905_62174_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
67576:67593	attR	CGGAAGAACAGATCCGTT	NA	NA	NA	NA
>prophage 2
NZ_CP049601	Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence	119990	66749	78841	119990		Enterobacteria_phage(25.0%)	13	NA	NA
WP_004152345.1|66749_68777_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|68888_69104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|69328_69661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|70037_71012_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|71008_72214_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|72535_73432_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|73832_75104_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|75103_75535_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|75766_76738_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|76740_77412_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|77472_77703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|77821_77938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|78139_78841_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
