The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049368	Stenotrophomonas maltophilia strain MER1 chromosome, complete genome	4547296	590157	599094	4547296		Enterobacteria_phage(42.86%)	7	NA	NA
WP_165376202.1|590157_591213_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.9	7.8e-78
WP_165376203.1|591227_592115_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.9	2.8e-97
WP_165376204.1|592111_592669_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	2.7e-45
WP_165376205.1|592665_593559_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	35.8	1.1e-27
WP_165376206.1|593611_595015_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.9	1.9e-47
WP_165376207.1|595029_596376_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.8	3.5e-30
WP_165376208.1|596472_599094_-	DEAD/DEAH box helicase	NA	A8C6A2	Antheraea_pernyi_nuclear_polyhedrosis_virus	30.4	6.1e-47
>prophage 2
NZ_CP049368	Stenotrophomonas maltophilia strain MER1 chromosome, complete genome	4547296	962263	1032555	4547296	integrase,tail,protease,plate	Escherichia_phage(16.67%)	67	1013746:1013765	1033601:1033620
WP_089239110.1|962263_963553_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.4	1.9e-134
WP_108265118.1|963695_966149_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.9	2.7e-214
WP_004146343.1|966367_966640_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.8	7.7e-22
WP_165376379.1|967363_969319_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_165376380.1|969679_970882_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_165376381.1|970878_971643_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_165376382.1|971654_972299_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025878155.1|972311_972764_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	52.1	6.6e-42
WP_025878156.1|972768_973497_+	DNA polymerase III subunit epsilon	NA	A2I2Z6	Vibrio_virus	30.0	2.6e-08
WP_165376383.1|973597_974302_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_049468383.1|974915_975320_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.3	5.0e-17
WP_099819185.1|975438_976485_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_089239126.1|976505_977255_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_165376384.1|977254_978022_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_165376385.1|978018_978408_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_032977375.1|978882_979200_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_165376386.1|979568_988826_+	transporter	NA	NA	NA	NA	NA
WP_165376387.1|988881_989325_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_165376388.1|989388_990243_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_165376389.1|990991_993070_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.8e-47
WP_025879376.1|993076_993397_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_089239142.1|993508_994108_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_089239144.1|994172_994532_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_100551691.1|994610_995138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376390.1|995134_997084_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_165376391.1|997076_998021_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_165376392.1|998023_998977_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_165376393.1|999021_1000863_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_165376394.1|1000892_1001465_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_088101178.1|1001578_1002088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025879386.1|1002195_1002390_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_165376395.1|1002481_1003459_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_100463422.1|1003532_1004315_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_165376396.1|1004463_1005408_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_165376397.1|1005490_1006234_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	3.4e-11
WP_025874077.1|1006387_1006627_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	43.2	2.9e-09
WP_165376398.1|1006772_1008035_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_165376399.1|1008127_1009492_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_165376400.1|1009636_1010698_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_165376401.1|1010694_1011360_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	35.3	1.2e-20
WP_165376402.1|1011356_1012313_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_089239172.1|1012309_1012663_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_165376403.1|1012926_1013160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376404.1|1013296_1013677_+	tautomerase family protein	NA	NA	NA	NA	NA
1013746:1013765	attL	CGCATGGCGTGGATCTACAC	NA	NA	NA	NA
WP_165376405.1|1013759_1014833_-	phage late control D family protein	NA	D5LGY1	Escherichia_phage	53.7	4.5e-97
WP_089239180.1|1014823_1015039_-|tail	phage tail protein	tail	A2I2Y3	Vibrio_virus	40.6	2.5e-07
WP_165376406.1|1015022_1015490_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	36.1	8.9e-18
WP_165376407.1|1015492_1017946_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	23.6	4.4e-15
WP_089239186.1|1018066_1018357_-|tail	phage tail assembly protein	tail	A0A1W6JT47	Escherichia_phage	59.0	6.5e-19
WP_093817501.1|1018440_1018944_-|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	48.8	7.6e-39
WP_165376408.1|1018946_1020149_-|tail	phage tail protein	tail	A0A088FVH5	Escherichia_phage	53.8	3.0e-126
WP_165376409.1|1020255_1020915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376410.1|1020916_1022956_-|tail	tail fiber domain-containing protein	tail	V9IQX0	Stenotrophomonas_phage	37.4	3.1e-99
WP_165376411.1|1022963_1023743_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.3	1.5e-46
WP_165376412.1|1023735_1024632_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	55.5	6.0e-79
WP_089239202.1|1024634_1024973_-|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	61.3	7.8e-32
WP_165376413.1|1025025_1025616_-|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	39.3	1.3e-26
WP_165376414.1|1025612_1026167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376415.1|1026286_1026565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376416.1|1026539_1026917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376417.1|1026913_1027399_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	55.0	8.6e-40
WP_089239212.1|1027395_1027746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376418.1|1027742_1028192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165376419.1|1028531_1028915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376420.1|1029084_1029621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376421.1|1029662_1029890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165376422.1|1030236_1032555_-|integrase	integrase	integrase	V5YUR8	Pseudomonas_phage	42.1	3.1e-135
1033601:1033620	attR	CGCATGGCGTGGATCTACAC	NA	NA	NA	NA
>prophage 3
NZ_CP049368	Stenotrophomonas maltophilia strain MER1 chromosome, complete genome	4547296	2209739	2222570	4547296	coat	Stenotrophomonas_phage(50.0%)	19	NA	NA
WP_165377113.1|2209739_2210135_-	hypothetical protein	NA	S0F2J2	Stenotrophomonas_phage	54.6	1.2e-31
WP_165377114.1|2210274_2210442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165377115.1|2210547_2211597_+	replication initiation protein	NA	A0A077JDC0	Xanthomonas_phage	70.3	7.6e-142
WP_165377116.1|2211593_2211884_+	DNA-binding protein	NA	O80282	Xanthomonas_phage	62.5	2.1e-25
WP_165377117.1|2212009_2212213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165377118.1|2212209_2212461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165377119.1|2212587_2214132_+|coat	A coat protein	coat	A0A077JDC5	Xanthomonas_phage	45.8	6.7e-62
WP_006445348.1|2214137_2214452_+	DUF2523 domain-containing protein	NA	A0A077JCZ2	Xanthomonas_phage	60.2	9.5e-24
WP_165377120.1|2214448_2215645_+	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	59.0	4.5e-122
WP_165377121.1|2215654_2215987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165377122.1|2216055_2216418_-	hypothetical protein	NA	B1NI82	Stenotrophomonas_phage	77.6	4.3e-44
WP_165378587.1|2216625_2216994_+	hypothetical protein	NA	A0A077JDD0	Xanthomonas_phage	50.4	1.5e-28
WP_165377123.1|2217030_2217630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165377124.1|2218204_2219413_-	hypothetical protein	NA	B1NI81	Stenotrophomonas_phage	30.7	4.5e-37
WP_154880323.1|2219409_2219694_-	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_165375838.1|2219693_2220743_-	hypothetical protein	NA	Q4LAU2	Stenotrophomonas_phage	73.2	3.1e-18
WP_165377125.1|2220809_2220947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165377126.1|2221157_2221460_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	96.9	6.5e-46
WP_165377127.1|2221463_2222570_-	replication protein	NA	S0F3I3	Stenotrophomonas_phage	90.5	1.1e-199
