The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049357	Deinococcus wulumuqiensis R12 chromosome, complete genome	2857585	222378	286633	2857585	tRNA,transposase,protease	uncultured_Mediterranean_phage(23.08%)	58	NA	NA
WP_010884088.1|222378_223191_+|transposase	IS5-like element ISDra5 family transposase	transposase	NA	NA	NA	NA
WP_152423789.1|223328_223883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871682.1|223886_224399_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	39.6	2.0e-18
WP_081608330.1|224461_224725_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_017871683.1|224773_228736_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.8	1.7e-45
WP_017871684.1|228732_229164_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_017871685.1|229175_229499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871686.1|229556_232376_-	DEAD/DEAH box helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.3	2.8e-34
WP_025567382.1|232380_237480_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	23.0	3.7e-56
WP_114671024.1|237781_238618_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017871058.1|238879_239932_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_152423702.1|240048_240498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871061.1|242141_242330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871062.1|242465_243731_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_161617992.1|243744_244356_+	VOC family protein	NA	NA	NA	NA	NA
WP_017871064.1|244862_245861_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_017871065.1|246103_247450_+	acyltransferase	NA	NA	NA	NA	NA
WP_017871066.1|247429_248296_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017871067.1|248300_248867_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_025567680.1|248863_249103_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_017871069.1|249401_250412_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_164993951.1|250576_250807_+	DUF3248 domain-containing protein	NA	NA	NA	NA	NA
WP_025567209.1|250830_251304_+	DUF3809 domain-containing protein	NA	NA	NA	NA	NA
WP_017871072.1|251513_251714_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010888637.1|251717_252074_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017871073.1|252310_252820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871074.1|252846_253251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871075.1|253251_253548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871076.1|253821_254847_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_017871077.1|254955_256566_-	catalase	NA	A0A2K9L572	Tupanvirus	46.8	3.7e-103
WP_017871078.1|256738_257359_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_017871079.1|257348_258422_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017871080.1|258501_259704_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017871081.1|259755_260340_+	DUF1282 family protein	NA	NA	NA	NA	NA
WP_017871082.1|260468_261293_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_152423701.1|261392_262094_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_017871084.1|262151_263246_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017871085.1|263278_263722_+	DUF3293 domain-containing protein	NA	NA	NA	NA	NA
WP_017871086.1|264049_265111_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.5	4.6e-46
WP_017871087.1|265495_266095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871748.1|266356_267214_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	3.8e-14
WP_164993994.1|267321_268518_+	serine hydrolase	NA	NA	NA	NA	NA
WP_025568039.1|268736_269381_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	33.8	7.4e-23
WP_017871745.1|269459_271241_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_025568038.1|271812_272799_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.1	5.2e-68
WP_025568036.1|272922_273438_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_025568033.1|273501_274467_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_017871741.1|274794_275253_-	DIP1984 family protein	NA	NA	NA	NA	NA
WP_017871740.1|275680_277981_+	endonuclease MutS2	NA	A0A1V0SJ67	Klosneuvirus	26.9	5.2e-18
WP_152423800.1|278159_278579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871738.1|278654_279536_+	MFS transporter	NA	NA	NA	NA	NA
WP_017871737.1|279532_279760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993948.1|279789_280904_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_025567030.1|280941_281517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423571.1|281549_282188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870149.1|282244_284689_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	42.8	3.8e-176
WP_017870150.1|284822_286031_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.3	1.9e-112
WP_017870151.1|286027_286633_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.6	3.6e-51
>prophage 2
NZ_CP049357	Deinococcus wulumuqiensis R12 chromosome, complete genome	2857585	733739	787384	2857585	integrase,transposase	Bacillus_phage(33.33%)	35	731074:731089	745195:745210
731074:731089	attL	TGGTTTCTTCCAACTG	NA	NA	NA	NA
WP_152423453.1|733739_734705_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.1	2.4e-17
WP_040383989.1|734810_735863_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	25.2	4.3e-20
WP_152423454.1|736172_737018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423455.1|737221_737584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993958.1|737820_738693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017869310.1|739331_739631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017869311.1|739883_740744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025566588.1|740827_741067_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017869313.1|741067_741580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423457.1|741630_741957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025566590.1|741940_742996_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017869316.1|743501_746255_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	22.7	1.4e-22
745195:745210	attR	CAGTTGGAAGAAACCA	NA	NA	NA	NA
WP_017869317.1|746254_749020_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_017869318.1|749024_751775_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_017869319.1|751771_752401_-	DUF3780 domain-containing protein	NA	NA	NA	NA	NA
WP_017869320.1|752436_755511_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_017869321.1|755546_755894_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_017869322.1|756131_757283_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_152423463.1|760209_765249_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	37.7	4.1e-52
WP_017869328.1|765245_767348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017869329.1|767362_769906_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	26.4	9.7e-50
WP_017869330.1|770213_770507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161617818.1|770606_771458_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_017869332.1|771461_772427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025566595.1|772496_773444_-	LamG domain-containing protein	NA	Q5GQG3	Synechococcus_phage	25.8	7.1e-06
WP_152524797.1|773537_773873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017869334.1|774197_775151_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_017869335.1|775147_776101_-	CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6	NA	NA	NA	NA	NA
WP_025566598.1|776110_778939_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081703130.1|780523_781720_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017871705.1|782000_783446_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_025566605.1|783693_784152_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_025566607.1|784174_785089_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_025566609.1|785191_786079_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_152423790.1|786154_787384_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP049357	Deinococcus wulumuqiensis R12 chromosome, complete genome	2857585	1822964	1887552	2857585	tRNA,transposase	uncultured_virus(23.08%)	58	NA	NA
WP_114671024.1|1822964_1823801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017871277.1|1823874_1824804_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025567427.1|1825153_1825873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871275.1|1825878_1826526_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_040384555.1|1826990_1828622_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_017871273.1|1828837_1829854_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017871272.1|1829899_1830409_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017871271.1|1830407_1830764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871270.1|1830795_1831458_-	acetyltransferase	NA	NA	NA	NA	NA
WP_152423729.1|1831615_1832074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871268.1|1832146_1833793_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	7.0e-158
WP_017871267.1|1833867_1834155_-	co-chaperone GroES	NA	A0A221S308	uncultured_virus	45.2	4.8e-14
WP_025567431.1|1834457_1835063_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.8	5.2e-10
WP_017871265.1|1835059_1836019_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017871264.1|1836015_1837647_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_017871263.1|1837643_1838102_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017871262.1|1838177_1838378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051056507.1|1838535_1840296_-	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	31.9	8.8e-42
WP_017871260.1|1840524_1840764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025567796.1|1840986_1841811_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	50.4	6.1e-62
WP_017871258.1|1841773_1842298_-	M23 family metallopeptidase	NA	A0A0Y0AH42	Bacillus_phage	41.3	7.7e-10
WP_017871257.1|1842454_1843141_+	SCO family protein	NA	NA	NA	NA	NA
WP_017871256.1|1843210_1844212_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	3.4e-06
WP_017871255.1|1844465_1845824_+	glycogen synthase	NA	NA	NA	NA	NA
WP_051056508.1|1845834_1846578_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_152423730.1|1846753_1847500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993977.1|1847994_1848807_-|transposase	IS5-like element ISDra5 family transposase	transposase	NA	NA	NA	NA
WP_161618026.1|1848974_1849814_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017871448.1|1849814_1850072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152423757.1|1850302_1850572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871450.1|1850789_1852010_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	24.9	8.6e-20
WP_017871451.1|1852229_1854035_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_017871452.1|1854031_1858054_-	hypothetical protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	28.2	1.2e-65
WP_017871453.1|1858103_1861487_-	hypothetical protein	NA	A0A2K5B2B9	Erysipelothrix_phage	26.8	4.0e-43
WP_152423758.1|1861958_1863263_-	MFS transporter	NA	NA	NA	NA	NA
WP_017871455.1|1863322_1864246_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_017871456.1|1864887_1865523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871457.1|1865627_1866734_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_017871458.1|1866952_1867627_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	3.3e-29
WP_114671024.1|1867895_1868732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164993948.1|1868935_1870049_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017870442.1|1870163_1870505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870443.1|1870604_1870778_+	lysine biosynthesis protein LysW	NA	NA	NA	NA	NA
WP_017870444.1|1870855_1871722_+	lysine biosynthesis protein LysX	NA	NA	NA	NA	NA
WP_017870445.1|1871946_1874463_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_025568107.1|1874868_1875702_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017870447.1|1875698_1876406_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	1.6e-18
WP_081608252.1|1876476_1877055_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_029732772.1|1877209_1877404_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025567418.1|1877481_1879278_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017870449.1|1879320_1880142_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_152423608.1|1880191_1881061_+	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_017870451.1|1881109_1881577_+	RrF2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_017870452.1|1881720_1881975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870453.1|1882060_1883746_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_017870454.1|1883879_1885061_-|tRNA	serine-tRNA(Ala) deacylase	tRNA	NA	NA	NA	NA
WP_017870455.1|1885104_1886184_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_040384345.1|1886397_1887552_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	48.1	5.1e-91
>prophage 4
NZ_CP049357	Deinococcus wulumuqiensis R12 chromosome, complete genome	2857585	2597184	2646035	2857585	tRNA,transposase	Caulobacter_phage(12.5%)	46	NA	NA
WP_017870267.1|2597184_2598111_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_017870268.1|2598399_2599014_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_017870269.1|2599285_2599465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870270.1|2599461_2600253_+	endonuclease III	NA	NA	NA	NA	NA
WP_017870271.1|2600404_2601037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870272.1|2601040_2602024_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_040384270.1|2602020_2602647_-	peptide deformylase	NA	K4JRM9	Caulobacter_phage	35.0	3.0e-13
WP_017870274.1|2602922_2603825_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_017870275.1|2603821_2604343_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017870276.1|2604360_2605494_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_025567746.1|2605490_2606612_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_025567748.1|2606732_2607881_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A2I7SAC4	Vibrio_phage	32.6	3.1e-40
WP_017870279.1|2607864_2608746_-	DUF1206 domain-containing protein	NA	NA	NA	NA	NA
WP_081608237.1|2608793_2609141_-	hypothetical protein	NA	A0A2H4UTN1	Bodo_saltans_virus	45.2	3.3e-09
WP_017870281.1|2609026_2609479_-	hypothetical protein	NA	A0A2R2ZGT8	Clostridioides_phage	40.2	3.4e-14
WP_017870282.1|2609580_2611092_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_025568162.1|2611168_2611555_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_017870286.1|2612398_2612845_-	response regulator	NA	NA	NA	NA	NA
WP_152423587.1|2612841_2615109_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.7	2.2e-13
WP_017870288.1|2615218_2615884_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_051056480.1|2616183_2617866_+	ribonuclease J	NA	NA	NA	NA	NA
WP_025567898.1|2617927_2619307_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_017870291.1|2619346_2620006_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_114672231.1|2620123_2620573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871776.1|2621249_2622464_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_152524824.1|2622496_2624287_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_017871778.1|2624422_2626789_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.0	5.7e-44
WP_017871779.1|2626974_2627535_-	HNH endonuclease	NA	A0A1P8DIY8	Virus_Rctr197k	40.0	2.7e-21
WP_017871780.1|2627781_2628720_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_017871781.1|2628747_2629227_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_017871782.1|2629242_2629662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871783.1|2629726_2630452_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017871784.1|2631068_2632571_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.2	1.5e-90
WP_017871785.1|2632567_2633416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025567528.1|2633409_2634393_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081608351.1|2634631_2634988_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_017871961.1|2634984_2635803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871960.1|2635815_2639013_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_116630749.1|2638894_2639731_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017871958.1|2639799_2640645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017872099.1|2640690_2641122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164993985.1|2641214_2642555_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_081608370.1|2642587_2642887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994000.1|2642876_2643860_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164993986.1|2644030_2644903_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164994000.1|2645051_2646035_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP049357	Deinococcus wulumuqiensis R12 chromosome, complete genome	2857585	2820274	2856353	2857585	tRNA,transposase	Streptococcus_phage(16.67%)	43	NA	NA
WP_164993989.1|2820274_2821414_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164993990.1|2821414_2822113_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017871170.1|2822612_2823254_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_017871171.1|2823328_2823784_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_025568118.1|2824087_2825479_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_017871174.1|2825645_2826074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871175.1|2826170_2827256_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_017871176.1|2827313_2827925_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.2	9.5e-20
WP_026138772.1|2827937_2828552_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017871178.1|2828857_2829700_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_017871180.1|2829875_2830145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871181.1|2830492_2830873_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_017871182.1|2830882_2831755_-	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_161618003.1|2831773_2831914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871183.1|2832172_2832847_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017871184.1|2833005_2833809_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.1	4.2e-31
WP_017871185.1|2833916_2835149_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_026138773.1|2835225_2835846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871187.1|2835945_2836464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871188.1|2836531_2836696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871189.1|2836884_2837334_+	hypothetical protein	NA	A0A1P8DIZ8	Virus_Rctr197k	37.0	4.4e-14
WP_017871190.1|2837352_2837844_+	SocA family protein	NA	NA	NA	NA	NA
WP_017871191.1|2837853_2838378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871192.1|2838400_2839570_+	MFS transporter	NA	NA	NA	NA	NA
WP_017871193.1|2839637_2839793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871194.1|2839832_2840636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871195.1|2840796_2841531_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_017871196.1|2841916_2842120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871197.1|2842176_2842563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423718.1|2842561_2843365_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017871199.1|2843546_2844542_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	33.9	2.0e-43
WP_017871200.1|2845073_2845886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871202.1|2846275_2847181_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017871203.1|2847177_2848662_+	ABC transporter permease subunit	NA	G3M9Y6	Bacillus_virus	32.5	9.1e-24
WP_164993991.1|2848902_2850129_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	29.2	6.3e-39
WP_017872080.1|2850266_2850863_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_017872079.1|2850983_2851184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994000.1|2851201_2852185_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164993992.1|2852355_2852628_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081608353.1|2853028_2853724_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017871971.1|2854059_2855199_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_025568141.1|2855276_2855762_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_152423840.1|2856245_2856353_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP049358	Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence	323544	40440	145463	323544	protease,transposase,integrase	uncultured_virus(15.0%)	95	82594:82652	121812:121870
WP_164993946.1|40440_41565_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164993966.1|41723_42944_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	29.2	7.5e-40
WP_025566826.1|43038_43857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871931.1|44005_44764_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017871932.1|44760_45690_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.4	9.7e-16
WP_025566824.1|45732_47169_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017871934.1|47299_48202_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081608345.1|48303_50676_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
WP_164994016.1|50683_52036_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	33.9	8.8e-42
WP_017871724.1|52149_52902_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_017871725.1|52992_53580_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017871726.1|53617_54619_-	serine hydrolase	NA	NA	NA	NA	NA
WP_017871727.1|54623_55643_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_040384667.1|55639_56839_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_152423797.1|56865_57720_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_017871730.1|57790_59530_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081608361.1|59631_61068_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.5	6.1e-41
WP_017871731.1|61157_62129_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040384668.1|62161_63235_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017871733.1|63299_64862_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_017871734.1|64989_65586_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017871735.1|65970_66129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152423799.1|66104_67037_-	ATPase	NA	NA	NA	NA	NA
WP_162865373.1|67415_68648_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.3e-36
WP_017871416.1|68693_69392_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017871415.1|69384_70542_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_017871414.1|70538_71390_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017871413.1|71429_72677_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_162865701.1|72673_73042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871411.1|73052_73538_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_017871410.1|73549_74008_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_017871409.1|74004_74781_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.4	9.3e-20
WP_017871408.1|74863_75742_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.7	3.2e-77
WP_017871407.1|75814_77200_-	superoxide dismutase copper/zinc-binding protein	NA	R4ZFG3	Choristoneura_biennis_entomopoxvirus	36.4	7.5e-12
WP_017871406.1|77199_78441_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_017871405.1|78556_78991_-	response regulator	NA	NA	NA	NA	NA
WP_017871404.1|78987_80598_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_017871403.1|80866_82582_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
82594:82652	attL	TAGAGCAGTTCTCCGAATTACGTGATGCGCGGAACGGCACCCCGCATCACTCCATTCTC	NA	NA	NA	NA
WP_026138780.1|82830_84327_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_017871401.1|84541_87061_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	36.5	6.9e-165
WP_025567966.1|87109_88312_-	cytochrome P450	NA	NA	NA	NA	NA
WP_164994017.1|88313_88826_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017871991.1|88933_90478_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_164994026.1|90700_91576_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_026138831.1|91920_93285_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	3.2e-55
WP_164994018.1|93645_94329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994019.1|94336_95461_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994020.1|95453_96080_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	27.6	3.3e-15
WP_162865705.1|96205_96970_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017871761.1|97014_97770_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_161618045.1|98081_98930_+	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_017871759.1|99075_99825_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_017871758.1|99878_100679_-	thiazole synthase	NA	NA	NA	NA	NA
WP_017871757.1|101119_101314_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_051056520.1|101411_102104_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017871755.1|102120_103932_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017871754.1|104309_104909_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_017871753.1|104905_105607_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.0e-17
WP_025567867.1|105599_106151_-	biotin biosynthesis protein BioY	NA	NA	NA	NA	NA
WP_152423803.1|106236_106500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871750.1|106534_108229_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_114673113.1|108593_109382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081703135.1|109802_111152_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_017871460.1|111244_111670_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	43.5	4.4e-16
WP_017871461.1|111739_112213_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_017871462.1|112209_112800_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_017871463.1|112914_113691_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017871464.1|114140_114827_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_017871465.1|114823_115588_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.6	8.9e-15
WP_029732711.1|115654_116518_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_017871467.1|116523_117543_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_017871468.1|117802_118822_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A222YW41	Synechococcus_phage	36.8	3.0e-50
WP_017871469.1|119213_119501_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_025567064.1|119525_120518_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017871471.1|120628_121669_+	SIS domain-containing protein	NA	M1GV45	Paramecium_bursaria_Chlorella_virus	27.8	1.5e-20
WP_017871472.1|121867_122548_-	DedA family protein	NA	NA	NA	NA	NA
121812:121870	attR	GAGAATGGAGTGATGCGGGGTGCCGTTCCGCGCATCACGTAATTCGGAGAACTGCTCTA	NA	NA	NA	NA
WP_017871473.1|122621_123371_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017871474.1|123506_125183_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_025567061.1|125207_125765_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_017871476.1|125798_126713_+	agmatinase	NA	NA	NA	NA	NA
WP_017871477.1|126705_127905_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017871478.1|127901_129476_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.8	2.3e-102
WP_081608369.1|129504_129888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994021.1|129769_130471_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	29.9	9.3e-11
WP_017869732.1|130649_131669_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017869733.1|131665_133180_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	5.4e-32
WP_017869734.1|133208_134009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017869735.1|134005_134761_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017869736.1|134757_136407_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	2.4e-09
WP_017869737.1|136472_138623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017869738.1|138619_139900_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_152423522.1|139896_140766_-	CoA transferase	NA	NA	NA	NA	NA
WP_017869740.1|140932_142234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017869741.1|142319_142973_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017869742.1|143432_145463_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
>prophage 1
NZ_CP049359	Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence	222570	7385	70045	222570	integrase,transposase,protease	Streptococcus_phage(16.67%)	52	48411:48426	67687:67702
WP_164994028.1|7385_8606_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_026138809.1|9097_10519_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017871825.1|10773_12285_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_025567084.1|12277_13708_-	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_017871823.1|13809_15375_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_017871822.1|15449_15971_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	45.9	5.6e-29
WP_017871821.1|15960_16677_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_017871820.1|16838_18005_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	29.5	1.4e-40
WP_017871819.1|18405_19455_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_152423815.1|19348_20140_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_025567087.1|20331_21507_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	44.5	1.5e-82
WP_081608346.1|21493_22870_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	5.7e-12
WP_026138826.1|22866_24063_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	28.9	1.9e-32
WP_025567089.1|24094_25045_-|integrase	tyrosine-type recombinase/integrase	integrase	R4JKS7	Mycobacterium_phage	31.4	4.8e-10
WP_017871949.1|25606_27430_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.2	3.3e-23
WP_025567091.1|27443_28634_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	49.2	8.7e-110
WP_025567093.1|28681_29320_-	acetyltransferase	NA	NA	NA	NA	NA
WP_161618073.1|29316_31041_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_081703136.1|32620_33970_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_025567297.1|34070_34757_-	recombinase family protein	NA	A0A1B1IWV2	uncultured_Mediterranean_phage	47.8	1.7e-33
WP_017871616.1|38034_38595_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	77.5	4.3e-43
WP_025567295.1|38827_39349_+	signal peptidase II	NA	NA	NA	NA	NA
WP_017871618.1|39409_41791_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.3	1.6e-131
WP_017871619.1|41909_42539_+	cation transporter	NA	NA	NA	NA	NA
WP_025567292.1|42589_42844_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.0	3.2e-06
WP_017871621.1|42840_43221_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.0	1.7e-11
WP_017871622.1|43332_46290_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.0	1.9e-65
WP_152423778.1|46406_46697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081608327.1|46687_46963_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017871624.1|47142_47700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025567289.1|47689_48202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994029.1|48257_48491_-	hypothetical protein	NA	NA	NA	NA	NA
48411:48426	attL	GCCGCGCCCGATCACC	NA	NA	NA	NA
WP_164994030.1|48645_49356_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	5.1e-25
WP_164994031.1|50234_51347_-	bifunctional DNA primase/polymerase	NA	A0A173H0P8	Pseudoalteromonas_phage	27.5	2.1e-09
WP_152423721.1|51528_53337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081608305.1|53592_53889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871206.1|53907_54213_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_081608309.1|54696_54876_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152423722.1|55110_56136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871209.1|56132_56441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871210.1|56437_57004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162531377.1|57057_57477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081608306.1|57385_57673_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017871212.1|57771_58392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081608310.1|60657_61485_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	25.6	3.5e-09
WP_017871215.1|61539_62634_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_152423723.1|62660_63341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871217.1|63536_64082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871218.1|64081_64915_-	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_017871219.1|64938_65511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081608307.1|65577_68433_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.4	1.8e-124
67687:67702	attR	GCCGCGCCCGATCACC	NA	NA	NA	NA
WP_025566934.1|69067_70045_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP049359	Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence	222570	86778	141556	222570	integrase,transposase	Streptococcus_phage(31.58%)	51	115609:115668	140810:140986
WP_081608295.1|86778_87489_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.2	5.1e-25
WP_152423704.1|87608_87938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029732691.1|87946_88267_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_017871100.1|88263_88626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081608296.1|88843_89830_-|integrase	site-specific integrase	integrase	A0A0K0NL26	Gordonia_phage	29.5	2.5e-09
WP_017871102.1|90055_90832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017871103.1|90899_91805_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.9	7.5e-37
WP_017871104.1|91801_92071_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081608298.1|92210_92828_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	48.0	7.4e-20
WP_161617998.1|92886_93363_-	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
WP_017871107.1|93632_94697_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_017871108.1|94772_96917_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_017871109.1|96925_97336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871110.1|97357_99868_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	2.7e-92
WP_017871111.1|100031_100241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013616071.1|100321_100585_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_025566961.1|100650_100887_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_114673812.1|101045_101612_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	38.5	3.0e-20
WP_017871114.1|101675_102242_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_051056502.1|102238_103285_-	peptidase C39 family protein	NA	NA	NA	NA	NA
WP_152423707.1|103376_104546_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013616027.1|104738_105140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871117.1|106246_106480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994042.1|106848_107832_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_162865373.1|107902_109135_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.3e-36
WP_013616026.1|109195_110311_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.1	1.0e-27
WP_013616025.1|110314_110980_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	4.3e-42
WP_152423853.1|111051_111741_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	38.4	2.3e-14
WP_017872031.1|111737_112265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994033.1|112530_113763_-|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.1e-35
WP_026138839.1|113907_115209_-	plasmid replication initiator protein	NA	NA	NA	NA	NA
115609:115668	attL	GGTTCTGGCAACTTAACGCTGATAGGCTGCCGAGCTGTGACTGACCGGAAGCCCTATCGA	NA	NA	NA	NA
WP_164994034.1|115841_116552_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	5.1e-25
WP_017872037.1|116772_118035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161629246.1|119376_119769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994035.1|120559_121270_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	3.9e-25
WP_081608355.1|121310_122003_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_017872021.1|122335_123904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017872022.1|123900_124869_-	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_164994036.1|125208_125919_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	5.1e-25
WP_081608368.1|125939_126140_-	ParA family protein	NA	D3JZ99	Mycobacterium_phage	51.9	2.2e-05
WP_164994043.1|126459_127692_+|transposase	transposase	transposase	A0A218MNH3	uncultured_virus	28.6	3.5e-37
WP_017872032.1|127709_127931_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017872033.1|128034_128667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081608358.1|130395_131043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994030.1|131083_131794_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	5.1e-25
WP_081608342.1|131954_132863_+	radical SAM protein	NA	NA	NA	NA	NA
WP_152423827.1|133291_137503_+	hypothetical protein	NA	A0A2H4PQT3	Staphylococcus_phage	24.1	1.1e-13
WP_152423826.1|137566_139828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081608341.1|139902_140133_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_164994037.1|140544_140853_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164994036.1|140845_141556_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	5.1e-25
140810:140986	attR	GGTTCTGGCAACTTAACGCTGATAGGCTGCCGAGCTGTGACTGACCGGAAGCCCTATCGACATCGATTCCCGCTGAGTGTCATTGGGTATGCCCTGCGGCTCTACCACCGCTTCCCCCTCAGCCAGCGGGACGTTCAGGAACTGCTTCACGAGCGTGGTGTTCAGGTCAGTCACGAG	NA	NA	NA	NA
>prophage 3
NZ_CP049359	Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence	222570	145506	212891	222570	integrase,transposase	Streptococcus_phage(10.0%)	54	141039:141071	163595:163627
141039:141071	attL	GCCATCGAGAACCCCGGCGGGGTTCTCGATGGC	NA	NA	NA	NA
WP_081703140.1|145506_146886_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_152423828.1|146957_148028_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	31.7	2.6e-36
WP_017871900.1|148142_149036_+	Abi family protein	NA	NA	NA	NA	NA
WP_017871901.1|149032_150076_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	54.2	2.1e-107
WP_017871804.1|151491_154497_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.2	2.0e-256
WP_026138807.1|154619_155492_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BW99	unidentified_phage	32.1	4.9e-09
WP_081608338.1|155919_156966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152423810.1|157012_157414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152423811.1|157497_157905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152423812.1|158323_158857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423813.1|159096_160242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871809.1|160656_162570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994038.1|163109_164291_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.7	6.6e-25
163595:163627	attR	GCCATCGAGAACCCCGGCGGGGTTCTCGATGGC	NA	NA	NA	NA
WP_017871975.1|164819_166343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152423842.1|166339_167179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871977.1|167317_169141_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.5	5.6e-23
WP_051349761.1|169159_170350_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	49.5	3.9e-110
WP_025567110.1|170397_171036_-	acetyltransferase	NA	A0A1E1ESK8	Acanthamoeba_castellanii_mimivirus	30.2	3.7e-06
WP_161617965.1|171035_172772_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017870750.1|172808_173819_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	31.7	1.4e-36
WP_017870749.1|173953_174853_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_051056493.1|175177_177268_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_161617963.1|177299_178298_-	EpsG family protein	NA	NA	NA	NA	NA
WP_043826539.1|178342_179446_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_081608275.1|179575_180472_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_081608274.1|180543_181476_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_043826536.1|181472_182591_-	UDP-galactopyranose mutase	NA	A0A076YLQ6	Rhizobium_phage	34.4	2.7e-52
WP_017870744.1|182592_183846_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017870743.1|183867_184245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994044.1|184784_185768_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_040384450.1|185862_186372_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081608273.1|186368_186890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017870738.1|186990_187410_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_017870737.1|187552_188944_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017870736.1|189121_189916_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_017870735.1|190131_190935_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.4	6.7e-13
WP_017870734.1|191189_193700_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A2D2W2B1	Stenotrophomonas_phage	37.8	9.4e-05
WP_017870733.1|193707_194649_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_017870732.1|194706_196500_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_152423654.1|197266_198622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870730.1|199002_199773_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A0N7E4H5	Mycobacterium_phage	33.8	6.6e-18
WP_152423651.1|199769_200672_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.3	1.8e-11
WP_152423650.1|201096_201255_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_161617961.1|201357_201888_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_152423648.1|201998_203441_-	PAS domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	33.9	2.3e-08
WP_025568020.1|203492_204623_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_029732907.1|204771_205938_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	42.9	2.2e-81
WP_017872051.1|206057_206372_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017872052.1|206419_207721_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	66.0	7.4e-155
WP_025568017.1|207720_208182_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	37.2	5.9e-14
WP_164994045.1|208541_209525_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164994039.1|210122_210833_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	35.2	5.1e-25
WP_017872096.1|211518_211875_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	39.4	2.5e-12
WP_164994046.1|211907_212891_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP049360	Deinococcus wulumuqiensis R12 plasmid unnamed3, complete sequence	58965	0	14759	58965	integrase,transposase	Brevibacillus_phage(25.0%)	16	8650:8664	30370:30384
WP_017870362.1|602_842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871723.1|1917_2604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871719.1|4977_5253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871718.1|5249_5675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871717.1|5692_5998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025566623.1|6417_8061_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_152423795.1|8140_8875_+	hypothetical protein	NA	NA	NA	NA	NA
8650:8664	attL	AGGCCGCTGGTATCC	NA	NA	NA	NA
WP_081608334.1|9016_9742_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_152423794.1|9738_10362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423793.1|10331_10664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017871710.1|11007_11268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017871709.1|11726_12641_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.4	9.9e-21
WP_152423796.1|12786_13392_+	AAA family ATPase	NA	W8ECJ6	Mycobacterium_phage	33.9	2.6e-09
WP_152423792.1|13381_13645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081608333.1|13929_14397_+	hypothetical protein	NA	A0A2I7QIM4	Bacillus_phage	59.1	1.2e-06
WP_029732644.1|14420_14759_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	43.0	1.0e-15
30370:30384	attR	AGGCCGCTGGTATCC	NA	NA	NA	NA
>prophage 2
NZ_CP049360	Deinococcus wulumuqiensis R12 plasmid unnamed3, complete sequence	58965	31393	40425	58965		Catovirus(33.33%)	6	NA	NA
WP_017870390.1|31393_32812_+	hypothetical protein	NA	A0A1V0S949	Catovirus	30.4	1.1e-15
WP_152423600.1|32865_33825_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017870388.1|33899_34184_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_026138728.1|34238_36479_-	DNA polymerase	NA	A0A2I6UGB2	Salinibacter_virus	31.3	1.8e-87
WP_017870386.1|36681_38868_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025566640.1|39027_40425_+	DEAD/DEAH box helicase family protein	NA	B2CRJ8	Acidianus_filamentous_virus	23.3	4.3e-15
>prophage 3
NZ_CP049360	Deinococcus wulumuqiensis R12 plasmid unnamed3, complete sequence	58965	45482	52396	58965		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_017870380.1|45482_48704_+	type I restriction-modification system endonuclease	NA	A0A2K9V3E9	Faecalibacterium_phage	25.0	1.3e-11
WP_161617916.1|48708_50268_-	type I restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	33.6	1.4e-14
WP_017870379.1|50289_50634_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_025566632.1|50630_50852_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_017870377.1|50920_52396_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	1.8e-27
>prophage 1
NZ_CP049361	Deinococcus wulumuqiensis R12 plasmid unnamed4, complete sequence	43283	0	6763	43283		Bacillus_phage(100.0%)	4	NA	NA
WP_161617947.1|790_2077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870644.1|2673_2853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025566738.1|2944_5095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870646.1|5221_6763_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.9	1.6e-10
>prophage 2
NZ_CP049361	Deinococcus wulumuqiensis R12 plasmid unnamed4, complete sequence	43283	14379	15534	43283	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_164994048.1|14379_15534_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A068A1P5	Thermus_phage	49.3	8.5e-94
>prophage 3
NZ_CP049361	Deinococcus wulumuqiensis R12 plasmid unnamed4, complete sequence	43283	18916	38140	43283		Streptococcus_phage(14.29%)	20	NA	NA
WP_081608347.1|18916_21241_-	hypothetical protein	NA	A0A1P8VVQ6	Streptococcus_phage	24.6	5.3e-10
WP_152423628.1|21476_23168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870622.1|23225_23426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870623.1|23663_23861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870624.1|24078_26418_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	24.9	5.5e-15
WP_161617945.1|26440_27517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870626.1|27531_27948_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_017870627.1|27950_28310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870628.1|28347_29805_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	25.3	1.2e-28
WP_017870629.1|29801_31664_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	33.8	3.3e-23
WP_152423630.1|31709_32567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017870632.1|33048_33840_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	27.1	7.3e-12
WP_025566733.1|33836_34706_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.3	3.0e-11
WP_152423631.1|34876_35347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152423632.1|35355_35793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017870634.1|35985_36405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081608264.1|36406_36778_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_152423633.1|36990_37224_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_017870636.1|37220_37568_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_017870637.1|37564_38140_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	57.0	1.9e-30
