The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	153054	276227	4334932	transposase,tRNA	uncultured_virus(11.11%)	112	NA	NA
WP_164994329.1|153054_155247_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099325216.1|155700_157041_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	6.7e-26
WP_164994330.1|157269_157905_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_164995689.1|157986_159642_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164994331.1|159764_160457_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326467.1|160551_160887_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099325215.1|161225_161690_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	3.2e-36
WP_099325214.1|162039_163308_+	transcription antitermination factor NusB	NA	Q8W6C3	Saccharomonospora_phage	36.1	2.8e-05
WP_164995690.1|163665_164631_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_099325213.1|164627_165350_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_099325212.1|165446_166055_+	TIGR00730 family Rossman fold protein	NA	A0A1D3SNB7	Enterococcus_phage	37.3	3.0e-21
WP_164994332.1|166245_167529_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydE	NA	NA	NA	NA	NA
WP_099325210.1|167886_168306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994333.1|168591_169968_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydG	NA	NA	NA	NA	NA
WP_099325208.1|170117_170402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325207.1|170705_171125_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_157820513.1|172159_172678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325203.1|173477_176141_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	32.5	1.8e-46
WP_157820512.1|176140_176752_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_099327030.1|176778_178116_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_099325201.1|179143_184180_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_099325200.1|184176_184959_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099325199.1|184955_186089_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.7	1.9e-37
WP_164995691.1|186085_186376_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_099325198.1|186507_186642_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_099325197.1|186671_187073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323647.1|187296_188853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994334.1|189300_189546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994335.1|189532_189745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994336.1|189990_191385_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_164994337.1|191679_192123_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_164994338.1|192113_192833_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_164994339.1|192931_197206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994340.1|197558_198239_-	PIG-L family deacetylase	NA	I7KLN7	Campylobacter_virus	26.5	3.4e-10
WP_164994341.1|199203_199434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994342.1|199423_199873_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_164994343.1|200512_201775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994344.1|202112_202787_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_164994345.1|202783_203491_-	WbqC family protein	NA	NA	NA	NA	NA
WP_164994346.1|203487_204360_-	hypothetical protein	NA	E3SNR5	Prochlorococcus_phage	33.3	2.4e-08
WP_164994347.1|204359_205412_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_164994348.1|205408_206413_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_164994349.1|206433_207132_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_164994350.1|207125_208196_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_099326746.1|208374_209412_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164994351.1|209383_210025_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_164994352.1|210196_210496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994353.1|210508_211006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994354.1|211008_212583_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	E5EQ73	Micromonas_sp._RCC1109_virus	29.2	2.3e-25
WP_164994355.1|212548_212782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994356.1|212794_213778_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	33.6	2.7e-40
WP_099323675.1|215635_215854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323647.1|216001_217558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994357.1|217658_218567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323988.1|218845_220183_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_164994358.1|220387_220744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994359.1|221103_221679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994360.1|221762_223445_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164994361.1|223484_224438_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994362.1|224511_225549_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164994363.1|225554_225965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994364.1|226162_226582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994365.1|226828_227056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994366.1|227461_228799_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	7.7e-30
WP_164994367.1|229063_230014_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099324749.1|230010_231387_-|transposase	IS4-like element ISCku2 family transposase	transposase	NA	NA	NA	NA
WP_164995692.1|231898_232051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994368.1|232281_232500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994369.1|232520_233396_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VY82	Leptospira_phage	28.0	5.9e-23
WP_164995693.1|234231_234462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995694.1|234605_234842_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_099325158.1|234878_235325_-	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	58.4	6.1e-32
WP_164994370.1|235353_236517_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.2	1.8e-35
WP_164994371.1|236538_238728_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	40.2	1.8e-121
WP_099327026.1|238724_239381_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_099325155.1|239502_240843_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_099325154.1|240987_242193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325153.1|242185_242389_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_099325152.1|242375_242663_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_164994372.1|242739_243858_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	5.2e-32
WP_099325150.1|244376_245996_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.3e-166
WP_099325149.1|246045_246336_-	co-chaperone GroES	NA	A0A221S331	uncultured_virus	42.2	1.4e-16
WP_164994373.1|246425_248117_-	chaperonin GroEL	NA	A0A240F766	uncultured_virus	56.1	1.1e-158
WP_099325147.1|248586_249393_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_099325146.1|249487_250093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325145.1|250276_251050_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	28.1	2.1e-19
WP_099325143.1|251673_252360_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099325142.1|252426_252630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325141.1|252808_253543_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_164994374.1|253953_255843_+	radical SAM protein	NA	NA	NA	NA	NA
WP_099325139.1|255922_257998_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.6	5.7e-16
WP_099325138.1|258031_258397_+	response regulator	NA	NA	NA	NA	NA
WP_099325137.1|258517_259288_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_157820506.1|259451_259745_+	TIGR04076 family protein	NA	NA	NA	NA	NA
WP_099327025.1|259848_260121_+	ferredoxin:thioredoxin reductase	NA	NA	NA	NA	NA
WP_099325135.1|260159_260486_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.3	8.1e-18
WP_099325134.1|260491_261271_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	42.2	6.6e-50
WP_099325133.1|261254_261704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325132.1|261704_261977_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_099325131.1|262538_263804_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_099325130.1|263825_264728_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_164995695.1|265028_267383_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.2	6.9e-159
WP_164994375.1|267398_267872_+	universal stress protein	NA	NA	NA	NA	NA
WP_099325127.1|267955_268372_+	archease	NA	NA	NA	NA	NA
WP_099325126.1|268442_269894_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	44.3	7.6e-116
WP_099325125.1|269948_270653_+	dTMP kinase	NA	R4ZGJ3	Mythimna_separata_entomopoxvirus	23.4	1.1e-08
WP_099325124.1|270742_272137_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_099325123.1|272240_272723_+	gluconokinase	NA	NA	NA	NA	NA
WP_157820505.1|272979_273459_-	response regulator	NA	NA	NA	NA	NA
WP_164994376.1|273539_274766_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099325119.1|275069_275768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325118.1|275813_276227_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	1413087	1487372	4334932	transposase,tRNA	Paramecium_bursaria_Chlorella_virus(27.27%)	59	NA	NA
WP_099326979.1|1413087_1414743_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099324312.1|1415319_1415646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324311.1|1415642_1416347_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_099324310.1|1416343_1418095_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_099324309.1|1418907_1420083_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_099324308.1|1420268_1422038_+	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_157820394.1|1422050_1422782_-	glycosyltransferase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	37.2	1.2e-24
WP_099324306.1|1422858_1424049_-	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_099324305.1|1424419_1426297_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	39.4	1.1e-103
WP_099326978.1|1426450_1426930_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_099324304.1|1427506_1427722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324303.1|1427714_1428761_+	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
WP_099324302.1|1429102_1431433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994670.1|1431654_1433775_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_164994671.1|1433942_1435013_+	phosphotransacetylase family protein	NA	NA	NA	NA	NA
WP_164994672.1|1435470_1436742_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_164994673.1|1436710_1437493_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_164994674.1|1437623_1439339_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_099324290.1|1439393_1439720_-|tRNA	methionine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_099324289.1|1439861_1440596_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_099324288.1|1440975_1441359_+	RidA family protein	NA	NA	NA	NA	NA
WP_099324287.1|1441468_1443214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994675.1|1443246_1443723_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_164994676.1|1443746_1444439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994677.1|1444719_1446039_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.4	1.8e-87
WP_164995721.1|1446887_1449659_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	30.0	1.5e-27
WP_164994678.1|1449703_1449994_+	PqqD family protein	NA	NA	NA	NA	NA
WP_164994679.1|1450198_1452025_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HQK2	Paramecium_bursaria_Chlorella_virus	42.9	5.2e-122
WP_164994680.1|1452716_1453286_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_164994681.1|1454064_1456617_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_164994682.1|1456871_1457069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323887.1|1457244_1458348_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_164994683.1|1459294_1460599_+	nucleotide sugar dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	28.1	2.3e-31
WP_164994684.1|1461002_1461242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994685.1|1464772_1464916_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099323887.1|1466065_1467169_+|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_164994686.1|1467381_1467831_+	hypothetical protein	NA	Q84439	Paramecium_bursaria_Chlorella_virus	50.9	9.4e-25
WP_164994687.1|1468177_1469017_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164994688.1|1469110_1470532_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	33.0	3.7e-59
WP_164994689.1|1470775_1471132_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_164994690.1|1471235_1472579_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.3	5.0e-13
WP_164994691.1|1472667_1473378_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164994258.1|1473472_1473652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994692.1|1473663_1475547_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164994693.1|1475594_1476530_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_164994694.1|1476785_1477703_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164994695.1|1477721_1478306_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164994696.1|1478290_1479313_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_164994697.1|1479309_1479648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994698.1|1479677_1480247_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164994699.1|1481027_1481330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994700.1|1481329_1481560_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_164994701.1|1482054_1482474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994702.1|1482519_1483509_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	S5VY82	Leptospira_phage	28.5	3.6e-24
WP_164994703.1|1483782_1484004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994704.1|1484000_1484348_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_164994705.1|1484543_1485692_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.4	5.2e-43
WP_164994706.1|1485688_1486261_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164994707.1|1486334_1487372_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	1673332	1813337	4334932	transposase,capsid,protease,terminase	Pseudomonas_phage(10.71%)	119	NA	NA
WP_164994798.1|1673332_1674874_+|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	29.2	3.9e-46
WP_164994799.1|1674948_1676502_+	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	39.5	1.7e-65
WP_164994800.1|1676485_1677775_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	52.5	1.1e-76
WP_164994801.1|1677934_1678453_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_164994802.1|1678666_1678879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994803.1|1678952_1680017_+	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	31.1	2.7e-30
WP_164994804.1|1680101_1680488_+	DUF2190 family protein	NA	A0A0U4JPA4	Arthrobacter_phage	35.5	1.9e-05
WP_164994805.1|1680547_1680904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994806.1|1680985_1681963_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	27.8	9.3e-17
WP_164994807.1|1682044_1682476_+	DUF1320 domain-containing protein	NA	A0A2K9VH41	Faecalibacterium_phage	35.5	6.5e-15
WP_164994808.1|1682524_1682959_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_164994809.1|1682992_1683325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994810.1|1683324_1684059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994811.1|1684108_1684288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994812.1|1684277_1685546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994813.1|1685688_1686096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994814.1|1686023_1686437_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_164994815.1|1686540_1688631_+	hypothetical protein	NA	A0A140XG67	Salmonella_phage	34.7	6.0e-05
WP_164994816.1|1688714_1689311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994817.1|1689353_1691210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994818.1|1691279_1691741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994819.1|1691716_1695316_+	hypothetical protein	NA	A0A023MI24	Escherichia_phage	33.2	5.8e-16
WP_164994692.1|1695357_1697241_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164994820.1|1697423_1697714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994821.1|1697825_1701509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994259.1|1701520_1702174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994822.1|1702257_1703424_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099324106.1|1703713_1705129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324105.1|1705560_1707099_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.8e-28
WP_099324104.1|1707330_1708524_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.2	1.6e-42
WP_099324103.1|1708520_1709375_-	Fe-S cluster assembly protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	51.2	3.0e-27
WP_164994823.1|1709957_1711337_+	porin	NA	NA	NA	NA	NA
WP_099324101.1|1711415_1712390_+	PstS family phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_164994824.1|1712521_1714786_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099324099.1|1714782_1716384_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_099324098.1|1716448_1717216_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	1.1e-17
WP_157820363.1|1717220_1717358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326961.1|1717347_1718013_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_099324097.1|1718158_1719232_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_164994825.1|1719578_1722911_-	diguanylate cyclase	NA	A0A1V0SGX0	Hokovirus	28.5	1.3e-25
WP_099324095.1|1723398_1723587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324094.1|1723690_1724698_-	response regulator	NA	W8CYM9	Bacillus_phage	32.2	3.8e-13
WP_157820361.1|1725002_1727378_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_099324092.1|1727533_1727953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324090.1|1728868_1729738_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099324089.1|1729734_1731576_-	protein BatD	NA	NA	NA	NA	NA
WP_164994826.1|1732035_1732914_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157820360.1|1732930_1733845_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_099324086.1|1734001_1734997_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_099324085.1|1735174_1735690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994827.1|1735754_1736732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324083.1|1736805_1737687_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_099324082.1|1737696_1738686_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_164994828.1|1739375_1739720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324080.1|1739800_1740844_+	RNA 3'-phosphate cyclase	NA	NA	NA	NA	NA
WP_099324079.1|1740933_1741191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994829.1|1741820_1742006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994830.1|1742035_1743364_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326467.1|1743458_1743794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994831.1|1743906_1746390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323988.1|1746666_1748004_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_164994832.1|1748416_1749943_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_164994833.1|1750625_1752410_-	hypothetical protein	NA	A0A0S2MYI4	Enterococcus_phage	35.6	3.1e-10
WP_099324072.1|1752396_1754391_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_099324071.1|1754696_1755221_-	HAD-IIIA family hydrolase	NA	A0A140XBD6	Dickeya_phage	44.4	2.7e-23
WP_128704831.1|1755226_1756216_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E5EYK6	Acinetobacter_phage	34.8	8.5e-18
WP_157820358.1|1756665_1757682_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_099324068.1|1757867_1758131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994834.1|1758276_1759107_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_164994835.1|1759177_1759594_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_099324065.1|1759568_1760042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324064.1|1760354_1761701_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_099324063.1|1762097_1762487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326960.1|1762817_1763513_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_099324062.1|1763699_1764287_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_099324061.1|1764318_1765044_+	UMP kinase	NA	NA	NA	NA	NA
WP_164994836.1|1765049_1765610_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_099324059.1|1766221_1766728_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_099324058.1|1766731_1767181_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_164994837.1|1768080_1769454_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099324055.1|1769621_1770272_-	repressor LexA	NA	E5DV74	Deep-sea_thermophilic_phage	46.8	3.7e-22
WP_157820355.1|1770489_1770735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099324053.1|1770752_1770959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820354.1|1771227_1772601_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_164994838.1|1772637_1772787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324051.1|1773065_1773377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324050.1|1773562_1775182_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_099324049.1|1775674_1776922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994839.1|1776906_1777515_+	RNA ligase partner protein	NA	NA	NA	NA	NA
WP_164994840.1|1777626_1778853_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	7.4e-96
WP_164994841.1|1779459_1780581_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	9.5e-58
WP_099324045.1|1780900_1784176_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_099324044.1|1784274_1785618_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	37.0	1.2e-54
WP_157820352.1|1785669_1786374_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099324042.1|1786400_1787258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324041.1|1787727_1787979_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_099324040.1|1788088_1788319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994842.1|1788433_1791625_+	EAL domain-containing protein	NA	A0A1B0Z064	Pseudomonas_phage	39.4	2.0e-07
WP_099326959.1|1791771_1792779_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_157820351.1|1792851_1793811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324038.1|1793930_1794524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324036.1|1794891_1795206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994843.1|1795353_1796307_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_099324033.1|1797438_1797711_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_099324032.1|1797752_1799375_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_099326958.1|1799653_1799944_-	general glycosylation protein	NA	NA	NA	NA	NA
WP_099324031.1|1800552_1800753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326957.1|1800907_1801228_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_099326956.1|1801424_1801646_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	55.6	3.9e-08
WP_164994844.1|1802367_1802748_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_164994845.1|1802747_1802957_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_164994846.1|1803555_1804884_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326467.1|1804978_1805314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994847.1|1807344_1807566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994848.1|1807985_1808414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994849.1|1808523_1809525_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_164994850.1|1809521_1810463_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	40.9	3.7e-55
WP_164994851.1|1810736_1811087_+	hypothetical protein	NA	A0A1P8DJJ6	Virus_Rctr41k	42.2	4.2e-12
WP_164994852.1|1811999_1813337_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	5.0e-29
>prophage 5
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	1822161	1943337	4334932	transposase	Pseudomonas_phage(15.0%)	114	NA	NA
WP_164994858.1|1822161_1823499_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.7e-29
WP_164994859.1|1824001_1824295_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	60.8	2.8e-09
WP_164994860.1|1824373_1825462_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_099324019.1|1825612_1826632_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	24.9	1.0e-13
WP_099324018.1|1826781_1827564_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_099324017.1|1827840_1828578_-	serine O-acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	32.4	3.7e-10
WP_099324016.1|1828577_1829507_-	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	54.2	3.8e-84
WP_099324014.1|1829733_1829934_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_099324013.1|1830385_1831330_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	5.4e-22
WP_099324012.1|1831330_1832041_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164994861.1|1832037_1833741_+	GldG family protein	NA	NA	NA	NA	NA
WP_164994862.1|1833904_1836334_+	DUF4340 domain-containing protein	NA	NA	NA	NA	NA
WP_099324009.1|1836376_1837777_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.9	3.5e-25
WP_157820349.1|1837925_1838087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324008.1|1838128_1838803_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	1.6e-31
WP_099324007.1|1838780_1840211_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.9	2.0e-31
WP_164994863.1|1840388_1841510_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_099323647.1|1841743_1843300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994864.1|1843472_1844273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994865.1|1844363_1845173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994866.1|1845297_1846284_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_164994867.1|1846433_1847711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994868.1|1847710_1847989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161081522.1|1848546_1848948_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_161081509.1|1849354_1849993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161081508.1|1850031_1850484_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164994869.1|1850377_1851592_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323525.1|1851594_1852386_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099326453.1|1852921_1853443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994260.1|1854459_1854639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326455.1|1854854_1856048_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_099326456.1|1856452_1857214_+	precorrin-6A reductase	NA	NA	NA	NA	NA
WP_157820699.1|1857311_1857467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994870.1|1857544_1858204_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_164994871.1|1858265_1859423_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_164994872.1|1859745_1861287_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_099326460.1|1861530_1862163_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_099326461.1|1862407_1863958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326462.1|1864317_1864614_-	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_099326463.1|1865023_1865329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326464.1|1865480_1867511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994873.1|1867889_1869218_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099326467.1|1869312_1869648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326468.1|1869890_1870217_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_157820701.1|1870425_1870701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327106.1|1871796_1873020_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	61.1	1.2e-10
WP_164995728.1|1873485_1873731_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_099326470.1|1873779_1874229_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_099326471.1|1874247_1875468_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_164994874.1|1875566_1876805_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_164994875.1|1876810_1878280_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099326474.1|1878284_1879745_+	radical SAM protein	NA	NA	NA	NA	NA
WP_099326475.1|1879932_1881357_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.9	7.4e-39
WP_164994876.1|1881671_1882229_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_099324748.1|1882347_1883298_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099324749.1|1883294_1884671_-|transposase	IS4-like element ISCku2 family transposase	transposase	NA	NA	NA	NA
WP_164994877.1|1884894_1886322_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164994724.1|1886692_1888558_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995729.1|1888562_1888877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099324416.1|1888895_1889363_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	35.2	2.7e-14
WP_099324415.1|1889362_1889791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994878.1|1890453_1890798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820838.1|1891045_1891138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995730.1|1891150_1891387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994724.1|1891521_1893387_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326928.1|1893561_1893729_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_099323553.1|1893877_1894936_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_157775565.1|1895259_1895520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994261.1|1896924_1897080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323551.1|1897122_1897821_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.5	6.4e-12
WP_157775562.1|1897841_1899584_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_099323550.1|1899891_1900620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323549.1|1900749_1902048_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.9e-82
WP_099323548.1|1902061_1902688_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157775559.1|1902697_1904158_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_099323546.1|1904226_1904649_-	response regulator	NA	NA	NA	NA	NA
WP_099323545.1|1904825_1905269_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.2	1.9e-33
WP_099323543.1|1906733_1907204_+	bacterioferritin	NA	NA	NA	NA	NA
WP_099326927.1|1907481_1907631_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099323542.1|1907600_1907840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611520.1|1908232_1909570_+|transposase	IS1380-like element ISCku8 family transposase	transposase	NA	NA	NA	NA
WP_157775556.1|1909954_1910116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323540.1|1910346_1911720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323539.1|1912062_1912653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323538.1|1912809_1913553_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	5.4e-17
WP_164994879.1|1913740_1914085_+	muconolactone delta-isomerase	NA	NA	NA	NA	NA
WP_099323536.1|1914372_1915140_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_099323535.1|1915587_1915863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323889.1|1916139_1916607_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164994880.1|1916569_1917898_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164994881.1|1918001_1918850_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.2	3.6e-33
WP_099323988.1|1919972_1921310_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_164994882.1|1922063_1923071_+	radical SAM protein	NA	NA	NA	NA	NA
WP_164994883.1|1923187_1923496_+	PqqD family protein	NA	NA	NA	NA	NA
WP_161081509.1|1924941_1925580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161081508.1|1925618_1926071_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164994869.1|1925964_1927179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323525.1|1927181_1927973_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_099326783.1|1929288_1929777_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_099326782.1|1929809_1931096_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_164995731.1|1931291_1931615_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_164994884.1|1931656_1932109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326780.1|1932529_1934203_+	adenylyl-sulfate reductase subunit alpha	NA	NA	NA	NA	NA
WP_099326779.1|1934202_1934520_+	adenylylsulfate reductase	NA	NA	NA	NA	NA
WP_099326778.1|1934615_1935785_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	31.4	8.7e-46
WP_099326777.1|1936436_1938173_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	27.5	2.7e-19
WP_099326776.1|1938376_1938685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326775.1|1939119_1939380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326774.1|1939380_1939581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994885.1|1939995_1940382_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099326507.1|1940939_1941473_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164995732.1|1941483_1942011_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164994886.1|1942214_1942907_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_099323889.1|1942869_1943337_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	2060319	2172885	4334932	transposase,integrase,tRNA	Clostridium_phage(21.43%)	105	2071472:2071493	2107634:2107655
WP_164994924.1|2060319_2060745_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	27.4	4.8e-10
WP_164994925.1|2062115_2062316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994926.1|2062470_2062965_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_164994927.1|2062993_2063446_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_099323558.1|2063598_2064165_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_164994928.1|2065031_2065871_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	23.3	3.0e-08
WP_164994929.1|2066194_2067391_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_099326483.1|2067416_2067974_+	elongation factor P	NA	NA	NA	NA	NA
WP_164994930.1|2068189_2069173_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_164994931.1|2069229_2070339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994932.1|2070328_2071252_+	radical SAM protein	NA	NA	NA	NA	NA
2071472:2071493	attL	ATTAAATATTTTGCCAAAAAGC	NA	NA	NA	NA
WP_164994933.1|2071524_2072067_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	43.8	9.6e-32
WP_164994934.1|2072465_2073104_+	nitroreductase	NA	NA	NA	NA	NA
WP_164994935.1|2073276_2074698_+	DUF4139 domain-containing protein	NA	NA	NA	NA	NA
WP_099326491.1|2075096_2075291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994936.1|2076467_2078735_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164994937.1|2079402_2080005_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_164994938.1|2080727_2080964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994939.1|2081084_2081336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994940.1|2081665_2082610_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099323887.1|2082858_2083962_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099327108.1|2084639_2085086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994941.1|2085457_2085943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994942.1|2086266_2086800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326500.1|2088024_2088657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326501.1|2088657_2089200_+	DUF2764 family protein	NA	NA	NA	NA	NA
WP_099326502.1|2089189_2090959_+	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_099326503.1|2090939_2092253_+	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_099326504.1|2092852_2093461_+	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_099326505.1|2093457_2095209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327109.1|2095273_2095708_+	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_099327110.1|2095734_2095914_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099326506.1|2095841_2096369_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326507.1|2096379_2096913_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326508.1|2097052_2097205_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099326509.1|2097201_2097381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995734.1|2097696_2099760_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_164994943.1|2099740_2099908_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_099326511.1|2100774_2100996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994944.1|2101052_2101508_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_157820709.1|2101593_2102553_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_099327112.1|2103075_2103363_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_099326514.1|2103527_2103734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326515.1|2103730_2104420_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_099326516.1|2104677_2104974_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	46.2	9.3e-13
WP_099326517.1|2105647_2106376_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_157820710.1|2106629_2107598_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_164995735.1|2108133_2108865_+	precorrin-8X methylmutase	NA	NA	NA	NA	NA
2107634:2107655	attR	GCTTTTTGGCAAAATATTTAAT	NA	NA	NA	NA
WP_099326520.1|2109030_2110104_+	cobalamin biosynthesis protein CbiD	NA	NA	NA	NA	NA
WP_099326521.1|2110088_2110739_+	precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE	NA	NA	NA	NA	NA
WP_157820711.1|2110831_2110987_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_099326522.1|2111155_2111359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326523.1|2111336_2111669_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_099326524.1|2111812_2112607_+	DUF2034 domain-containing protein	NA	NA	NA	NA	NA
WP_164994945.1|2112682_2113405_+	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_099323925.1|2113954_2114971_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164994946.1|2115355_2115907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994947.1|2115863_2116994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994948.1|2117016_2119164_+	Vps62-related protein	NA	A0A1V0SEH2	Indivirus	30.2	1.0e-12
WP_164994949.1|2119966_2121076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994950.1|2121204_2122461_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
WP_164994951.1|2122677_2123388_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_164994952.1|2123391_2124921_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_099326439.1|2125171_2126854_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164994953.1|2126947_2127352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994924.1|2127470_2127896_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	27.4	4.8e-10
WP_164995736.1|2128447_2129602_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	35.5	4.5e-55
WP_164994954.1|2129647_2130742_-	deoxyhypusine synthase	NA	NA	NA	NA	NA
WP_164994955.1|2130947_2131955_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_164994956.1|2132275_2132611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326538.1|2133098_2134115_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_099326539.1|2134173_2134428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326540.1|2134525_2135026_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_099326541.1|2135053_2136241_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_099326542.1|2136333_2137311_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_099326543.1|2137545_2139243_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	36.6	4.4e-91
WP_099327113.1|2139644_2140277_+	endonuclease III	NA	NA	NA	NA	NA
WP_099326544.1|2140457_2140661_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326545.1|2140837_2141176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326096.1|2141243_2141669_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	27.4	1.3e-10
WP_164995737.1|2141733_2141997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326547.1|2142208_2143393_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_164994957.1|2144380_2146294_-	response regulator	NA	A0A1V0SGX0	Hokovirus	25.2	2.1e-12
WP_164994958.1|2146661_2147672_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_099326551.1|2147762_2148338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994959.1|2148759_2150097_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	2.9e-29
WP_099326552.1|2150237_2151257_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_164994960.1|2151253_2152684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820714.1|2152680_2153538_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_099326555.1|2153543_2154536_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_099326556.1|2154878_2156618_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_157820715.1|2157265_2157559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820716.1|2157701_2158022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994961.1|2159779_2160106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994962.1|2160283_2160790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994963.1|2161331_2163524_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	34.4	5.5e-09
WP_164994964.1|2163587_2163974_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_164994965.1|2163970_2168026_+	cobaltochelatase subunit CobN	NA	NA	NA	NA	NA
WP_164994966.1|2168396_2169059_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_164994967.1|2169119_2169473_+	DUF2149 domain-containing protein	NA	NA	NA	NA	NA
WP_164994968.1|2169714_2170404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994969.1|2170387_2171458_-	radical SAM protein	NA	NA	NA	NA	NA
WP_164994970.1|2171688_2171859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994971.1|2171890_2172496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994972.1|2172642_2172885_+|transposase	transposase	transposase	Q9JMP3	Wolbachia_phage	49.3	3.1e-14
>prophage 8
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	2256197	2307504	4334932	transposase	Burkholderia_virus(33.33%)	43	NA	NA
WP_099326869.1|2256197_2256686_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_164994990.1|2257144_2258536_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164994991.1|2258643_2259144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994992.1|2259250_2260003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325441.1|2260004_2260943_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_164994993.1|2260983_2261853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326862.1|2262164_2262488_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326653.1|2262810_2263014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820771.1|2263000_2263327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327142.1|2264043_2264250_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_099326860.1|2264265_2264466_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_157820770.1|2265207_2265447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994692.1|2267616_2269500_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099323525.1|2270603_2271395_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164994869.1|2271397_2272612_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994994.1|2272505_2272958_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161081509.1|2272996_2273635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994995.1|2274023_2274413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994996.1|2274399_2276265_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325794.1|2277116_2278373_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
WP_099326856.1|2279379_2279703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994997.1|2279952_2281623_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099326853.1|2281925_2282342_+	NAD(P)H-quinone oxidoreductase subunit 3	NA	NA	NA	NA	NA
WP_099326852.1|2282348_2282987_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_164994998.1|2283021_2284767_+	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_099326850.1|2284782_2285247_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_099327141.1|2285252_2286527_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_164994999.1|2286530_2289245_+	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_099326848.1|2289744_2290701_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_099326847.1|2290736_2291252_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_099327140.1|2291276_2291831_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_099326846.1|2291827_2292136_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_099326845.1|2292137_2294018_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_099326844.1|2294014_2295652_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_099326843.1|2295638_2297096_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_099326842.1|2297434_2298184_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	4.9e-18
WP_164995000.1|2298183_2299701_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099326840.1|2300453_2300693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326839.1|2301136_2301355_+	DUF2945 domain-containing protein	NA	NA	NA	NA	NA
WP_157820768.1|2302129_2302267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099327139.1|2303221_2303674_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_099326838.1|2303872_2305879_+	transketolase	NA	NA	NA	NA	NA
WP_099323988.1|2306166_2307504_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
>prophage 10
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	2482773	2558238	4334932	transposase	Streptococcus_phage(18.18%)	54	NA	NA
WP_099326422.1|2482773_2484144_-|transposase	IS66-like element ISCku7 family transposase	transposase	NA	NA	NA	NA
WP_099325006.1|2484130_2485012_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_164995044.1|2485178_2486495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326629.1|2487141_2487396_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099326631.1|2489389_2490541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995741.1|2491126_2499691_+	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_099326632.1|2500249_2501341_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.0	1.1e-31
WP_164995045.1|2501525_2502335_+	cobalamin biosynthesis protein CbiG	NA	NA	NA	NA	NA
WP_099326634.1|2502328_2503087_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_164995046.1|2503228_2504260_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_099326636.1|2504262_2505090_+	oxidoreductase	NA	NA	NA	NA	NA
WP_099326637.1|2505086_2505827_+	NADH:ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_099326638.1|2505846_2507136_+	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_164995689.1|2507562_2509218_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995047.1|2509180_2509732_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_164995742.1|2510168_2510282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995048.1|2510869_2511007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995049.1|2511219_2511819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820725.1|2512466_2512778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326656.1|2512924_2513227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326657.1|2513453_2514209_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.6e-24
WP_099326658.1|2514301_2515807_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_099326659.1|2515813_2516380_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_099326660.1|2516539_2517976_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	34.8	1.5e-63
WP_099326661.1|2518012_2519710_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	37.0	3.0e-39
WP_099326662.1|2519878_2520589_-	endonuclease V	NA	NA	NA	NA	NA
WP_157820726.1|2520841_2521000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326664.1|2521651_2523109_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.2	2.0e-55
WP_099326665.1|2523364_2523811_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099326666.1|2523850_2524282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326667.1|2524622_2526017_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	31.1	1.9e-10
WP_099326668.1|2526243_2526612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995050.1|2526641_2529836_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_099326670.1|2529845_2531465_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	34.5	5.2e-41
WP_099326671.1|2533210_2535886_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_099326672.1|2535895_2536210_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099326673.1|2536197_2536386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995051.1|2536585_2538283_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.8	8.7e-87
WP_164995052.1|2538405_2538555_-	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_164995053.1|2538788_2540255_-	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	30.0	4.5e-15
WP_164995054.1|2540354_2543249_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	44.3	8.3e-231
WP_099326677.1|2543656_2544184_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_099326678.1|2544221_2544953_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_099326679.1|2544956_2545988_-	RnfABCDGE type electron transport complex subunit D	NA	NA	NA	NA	NA
WP_157820727.1|2546038_2547355_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_099326681.1|2548499_2549456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995055.1|2549581_2550166_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_099326683.1|2550185_2550404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995056.1|2550417_2553114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820729.1|2553119_2553722_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_164995057.1|2554390_2554606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323988.1|2554950_2556288_-|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_164995058.1|2556367_2557456_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099323889.1|2557770_2558238_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	2621021	2673235	4334932	transposase,protease	Lactococcus_phage(16.67%)	52	NA	NA
WP_164994724.1|2621021_2622887_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326725.1|2623742_2624666_-	agmatinase	NA	NA	NA	NA	NA
WP_099326726.1|2625247_2627002_-	hydroxylamine oxidoreductase	NA	NA	NA	NA	NA
WP_157820736.1|2627085_2628177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995078.1|2628214_2628937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326728.1|2628978_2629749_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_099326729.1|2629831_2631577_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099326730.1|2631611_2632133_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_099327129.1|2632496_2632706_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_099326731.1|2632787_2633207_-	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_099327130.1|2633248_2634163_-	cysteine synthase family protein	NA	C3U2M1	Lactococcus_phage	37.3	4.4e-45
WP_099326732.1|2634196_2634616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099327131.1|2634629_2635520_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_099326733.1|2635666_2636305_-	bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase	NA	NA	NA	NA	NA
WP_164995079.1|2636318_2637608_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_099326735.1|2637613_2638996_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_099326736.1|2639286_2639622_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_164995080.1|2640528_2641026_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099326738.1|2641018_2641255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326739.1|2641349_2641634_-	addiction module protein	NA	NA	NA	NA	NA
WP_099326740.1|2641879_2642062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326741.1|2642142_2642448_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_099326742.1|2642444_2642666_-	addiction module protein	NA	NA	NA	NA	NA
WP_099326743.1|2643143_2643410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326744.1|2644140_2644362_-	addiction module protein	NA	NA	NA	NA	NA
WP_099327132.1|2644655_2644865_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_099326745.1|2644912_2645221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995081.1|2645337_2645733_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076611516.1|2645770_2647174_-|transposase	IS4-like element ISCku4 family transposase	transposase	NA	NA	NA	NA
WP_164995082.1|2647235_2647559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995744.1|2647678_2648353_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099326747.1|2649570_2649837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326748.1|2650541_2651357_-	response regulator	NA	W8CYM9	Bacillus_phage	35.2	8.0e-14
WP_099327133.1|2651514_2652456_-	hypothetical protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	37.4	6.4e-31
WP_099326749.1|2652716_2654345_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.3	1.6e-42
WP_099326750.1|2654475_2654931_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_099326751.1|2654893_2655082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820737.1|2655395_2655545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326752.1|2656322_2656592_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099326753.1|2656953_2657202_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_099323887.1|2658252_2659356_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_157820738.1|2659666_2660680_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099326757.1|2660651_2661692_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_164995083.1|2661673_2662525_+	LpxI family protein	NA	NA	NA	NA	NA
WP_157820739.1|2662779_2663403_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_164995084.1|2664227_2665358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099327134.1|2665586_2666723_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_099327135.1|2666819_2667806_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.9	3.0e-23
WP_099326761.1|2667816_2668746_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	2.2e-23
WP_099326762.1|2668751_2669750_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_099326764.1|2670302_2670536_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_164995064.1|2671465_2673235_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	2676790	2730800	4334932	transposase,integrase,protease	Enterobacteria_phage(16.67%)	48	2669859:2669891	2725786:2725818
2669859:2669891	attL	ATGTCCCCCGCTGGCGGGGGTGCAGGGGGTGGA	NA	NA	NA	NA
WP_164995090.1|2676790_2677468_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_161081509.1|2677856_2678495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161081508.1|2678533_2678986_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164994869.1|2678879_2680094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323525.1|2680096_2680888_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164995091.1|2681225_2681603_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164995092.1|2682514_2683390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995093.1|2683487_2685362_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099326770.1|2685661_2686027_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099326771.1|2686438_2687176_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_164995094.1|2687604_2689635_+	glycogen debranching protein	NA	NA	NA	NA	NA
WP_099323672.1|2689747_2690224_-	bacterioferritin	NA	NA	NA	NA	NA
WP_164995095.1|2690515_2690671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995096.1|2690982_2691129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995745.1|2691663_2692143_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.9	3.3e-28
WP_099323675.1|2692126_2692345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995097.1|2692457_2693261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070065843.1|2694391_2695870_-|transposase	ISNCY-like element ISCku10 family transposase	transposase	NA	NA	NA	NA
WP_099323678.1|2696073_2696481_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164995098.1|2696625_2697180_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164995099.1|2697704_2701112_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	28.8	5.7e-37
WP_164995100.1|2701132_2702134_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_164995101.1|2702412_2702712_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_164995102.1|2702735_2702903_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323684.1|2703176_2703467_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_164995103.1|2703612_2704446_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	45.8	9.5e-55
WP_164995104.1|2704492_2704912_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_164995105.1|2705013_2708592_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_099323688.1|2708885_2709605_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164995106.1|2709798_2710479_-	hypothetical protein	NA	A0ZS58	Staphylococcus_virus	34.6	1.5e-13
WP_164995107.1|2711925_2714193_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157775639.1|2714242_2714452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323693.1|2714753_2715302_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_099323694.1|2715376_2715667_-	coiled coil domain-containing protein	NA	NA	NA	NA	NA
WP_099323695.1|2715683_2715839_-	DUF3309 domain-containing protein	NA	NA	NA	NA	NA
WP_099323696.1|2715915_2716092_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_099323697.1|2716241_2717201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995108.1|2717386_2718343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995109.1|2718345_2718699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995110.1|2718720_2720421_-	cytochrome P460 family protein	NA	NA	NA	NA	NA
WP_164995111.1|2720675_2722097_-|transposase	IS66-like element ISCku5 family transposase	transposase	NA	NA	NA	NA
WP_164995112.1|2722459_2722633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995113.1|2723134_2724145_-	DUF1326 domain-containing protein	NA	NA	NA	NA	NA
WP_099323702.1|2724265_2725651_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_099323703.1|2725972_2726437_-	DNA-binding protein	NA	NA	NA	NA	NA
2725786:2725818	attR	ATGTCCCCCGCTGGCGGGGGTGCAGGGGGTGGA	NA	NA	NA	NA
WP_157775648.1|2727979_2728705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323705.1|2728751_2729120_-	response regulator	NA	W8CYM9	Bacillus_phage	35.1	2.7e-09
WP_164995114.1|2729543_2730800_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	26.6	7.2e-06
>prophage 13
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	2995650	3023789	4334932	transposase	Streptococcus_phage(25.0%)	15	NA	NA
WP_099323988.1|2995650_2996988_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_164995195.1|2997122_2999045_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995196.1|2999798_3000218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995197.1|3000813_3002151_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	23.0	4.4e-09
WP_164995198.1|3002781_3004065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995199.1|3004265_3005639_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_164995200.1|3006457_3007417_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	35.4	8.4e-47
WP_164995201.1|3007907_3008927_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_164995202.1|3009259_3013987_-	hypothetical protein	NA	A0A1B1IUC7	uncultured_Mediterranean_phage	32.9	3.7e-10
WP_164995203.1|3015294_3015543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995204.1|3017033_3018290_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_164995205.1|3018957_3019347_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164994692.1|3019434_3021318_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_131493161.1|3021361_3022039_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323925.1|3022772_3023789_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	3029778	3100120	4334932	transposase	Catovirus(28.57%)	55	NA	NA
WP_164995208.1|3029778_3029991_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164995209.1|3030565_3030733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099323647.1|3031749_3033306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995210.1|3033406_3033676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995211.1|3033920_3035171_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_161081509.1|3035559_3036198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994994.1|3036236_3036689_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164994869.1|3036582_3037797_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164995212.1|3037799_3038396_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164995213.1|3038487_3040170_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995214.1|3040413_3041649_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_164995751.1|3041675_3042425_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_164995215.1|3042632_3043673_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.7	1.4e-07
WP_164995216.1|3043653_3045162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995217.1|3045168_3047181_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	27.7	7.7e-26
WP_164995218.1|3047218_3047896_-	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	29.1	1.1e-05
WP_164995219.1|3047915_3049388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995220.1|3049450_3050200_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_164995221.1|3050207_3051083_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_164995222.1|3051278_3052448_-	phosphotransferase	NA	NA	NA	NA	NA
WP_164995223.1|3052452_3053226_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164995224.1|3053386_3054637_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164995225.1|3054639_3055959_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	1.1e-09
WP_164995226.1|3056362_3057232_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_164995227.1|3057404_3058133_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164995228.1|3058281_3059577_-	DUF4910 domain-containing protein	NA	NA	NA	NA	NA
WP_164995229.1|3059605_3060157_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	39.3	3.5e-29
WP_164995230.1|3060199_3061432_-	class I SAM-dependent methyltransferase	NA	A0A1C9C5J0	Heterosigma_akashiwo_virus	29.0	8.6e-44
WP_164995231.1|3061428_3062511_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	26.4	3.9e-16
WP_164995232.1|3062504_3063278_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_164995233.1|3064055_3064334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995234.1|3064721_3072032_-	hypothetical protein	NA	A0A1B1IUC7	uncultured_Mediterranean_phage	31.8	5.2e-11
WP_164995235.1|3073918_3074161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995236.1|3075021_3075216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995237.1|3075510_3076221_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164995238.1|3076290_3077052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995752.1|3077683_3078256_-	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	36.8	1.1e-22
WP_164995239.1|3078810_3079335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995240.1|3079715_3079853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995241.1|3080302_3081283_-	GHMP kinase	NA	A0A067XQL1	Caulobacter_phage	40.0	8.9e-44
WP_164995242.1|3081288_3083187_-	HAD-IIIA family hydrolase	NA	A0A1V0SB89	Catovirus	26.1	6.6e-11
WP_164995243.1|3083194_3084157_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	29.0	3.8e-23
WP_164995244.1|3084246_3084621_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_164995245.1|3084738_3085857_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_164995246.1|3085964_3086282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995247.1|3086929_3087625_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164995248.1|3087642_3088857_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_164995249.1|3088853_3090035_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_164995250.1|3090214_3091216_-	radical SAM protein	NA	NA	NA	NA	NA
WP_164995251.1|3091403_3092741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995252.1|3092745_3093627_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_164995253.1|3093668_3094577_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.0	7.3e-08
WP_164995753.1|3095172_3096759_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_164995254.1|3097023_3097863_-	sugar transporter	NA	NA	NA	NA	NA
WP_099323988.1|3098782_3100120_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
>prophage 15
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	3103878	3166345	4334932	transposase,bacteriocin	Micromonas_pusilla_virus(40.0%)	57	NA	NA
WP_164994692.1|3103878_3105762_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995258.1|3105849_3106680_+	hypothetical protein	NA	G8DDL3	Micromonas_pusilla_virus	29.6	6.2e-14
WP_164995259.1|3106790_3107549_-	FliA/WhiG family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_164995260.1|3107706_3107994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995261.1|3108650_3109496_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_164995262.1|3109733_3111821_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_128705196.1|3111898_3112948_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_128705195.1|3112954_3113737_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_164995263.1|3113878_3114148_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_164995754.1|3114762_3115527_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_164995264.1|3115750_3116215_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_099323647.1|3116900_3118457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995265.1|3118652_3119015_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_164995266.1|3119046_3120003_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_099323977.1|3120051_3120612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323978.1|3120685_3121411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323979.1|3121432_3121897_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_164995755.1|3122005_3123325_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_099323981.1|3123324_3124026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323982.1|3124022_3125051_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_099323983.1|3125080_3126835_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_164995267.1|3127182_3127407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099323985.1|3128016_3128319_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_164995268.1|3128866_3129271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995269.1|3129328_3129934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099323989.1|3130507_3131377_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_164995270.1|3131390_3134258_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	30.1	5.2e-84
WP_099323991.1|3134554_3135340_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_164995271.1|3135477_3135966_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_099323988.1|3136112_3137450_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.7	1.0e-29
WP_164994536.1|3137866_3139519_+	NADH-quinone oxidoreductase subunit F	NA	NA	NA	NA	NA
WP_099323994.1|3139719_3140901_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_164995272.1|3140904_3141603_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_164995273.1|3141612_3143151_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_099323997.1|3143528_3143954_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_164995274.1|3143988_3144399_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_164995275.1|3144532_3145039_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	41.5	4.2e-21
WP_099326955.1|3145387_3145813_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_164995276.1|3146129_3146792_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_164995277.1|3146840_3148709_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	44.7	1.0e-133
WP_164995278.1|3148748_3149030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995279.1|3149059_3149686_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_099323525.1|3150032_3150824_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164994869.1|3150826_3152041_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994994.1|3151934_3152387_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161081509.1|3152425_3153064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995756.1|3153510_3153936_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157820697.1|3153916_3154030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995280.1|3154307_3154859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326449.1|3154812_3156564_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_099326448.1|3156739_3157210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326446.1|3157783_3160075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099326445.1|3160077_3160740_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_099326444.1|3161153_3161471_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_157820695.1|3161545_3162589_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_099326442.1|3162697_3165256_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_157820694.1|3165259_3166345_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
>prophage 16
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	3517009	3536049	4334932	transposase,tRNA	Staphylococcus_phage(50.0%)	15	NA	NA
WP_164995370.1|3517009_3519511_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.9	5.0e-208
WP_164995762.1|3521135_3521462_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_164995371.1|3521650_3522127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995372.1|3522172_3522601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994891.1|3523405_3524302_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.3	2.2e-33
WP_099323535.1|3524320_3524596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326688.1|3524784_3525135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995763.1|3525709_3527365_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995373.1|3528090_3530358_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164995764.1|3530637_3531051_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164995374.1|3531013_3531520_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164995375.1|3531565_3531895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995376.1|3532004_3532634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326746.1|3532660_3533698_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164995377.1|3535386_3536049_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	3741470	3802146	4334932	transposase,protease	Bacillus_phage(14.29%)	53	NA	NA
WP_164995433.1|3741470_3743495_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_164995434.1|3743584_3743881_+	DNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_164995435.1|3743942_3744137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995436.1|3744521_3744812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995437.1|3744936_3746529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994263.1|3746702_3746954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995438.1|3747037_3747352_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_164995439.1|3747348_3747555_-	addiction module protein	NA	NA	NA	NA	NA
WP_164995440.1|3747846_3749043_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_164995441.1|3749157_3749715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325967.1|3749848_3750667_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_164995442.1|3751088_3751922_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_099325965.1|3752128_3753577_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.7	2.5e-18
WP_164994692.1|3755651_3757535_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995443.1|3758293_3759109_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_099327078.1|3759243_3759567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325963.1|3760486_3761422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325962.1|3761464_3762136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820625.1|3762199_3762598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325960.1|3763012_3763357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325959.1|3763725_3764367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325958.1|3764539_3766270_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	58.9	2.8e-165
WP_157820624.1|3766632_3766764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325957.1|3766969_3767794_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_099327077.1|3768156_3768819_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.8	9.3e-37
WP_099323544.1|3769182_3770520_+|transposase	IS1380-like element ISCku8 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.5	7.7e-30
WP_099325956.1|3770802_3771294_+	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_164995444.1|3771399_3772614_+	pyruvate synthase	NA	NA	NA	NA	NA
WP_099325955.1|3773361_3774783_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_099325954.1|3774788_3775580_+	pyruvate synthase	NA	NA	NA	NA	NA
WP_099325953.1|3775713_3776355_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_164995445.1|3776443_3777160_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_164995446.1|3777164_3778088_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_164995447.1|3778104_3779286_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	31.8	4.1e-35
WP_157820623.1|3779392_3780280_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_164995448.1|3781219_3782815_+|protease	serine protease	protease	NA	NA	NA	NA
WP_164995449.1|3783024_3783486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995772.1|3783622_3784651_+	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_164995450.1|3784725_3785331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995451.1|3786168_3787359_-	CfrBI family restriction endonuclease	NA	NA	NA	NA	NA
WP_164995452.1|3787355_3788567_-	site-specific DNA-methyltransferase	NA	A0A0B5IWU9	Pandoravirus	29.1	1.0e-20
WP_164995453.1|3789752_3789941_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_164995454.1|3789937_3790108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995455.1|3790139_3791246_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_164995456.1|3791265_3792315_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_164995457.1|3792315_3793677_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_164995458.1|3793784_3795809_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.6	1.9e-112
WP_164995459.1|3796228_3797185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995460.1|3797201_3797447_+	small basic protein	NA	NA	NA	NA	NA
WP_164995461.1|3797443_3798535_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_164995462.1|3798890_3800426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325926.1|3800622_3800868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995463.1|3801108_3802146_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	3809235	3932475	4334932	transposase,integrase,protease	Hokovirus(11.76%)	109	3873122:3873181	3932565:3934419
WP_099326439.1|3809235_3810918_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_099325790.1|3811162_3811432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157820605.1|3811659_3812493_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_099327065.1|3812611_3813784_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_099325788.1|3814158_3815769_-	hydroxylamine oxidoreductase	NA	NA	NA	NA	NA
WP_164995467.1|3816712_3819166_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_157820604.1|3819717_3820131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325785.1|3820132_3820432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325784.1|3820473_3821244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325783.1|3821266_3822292_-	2-oxoglutarate synthase subunit alpha	NA	NA	NA	NA	NA
WP_099325782.1|3822284_3822497_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_099325781.1|3822776_3823613_-	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	32.1	7.4e-31
WP_164995468.1|3823705_3824323_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164995469.1|3824427_3825849_-|transposase	IS66-like element ISCku5 family transposase	transposase	NA	NA	NA	NA
WP_099325778.1|3826121_3826442_-	DsrE family protein	NA	NA	NA	NA	NA
WP_164995470.1|3826438_3827599_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.0	7.1e-40
WP_099325776.1|3827634_3827985_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099325775.1|3827997_3829158_-	hypothetical protein	NA	S5VL21	Leptospira_phage	26.8	1.1e-16
WP_164995471.1|3829463_3831257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325771.1|3831359_3832178_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_164995472.1|3832372_3832726_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099325769.1|3833008_3833422_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164995473.1|3833538_3833742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325768.1|3833911_3834283_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_099325767.1|3834279_3834522_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_099327064.1|3835125_3835641_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_164995474.1|3836273_3837329_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164995773.1|3837665_3838751_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.8	3.7e-51
WP_164995475.1|3838768_3839644_-	HAD-IC family P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.5	7.8e-23
WP_164995476.1|3839706_3839865_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_099327063.1|3839980_3840379_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_164995774.1|3840626_3841166_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_164995477.1|3841168_3842518_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	26.9	1.2e-38
WP_099325760.1|3842733_3843471_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A2P9FI75	Pseudomonas_phage	30.9	5.9e-08
WP_099325759.1|3843661_3844093_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_099325757.1|3845121_3846156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995478.1|3846447_3847350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995479.1|3847546_3848557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995480.1|3848489_3850256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325753.1|3850374_3851925_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.6	3.2e-19
WP_099325752.1|3852178_3853525_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.7	7.2e-36
WP_099325751.1|3853585_3853924_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099325750.1|3856055_3856394_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_099325749.1|3856452_3858012_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	39.6	2.0e-66
WP_164995481.1|3858971_3859778_+	protein kinase	NA	NA	NA	NA	NA
WP_164995482.1|3859812_3860736_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_157820600.1|3861224_3862034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995483.1|3862854_3863955_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_099325744.1|3864286_3865270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995484.1|3865830_3867426_+	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_164995485.1|3867796_3868663_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_099327061.1|3868659_3869445_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_164995486.1|3869676_3872271_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	34.4	1.3e-129
WP_164995487.1|3872430_3872604_-	TdeIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_164995488.1|3872641_3873061_-	hypothetical protein	NA	NA	NA	NA	NA
3873122:3873181	attL	AACGGATGTTCACCCCTGCCAAAACGCATAAGTGCTTAATATATAGTTTGTTAAGGCTGT	NA	NA	NA	NA
WP_164995775.1|3873270_3874926_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995489.1|3875758_3876307_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164995490.1|3876249_3876831_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164995491.1|3876852_3877419_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157820591.1|3878316_3878481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995492.1|3878726_3881360_-	HAMP domain-containing protein	NA	A0A2K9L0Z8	Tupanvirus	35.2	3.3e-08
WP_164995493.1|3882399_3882942_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_164995494.1|3882945_3883815_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_164995495.1|3884174_3884405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995496.1|3884726_3885350_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_164995497.1|3885346_3887032_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_099327057.1|3887060_3889085_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_099323887.1|3889570_3890674_-|transposase	IS4-like element ISCku3 family transposase	transposase	NA	NA	NA	NA
WP_099325705.1|3890977_3891655_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_164995498.1|3891651_3893070_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164995499.1|3893307_3893727_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_164995500.1|3893908_3894109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995501.1|3894125_3895955_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_099325709.1|3896353_3897481_+	transaldolase	NA	NA	NA	NA	NA
WP_099325710.1|3897834_3898080_+	hypothetical protein	NA	A0A1V0SKX4	Klosneuvirus	47.8	1.8e-09
WP_164995502.1|3898252_3899935_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164995503.1|3900781_3902038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099326467.1|3902150_3902486_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164995504.1|3902580_3903909_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164995505.1|3903979_3905506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995506.1|3905695_3906037_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_099325718.1|3906214_3906886_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_164994264.1|3907049_3907193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995507.1|3907176_3907356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995508.1|3907352_3907871_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164995509.1|3907986_3908517_+	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_164995510.1|3908516_3909647_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_099325723.1|3909719_3910208_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_099325727.1|3910334_3910937_-	cation transporter	NA	NA	NA	NA	NA
WP_099323647.1|3911360_3912917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995776.1|3913314_3914349_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.1	3.1e-63
WP_099327059.1|3915263_3916274_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099325728.1|3916455_3916671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157820598.1|3916606_3916963_+	TolC family protein	NA	NA	NA	NA	NA
WP_099325730.1|3917551_3917773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099325731.1|3917745_3918015_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2P1N333	Gordonia_phage	38.8	4.8e-08
WP_164995777.1|3918266_3920378_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_157820829.1|3921387_3921987_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	40.9	1.4e-31
WP_099325734.1|3922410_3923235_+	A24 family peptidase	NA	NA	NA	NA	NA
WP_099325735.1|3923514_3924162_+	OmpA family protein	NA	NA	NA	NA	NA
WP_099325736.1|3924172_3924796_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_164995511.1|3924927_3925659_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_164995512.1|3925763_3927077_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_164995513.1|3927265_3927475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995514.1|3927533_3928364_+	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	38.9	6.2e-46
WP_164995515.1|3928353_3928683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164995082.1|3928724_3929048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611516.1|3929109_3930513_+|transposase	IS4-like element ISCku4 family transposase	transposase	NA	NA	NA	NA
WP_164995775.1|3930819_3932475_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
3932565:3934419	attR	ACAGCCTTAACAAACTATATATTAAGCACTTATGCGTTTTGGCAGGGGTGAACATCCGTTGTAATTGTATCCCATCCATCCCGTTTTCAATCTTAACACAAAATTAACAAATCCTTCATATTCTCTTAATAAATAAAAGTTACATTTTCACGCATGTGATGCTCACAATCCGCTTCATGCAGATTGGCGCTCAATAAATCAGGCCATCGGTGGACTTAAATATTAAATGAACAAAAACGAATAATAAAATAATGAAAGGAGGCAGGAATGAAACGGAAAATCGCATGAAAATAATGGAGCTATGCTGATGCGCTAAACAGTAATTAATAAAACTAAGATTTAAAGGAGAAATATATCGTGAAGAATATGAGAAAAATAGTATTGGCAGCGTTTACAACACTTTTCTTTACAAGTGCTGCCAGCGCCGCCACAGTAAAAGTGTCAAAAAATATTGATACTTCTACTGCATGGACTGCTGACAACGTATACCGGTTAGAAGGCCAAATCTTTGTTTTGCCTGGCGCTAGTCTTACGATAGAGGCAGGGACAGTCATTGCCAGCACTACAGACGCTGGAGGCAGTCTGGCGGTAGCACGCGGCGCAAAAATCTTCGTAAACGGCACAGAAGACAACCCGGTAATAATGACCTCTACCGACGATGTGGCTACATGGGAAAAAGATTCCAGCCACCCCAGCGGCGGCGACCCCAAAACCGGCACATGGCGTGAAGGCGCAAATGAGTGGGGGAATCTGACTATTATGGGTGAAGGAGTAATATCCGCTTCCCACTCCAAAGGTCTTCAGGTGGGTAGTAACACTAAAGATCCTTCAGGGCTAAATGAGGCGCAAATGGAAGGACTTACGGATGCTAATTACTCATTGTATGGTGGCGCAGATGACAATGATGACAGCGGTTCCATCAGCTATTTGTCCTTACGATACGCAGGAAAAGTTGTTGGCCTTGGTAATGAGCTCAACGGTTTATCGCTGGGCGGTATCGGGCGTGAAACCGATATCGATCATGTTGAGATTATGAACAATGTAGATGATGGTATTGAAATCTGGGGCGGTACGGTTAATCTGAAATACGCCAGTATCTGGAACGTTGGTGACGACAGTTTTGACGTTGACCAGGGCTGGCGCGGTAAAGCACAGTTTCTTTTTGTTGTTCAGGGCTACAGCGTCGATGCAAAACAAGGTTCCGGTGTTGGCGACAACTGTTTTGAGATGGATGGCGCAGAAGATTCTGACGCTCAGCCAGTTACTACATCCGTAATTTATAATGCCACAGTTATTGGCAATCCACTTGATGGTGACCATGGAACTGCATGGCGAGATAATGCCCGGGTGCAGTTTCGCAATTGCATATTTATGGATCTGGGCGAAAAACTTGTAAAAGCCGACAATGATGATGGTGACGGCGCTAATGGTTATGGTTACAACGGCACGCTGTCATGGGAAAAGACGTGGGAAACAGATTATACAGTTACTTCCACGGTGAACGATTGTGGCGGATGTCCTTCCGCTGCTTTCAATAACGCCAGTAATCTTTATACAACCCAGACGTCAGGTAAACTTGCGGAAATCACAGACAGTGTGTTCTTCAGGAACCTTCATGCGGATGCATATACGGACGCAGATACAGTCGGCGTAACAACTAACGGCGGCAGTAATTCCGGAAAGAACAACGTGGTGGTTACCGGTACCGATAATAAGGATATGCCTATTGTTAGCTTAACCCGTGGTACAACTTTTACTTCCTCAGAAGGCAAAGGCGTCCTTCCTGTAAAATCCGTAGACCCACGCGCCGCCAATGACGCCCTTGTTAGTGCGGGTACTGCACCTAATGACGGGT	NA	NA	NA	NA
>prophage 19
NZ_CP049055	Candidatus Kuenenia stuttgartiensis strain CSTR1 chromosome, complete genome	4334932	4175854	4186118	4334932		Ostreococcus_tauri_virus(16.67%)	10	NA	NA
WP_164995616.1|4175854_4177645_-	thiamine pyrophosphate-binding protein	NA	E4WLQ6	Ostreococcus_tauri_virus	36.2	3.5e-102
WP_164995617.1|4177655_4178855_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_164995618.1|4178838_4179783_-	GDP-L-fucose synthase	NA	A0A1J0F9I6	Only_Syngen_Nebraska_virus	49.7	4.4e-80
WP_099325465.1|4179785_4180007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164995619.1|4179999_4180362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099325463.1|4180420_4181359_-	NAD(P)-dependent oxidoreductase	NA	A0A0F7LC08	uncultured_marine_virus	46.1	7.9e-74
WP_099325462.1|4181373_4182534_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES46	Bathycoccus_sp._RCC1105_virus	31.0	2.8e-44
WP_099325461.1|4182556_4183549_-	kinase	NA	A0A067XQL1	Caulobacter_phage	35.3	1.8e-39
WP_099325460.1|4183545_4184256_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_164995620.1|4184261_4186118_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	45.3	1.5e-31
