The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	2153	63447	3468545	integrase,transposase	Catovirus(14.29%)	57	NA	NA
WP_164954111.1|2153_2867_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164954112.1|2719_3598_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_074842002.1|3921_5397_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_164954113.1|5847_6192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954114.1|6201_7347_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164954115.1|7531_8410_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_164954116.1|8492_8972_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.7	5.4e-10
WP_074842021.1|9838_10174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954117.1|10221_11262_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_074842036.1|11261_12260_+	NAD(P)-dependent oxidoreductase	NA	A0A1B1MRD1	Pteropox_virus	24.6	7.5e-06
WP_164954118.1|12705_14118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954113.1|14294_14639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954119.1|14648_15836_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_074841710.1|16128_16869_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_074841709.1|16981_18592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841708.1|18655_19168_+	HAD hydrolase family protein	NA	E3T535	Cafeteria_roenbergensis_virus	33.8	2.6e-18
WP_074841707.1|19262_20945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841706.1|21378_22869_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_074841705.1|22996_23560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841704.1|23563_23911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841703.1|24158_27038_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954120.1|27890_28259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954121.1|28337_29960_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954122.1|30446_30923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841956.1|31039_34204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954123.1|34401_35766_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164954124.1|36310_37735_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164954125.1|38215_39328_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	36.5	2.6e-07
WP_074842055.1|39555_39909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074842057.1|39919_40567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074842053.1|40649_41219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954126.1|41291_42125_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954127.1|42469_42895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954128.1|42962_43619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954129.1|43813_44746_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_164954524.1|44727_45057_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_164954130.1|45217_46039_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	25.0	8.9e-05
WP_164954131.1|46031_46184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954132.1|46447_47077_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	26.4	2.5e-07
WP_164954128.1|47242_47899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_083397069.1|48204_49185_+	DUF4277 domain-containing protein	NA	NA	NA	NA	NA
WP_074841849.1|49321_51025_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_074841848.1|51100_52552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841847.1|52553_53369_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_074841846.1|53527_53896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841845.1|54462_54822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954133.1|55450_55915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954134.1|55926_56343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954135.1|56451_56769_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	39.4	1.5e-08
WP_164954136.1|56786_56975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954137.1|57109_57712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954138.1|57677_58772_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_164954139.1|58918_59095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954140.1|59855_61301_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_074842026.1|61505_62099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074842028.1|62076_62313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954525.1|62874_63447_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	66562	107678	3468545	integrase,transposase	Enterobacteria_phage(16.67%)	41	68793:68807	107773:107787
WP_164954142.1|66562_68266_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_074841896.1|68618_70577_+	AAA family ATPase	NA	NA	NA	NA	NA
68793:68807	attL	GAAAAACTTATTGTT	NA	NA	NA	NA
WP_164954143.1|70702_70870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841897.1|70972_72211_+	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	24.8	4.8e-10
WP_074841899.1|73017_73524_+	hypothetical protein	NA	A0A222YVZ6	Synechococcus_phage	36.8	1.4e-11
WP_164954144.1|74062_74941_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164954145.1|74829_75507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954146.1|75820_77116_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_074841535.1|77147_77768_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_164954147.1|78027_79884_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	1.4e-61
WP_074841533.1|80027_81458_+	sugar transferase	NA	NA	NA	NA	NA
WP_083397028.1|81530_82316_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_074841531.1|82393_83485_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	28.4	1.2e-33
WP_074841530.1|83512_83923_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_074841529.1|83955_85095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954148.1|85187_86081_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.4	8.0e-92
WP_074841527.1|86067_86619_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.6	2.3e-33
WP_074841526.1|86680_87700_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.8	1.9e-81
WP_074841525.1|88036_88333_+	plasmid maintenance system killer protein	NA	NA	NA	NA	NA
WP_074841524.1|88384_89437_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074841523.1|89565_89991_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PD76	Moraxella_phage	50.4	6.0e-29
WP_074841522.1|90255_90912_+	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_074841521.1|91201_92425_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	40.8	3.2e-67
WP_074841520.1|92458_93112_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083397027.1|93245_93506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841537.1|93635_93941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954124.1|94635_96060_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164954125.1|96542_97655_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	36.5	2.6e-07
WP_164954149.1|97793_98087_-|transposase	transposase	transposase	A0A1S5RGV0	Helicobacter_phage	46.1	2.5e-18
WP_164954150.1|99361_100111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954151.1|100082_101402_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_164954152.1|101394_101640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954153.1|101649_102378_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954154.1|102516_103134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954155.1|103321_104986_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_164954156.1|104989_105310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954157.1|105327_105438_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_164954526.1|105496_105643_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_164954158.1|105751_106168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954159.1|106179_106644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841026.1|106766_107678_-|transposase	transposase	transposase	D9J0Y9	Brochothrix_phage	28.7	4.4e-13
107773:107787	attR	GAAAAACTTATTGTT	NA	NA	NA	NA
>prophage 3
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	308945	348956	3468545	integrase,transposase,protease,tRNA	Burkholderia_phage(12.5%)	28	308831:308846	312197:312212
308831:308846	attL	AAATAATTCCCGATCT	NA	NA	NA	NA
WP_074838567.1|308945_310178_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_164954167.1|310509_311151_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_074838561.1|311147_312188_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_074838558.1|312270_313167_-	hypothetical protein	NA	A9YX10	Burkholderia_phage	27.4	7.7e-18
312197:312212	attR	AAATAATTCCCGATCT	NA	NA	NA	NA
WP_074838556.1|313590_314298_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_164954168.1|315048_316608_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_083397083.1|316922_317051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954169.1|317310_318933_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074840176.1|319231_321325_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	23.1	3.1e-09
WP_074840178.1|321351_325383_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_074840180.1|325403_329357_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_164954170.1|329670_330405_-	hypothetical protein	NA	S5VKI3	Leptospira_phage	33.7	4.7e-21
WP_164954171.1|330591_332355_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074840185.1|332543_333416_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	52.4	4.3e-74
WP_074840186.1|333417_334386_-	universal stress protein	NA	NA	NA	NA	NA
WP_074840188.1|334520_336209_-	ATP-dependent helicase	NA	A0A2I7RIK5	Vibrio_phage	28.2	2.0e-27
WP_074840190.1|336236_336791_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_074840192.1|336783_337485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840194.1|337526_338156_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	31.7	1.1e-18
WP_074840196.1|338444_339239_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_074840198.1|339283_339742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840200.1|339813_340209_-	DUF1036 domain-containing protein	NA	NA	NA	NA	NA
WP_074840202.1|340482_342405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840204.1|342603_342981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083396905.1|343078_345520_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.9	1.2e-182
WP_074840209.1|346258_347155_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_074840211.1|347253_347568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840213.1|347690_348956_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.7	2.0e-120
>prophage 4
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	592045	642065	3468545	transposase	Micromonas_sp._RCC1109_virus(12.5%)	36	NA	NA
WP_164954188.1|592045_593233_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_074840951.1|593439_593625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840950.1|593695_594085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840949.1|594160_594397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840948.1|594649_597151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840946.1|599450_600827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840945.1|600995_601976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840944.1|602137_606157_+	AAA family ATPase	NA	E5EQ50	Micromonas_sp._RCC1109_virus	34.7	2.0e-20
WP_074840943.1|606243_606837_+	hypothetical protein	NA	D5GVZ7	Campylobacter_virus	38.3	1.9e-25
WP_074840942.1|606854_608252_+	hypothetical protein	NA	G1FGP1	Mycobacterium_phage	28.7	2.0e-33
WP_143075408.1|608229_608964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840939.1|609439_610066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840938.1|610314_610932_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	50.7	2.5e-52
WP_074840937.1|610960_611341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083396957.1|611349_612234_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_143075407.1|612485_613580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840935.1|614011_615058_+	Fic family protein	NA	NA	NA	NA	NA
WP_074840934.1|615115_616339_-	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	42.6	1.0e-68
WP_164954189.1|616886_618509_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954190.1|618926_620549_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954191.1|620961_622581_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954192.1|622634_624014_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_164954193.1|624195_624369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954194.1|624881_626525_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074842040.1|626672_627020_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_164954195.1|627552_628998_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164954196.1|629276_630860_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954197.1|631026_631293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954198.1|631426_632146_-	deoxyribonuclease I	NA	A0A2P0VMP9	Tetraselmis_virus	35.6	3.4e-08
WP_074842034.1|632235_633273_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_164954199.1|633331_633808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_074841967.1|634347_635934_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.9	2.6e-16
WP_164954200.1|636443_638501_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164954201.1|638555_639506_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	30.0	6.2e-26
WP_083397082.1|639819_640059_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_164954202.1|640526_642065_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	1331355	1396464	3468545	plate,transposase,tRNA	Ostreococcus_mediterraneus_virus(11.11%)	49	NA	NA
WP_074838820.1|1331355_1332360_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_074838818.1|1332372_1333065_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_074838815.1|1333069_1333741_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_074838813.1|1333743_1335606_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074838810.1|1335745_1336828_-	3-dehydroquinate synthase	NA	A0A0P0C619	Ostreococcus_mediterraneus_virus	33.6	1.1e-29
WP_074838808.1|1336830_1337349_-	shikimate kinase	NA	NA	NA	NA	NA
WP_074838805.1|1337592_1338867_-	MFS transporter	NA	NA	NA	NA	NA
WP_074838802.1|1339222_1341688_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_074838800.1|1341802_1342090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838798.1|1342092_1344837_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.8	3.3e-80
WP_074838795.1|1344857_1345865_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_074838793.1|1345840_1347661_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_074838790.1|1347676_1348150_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_074838786.1|1348201_1348729_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_074838783.1|1348747_1350232_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_074838780.1|1350240_1350786_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_074838777.1|1350819_1351902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838775.1|1352222_1352750_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_074838772.1|1352884_1353412_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_074838770.1|1354088_1354604_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	33.1	3.4e-10
WP_074838767.1|1355343_1358847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838764.1|1358890_1359283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838761.1|1359308_1360529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954278.1|1360847_1362632_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074840675.1|1362736_1364215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840677.1|1364228_1368749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840679.1|1368789_1369554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840681.1|1369592_1370948_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_074840683.1|1370950_1371538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840685.1|1371866_1372616_-	phosphatase	NA	NA	NA	NA	NA
WP_074840687.1|1372635_1373925_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_074840689.1|1373918_1374635_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_074840691.1|1374621_1374993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083396934.1|1375039_1376443_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_074840693.1|1376513_1377392_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	36.6	3.1e-40
WP_074840695.1|1377715_1379374_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_074840697.1|1379480_1380803_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_074840699.1|1381214_1382339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840701.1|1382394_1384065_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_074840703.1|1384763_1385534_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	51.0	4.2e-57
WP_074840704.1|1386325_1387375_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	22.5	3.3e-12
WP_074840713.1|1387435_1388308_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_074840705.1|1388320_1389859_+	sugar kinase	NA	NA	NA	NA	NA
WP_074840706.1|1389949_1390951_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_074840707.1|1391053_1391599_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_074840708.1|1391602_1392883_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_074840709.1|1392898_1393867_+	D-2-hydroxyacid dehydrogenase	NA	M1HFV8	Paramecium_bursaria_Chlorella_virus	29.5	7.2e-30
WP_074840710.1|1393938_1395090_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	7.0e-40
WP_164954279.1|1395234_1396464_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	52.7	5.8e-109
>prophage 6
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	1464522	1516912	3468545	integrase,transposase,tRNA	Pseudomonas_phage(25.0%)	43	1466339:1466353	1479465:1479479
WP_164954286.1|1464522_1465296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_143075482.1|1465851_1466634_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1466339:1466353	attL	GAATAGAATTCTTCA	NA	NA	NA	NA
WP_074842010.1|1466978_1467176_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164954287.1|1467530_1469069_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_164954288.1|1469219_1469405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841938.1|1469663_1470044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841939.1|1470067_1470859_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_074841940.1|1470860_1472534_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_074841941.1|1472594_1473188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841659.1|1473566_1474550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841660.1|1474555_1475875_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0Z061	Pseudomonas_phage	25.4	3.1e-07
WP_074841661.1|1475911_1476529_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_074841662.1|1478116_1478380_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_074841663.1|1478379_1478643_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_074841664.1|1479085_1480546_+	hypothetical protein	NA	NA	NA	NA	NA
1479465:1479479	attR	TGAAGAATTCTATTC	NA	NA	NA	NA
WP_074841665.1|1480797_1484067_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_164954289.1|1485374_1486442_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_164954290.1|1487332_1487518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954158.1|1487529_1487946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954526.1|1488054_1488201_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_164954157.1|1488259_1488370_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_164954136.1|1488387_1488576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954291.1|1488710_1490375_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_074841376.1|1491426_1492158_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074841377.1|1492207_1493308_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_074841378.1|1493317_1494409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841389.1|1494401_1495028_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	41.5	1.0e-37
WP_074841379.1|1495135_1496503_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_074841380.1|1496674_1498063_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_074841390.1|1498301_1501166_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	35.4	1.6e-130
WP_074841381.1|1501330_1503514_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_143075440.1|1503515_1503935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841383.1|1503931_1505203_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_074841384.1|1505261_1506200_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_074841385.1|1506209_1506725_-	signal peptidase II	NA	NA	NA	NA	NA
WP_074841386.1|1506726_1509555_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	6.3e-82
WP_074841387.1|1509579_1510527_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_031492094.1|1510826_1511090_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_074841388.1|1511239_1511509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954292.1|1511665_1512856_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954293.1|1512975_1514595_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954533.1|1514779_1514980_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164954168.1|1515352_1516912_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	1562834	1687301	3468545	integrase,transposase,tRNA	Catovirus(10.53%)	108	1646472:1646528	1649913:1649969
WP_074840089.1|1562834_1564559_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_074840088.1|1564620_1565739_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_074840086.1|1565756_1566476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840084.1|1566502_1567291_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_074840082.1|1567304_1568054_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_074840080.1|1568220_1568916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840078.1|1569158_1569626_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_074840076.1|1569638_1570055_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_074840074.1|1570275_1572471_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_083396898.1|1572715_1573837_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_074840072.1|1574980_1575688_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_074840070.1|1575846_1576173_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_083396897.1|1576998_1577976_-	AAA domain-containing protein	NA	W6E9N8	Rhizobium_phage	31.2	6.0e-08
WP_074840066.1|1578182_1578668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840064.1|1578677_1579130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840062.1|1579142_1580150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840060.1|1580296_1581454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840058.1|1581764_1582526_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074840057.1|1582591_1584016_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_074840056.1|1584031_1585057_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_074840054.1|1585250_1589144_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.2	4.8e-125
WP_074840052.1|1589382_1591002_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954300.1|1591084_1591225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840050.1|1591319_1591787_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_074840048.1|1591788_1592115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840046.1|1592342_1592810_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_143075385.1|1593021_1593855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954301.1|1594548_1595334_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954154.1|1595477_1596095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954266.1|1596108_1596963_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954302.1|1596965_1597190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954303.1|1597212_1598526_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_164954150.1|1598497_1599247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074842063.1|1599777_1600458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954304.1|1600721_1601126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954305.1|1601239_1602145_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_074841915.1|1602315_1604544_-	DUF115 domain-containing protein	NA	NA	NA	NA	NA
WP_164954306.1|1605275_1607027_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_164954307.1|1607667_1608546_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164954308.1|1608661_1609111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841827.1|1609440_1612035_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.7e-121
WP_074841828.1|1612134_1612914_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_074841829.1|1612897_1613872_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_164954309.1|1613979_1614729_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_074841830.1|1614784_1615483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841831.1|1615534_1616341_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_164954310.1|1616615_1617560_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954311.1|1617661_1618570_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_164954312.1|1618573_1618972_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954313.1|1619341_1619800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954314.1|1620092_1620938_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954315.1|1620934_1621294_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_164954316.1|1621737_1621914_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954317.1|1622152_1623361_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841237.1|1623535_1624444_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_074841236.1|1624475_1625528_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_074841235.1|1625541_1626222_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_074841234.1|1626221_1627196_-	phosphotransferase	NA	A0A1V0SB89	Catovirus	25.3	5.4e-09
WP_074841233.1|1627188_1627920_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_074841232.1|1627923_1628802_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_074841231.1|1628827_1630348_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.4	6.8e-91
WP_143075425.1|1630372_1631471_-	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	36.7	4.4e-07
WP_074841230.1|1631659_1632508_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_074841229.1|1632548_1633631_-	alanine racemase	NA	NA	NA	NA	NA
WP_074841228.1|1633653_1635105_-	replicative DNA helicase	NA	O80281	Escherichia_phage	39.5	4.5e-84
WP_074841227.1|1635677_1635851_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_074841226.1|1635857_1638491_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	4.5e-82
WP_074841225.1|1638621_1639113_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_074841224.1|1639126_1640296_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.9	1.3e-113
WP_074841223.1|1640506_1641844_+	motility associated factor glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_074841222.1|1641887_1642151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841221.1|1642324_1644907_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.6	9.0e-35
WP_164954318.1|1645953_1646637_+|transposase	transposase	transposase	NA	NA	NA	NA
1646472:1646528	attL	GATTCATTATCCTAATGTTTTTATTATCCTAAAAGAATTCTGCAACTGGCTTAAAAT	NA	NA	NA	NA
WP_143075480.1|1646602_1647847_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_074841951.1|1647843_1648830_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_164954131.1|1648822_1648975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954534.1|1649013_1649187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954132.1|1649237_1649867_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	26.4	2.5e-07
WP_164954128.1|1650032_1650689_+|transposase	transposase	transposase	NA	NA	NA	NA
1649913:1649969	attR	ATTTTAAGCCAGTTGCAGAATTCTTTTAGGATAATAAAAACATTAGGATAATGAATC	NA	NA	NA	NA
WP_074841819.1|1650727_1651696_-	sigma-70 family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	32.2	3.3e-30
WP_083397063.1|1651845_1653006_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_083397064.1|1653075_1653573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841818.1|1653745_1654231_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_083397062.1|1654223_1654919_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_074841816.1|1654920_1655217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841815.1|1655228_1656866_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	3.7e-151
WP_164954319.1|1657187_1658720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_074840981.1|1658867_1661132_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_074840982.1|1661144_1662494_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K9V889	Bandra_megavirus	28.8	1.6e-11
WP_074840983.1|1662493_1663204_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_074840984.1|1663207_1664104_-	GTPase Era	NA	NA	NA	NA	NA
WP_143075412.1|1664122_1664824_-	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	36.8	5.3e-22
WP_074840985.1|1664829_1665765_-	signal peptidase I	NA	NA	NA	NA	NA
WP_074840986.1|1665838_1667650_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.5	1.9e-23
WP_083396962.1|1667799_1668744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840988.1|1668750_1669365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074840989.1|1669386_1669983_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_083396963.1|1670301_1671900_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_074840991.1|1672165_1675537_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_074840992.1|1675621_1676548_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_074840993.1|1676958_1678989_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_074840994.1|1679137_1679716_-	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_083396965.1|1679724_1680672_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	44.8	1.4e-38
WP_074840996.1|1681212_1681683_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	61.7	9.8e-49
WP_083396966.1|1681726_1682713_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_074840998.1|1682765_1684847_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.8	4.0e-118
WP_074840999.1|1684850_1685570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954320.1|1685855_1687301_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	1702654	1751060	3468545	transposase,protease,tRNA	Erysipelothrix_phage(12.5%)	38	NA	NA
WP_164954322.1|1702654_1704790_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_074841311.1|1704863_1705991_-	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	24.7	1.3e-22
WP_074841310.1|1706096_1706612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841309.1|1706799_1708641_-	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	33.6	2.1e-41
WP_074841308.1|1708909_1709245_+	DUF2172 domain-containing protein	NA	NA	NA	NA	NA
WP_074841306.1|1709628_1710510_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_074841305.1|1710506_1710989_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	47.4	7.5e-28
WP_074841304.1|1710991_1712143_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_031491644.1|1712255_1712519_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_031491645.1|1712537_1712849_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_074841303.1|1713150_1714116_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_074841302.1|1714191_1715409_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_074841301.1|1715478_1716777_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	37.4	1.0e-42
WP_074841300.1|1716853_1717846_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_074841312.1|1717845_1719048_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_083397005.1|1719074_1720418_-	GTPase HflX	NA	NA	NA	NA	NA
WP_074841299.1|1720448_1720703_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_074841298.1|1721129_1722026_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_074841297.1|1722153_1723158_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_074841296.1|1723634_1725239_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_074841295.1|1725367_1726303_+	DUF2786 domain-containing protein	NA	A0A0S0MUZ8	Pseudomonas_phage	36.8	5.8e-08
WP_164954323.1|1726501_1728598_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164954324.1|1728825_1730397_-	carboxylesterase family protein	NA	A0A140E1D0	Samba_virus	31.0	2.8e-15
WP_164954325.1|1730891_1731629_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954326.1|1731905_1732646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841961.1|1733477_1733879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954327.1|1734053_1735094_+	DUF4417 domain-containing protein	NA	NA	NA	NA	NA
WP_164954328.1|1735096_1735588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841957.1|1735779_1735959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954329.1|1735976_1737515_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_074841947.1|1738071_1739190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841946.1|1739328_1740852_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_164954330.1|1741587_1743423_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954331.1|1743801_1745634_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841293.1|1745876_1746848_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_074841292.1|1746844_1748860_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	38.5	1.2e-55
WP_164954332.1|1748875_1750519_-	LysM peptidoglycan-binding domain-containing protein	NA	M1HNA7	Bacillus_virus	29.6	8.8e-20
WP_074841290.1|1750571_1751060_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	2547933	2611646	3468545	integrase,transposase,protease,tRNA	Bodo_saltans_virus(25.0%)	54	2541131:2541147	2619695:2619711
2541131:2541147	attL	CTCAACCTATTCAGTTA	NA	NA	NA	NA
WP_074841555.1|2547933_2548917_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	41.6	5.1e-31
WP_074841556.1|2548941_2551320_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_074841557.1|2551332_2551584_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_074841558.1|2551593_2552481_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_074841559.1|2552487_2554362_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_031491369.1|2554364_2554853_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_074841563.1|2554925_2556140_+	MFS transporter	NA	NA	NA	NA	NA
WP_074841560.1|2557081_2557552_+	type III secretion system chaperone	NA	NA	NA	NA	NA
WP_143075449.1|2557972_2560036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954407.1|2560105_2561293_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164954408.1|2561302_2561647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841966.1|2562318_2562792_+	type III secretion system chaperone	NA	NA	NA	NA	NA
WP_074841965.1|2562835_2564140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954409.1|2564607_2564934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954410.1|2564949_2566146_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_074842068.1|2566312_2566897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954411.1|2567077_2568610_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_074841502.1|2568759_2569854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954412.1|2570108_2570285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954413.1|2570346_2570490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841504.1|2570716_2571184_+	type III secretion system chaperone	NA	NA	NA	NA	NA
WP_074841505.1|2571206_2573630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841506.1|2573858_2574230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841507.1|2574936_2575269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841508.1|2575247_2576549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841509.1|2576967_2578326_+	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_074841510.1|2578329_2579580_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_074841511.1|2579566_2580358_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_074841512.1|2580350_2581007_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_074841513.1|2581009_2581609_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_074841514.1|2581618_2582845_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_074841515.1|2583200_2584157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841516.1|2584276_2585422_+	DUF4885 family protein	NA	NA	NA	NA	NA
WP_164954414.1|2585776_2586151_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_143075445.1|2586147_2586330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143075446.1|2586382_2586571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954415.1|2586804_2588580_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954416.1|2588929_2590708_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_143075476.1|2591501_2593466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841928.1|2593479_2595117_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954417.1|2595497_2596727_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	52.7	5.8e-109
WP_083396985.1|2596869_2599530_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_074841158.1|2599543_2600329_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_164954418.1|2600624_2602448_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841160.1|2602505_2603297_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_074841161.1|2603352_2604024_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_074841162.1|2604378_2605125_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_074841163.1|2605243_2606131_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_074841164.1|2606151_2606877_+	UMP kinase	NA	NA	NA	NA	NA
WP_074841165.1|2606890_2607448_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_074841166.1|2607457_2608210_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	35.6	4.2e-17
WP_083396986.1|2608209_2609073_+	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	28.6	3.8e-06
WP_074841168.1|2609074_2610274_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_074841169.1|2610266_2611646_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
2619695:2619711	attR	CTCAACCTATTCAGTTA	NA	NA	NA	NA
>prophage 11
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	2619982	2678197	3468545	transposase,protease,tRNA	Helicobacter_phage(28.57%)	48	NA	NA
WP_074841178.1|2619982_2621314_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_164954320.1|2621830_2623276_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_074841538.1|2623476_2624493_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_074841539.1|2624511_2625531_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_074841540.1|2625646_2625883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841541.1|2626357_2626936_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	34.4	4.5e-27
WP_074841542.1|2627448_2628780_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.9	1.7e-16
WP_074841543.1|2629310_2631479_+	N-6 DNA methylase	NA	M1GZ08	Paramecium_bursaria_Chlorella_virus	25.4	7.6e-11
WP_074841544.1|2631546_2633517_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_074841545.1|2634019_2635798_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841546.1|2635977_2637057_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_083397029.1|2637509_2638202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841548.1|2638316_2639945_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841549.1|2640114_2640459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841550.1|2640696_2641152_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_074841968.1|2641510_2643589_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_074841550.1|2643802_2644258_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_074841855.1|2644502_2645903_-|protease	DegQ family serine endoprotease	protease	NA	NA	NA	NA
WP_074841854.1|2645931_2646465_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_074841853.1|2646746_2647862_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_074841852.1|2648011_2648860_+	DUF3737 family protein	NA	NA	NA	NA	NA
WP_074841851.1|2648852_2650013_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_074841850.1|2650340_2650769_+|transposase	IS607 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	56.7	1.5e-35
WP_164954320.1|2650919_2652365_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164954419.1|2652825_2654124_+|transposase	transposase	transposase	A0A1S5RFS3	Helicobacter_phage	43.9	2.7e-88
WP_164954420.1|2654262_2654475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954421.1|2654438_2655374_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	36.5	2.2e-07
WP_164954422.1|2655856_2657281_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164954423.1|2658221_2658863_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_074841719.1|2658872_2659829_-	sugar kinase	NA	NA	NA	NA	NA
WP_074841718.1|2659961_2661449_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_074841717.1|2661459_2662956_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_074841716.1|2663052_2664084_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_074841715.1|2664106_2665393_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_074841714.1|2665395_2665908_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_074841713.1|2665978_2666989_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_074841712.1|2667211_2669068_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_164954424.1|2669598_2671218_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954425.1|2671259_2672258_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954426.1|2672267_2672651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083397087.1|2672777_2673089_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164954427.1|2673547_2673772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954428.1|2673880_2674813_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074840764.1|2675048_2675789_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	24.2	9.8e-11
WP_164954429.1|2675802_2676048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954430.1|2676100_2676508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954431.1|2676468_2677515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954432.1|2677756_2678197_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	2894497	2941971	3468545	head,portal,protease,integrase,terminase,transposase,plate,tail,capsid	Vibrio_phage(32.14%)	68	2888298:2888313	2946340:2946356
2888298:2888313	attL	CCAGCATATCGCCAAA	NA	NA	NA	NA
WP_074838076.1|2894497_2895625_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	27.6	1.1e-34
2888298:2888313	attL	CCAGCATATCGCCAAA	NA	NA	NA	NA
WP_074838074.1|2895715_2895904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954447.1|2895906_2896065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838070.1|2896061_2896364_-	hypothetical protein	NA	G9BWA1	Planktothrix_phage	45.8	5.0e-14
WP_074838067.1|2896360_2896642_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_074838065.1|2896638_2897145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838062.1|2897131_2897536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838059.1|2897532_2897793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838057.1|2897789_2898080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838054.1|2898073_2898355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838051.1|2898382_2898604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838049.1|2898725_2898995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838046.1|2898991_2899459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838044.1|2899461_2899656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838041.1|2899853_2900171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074838039.1|2900380_2901073_-	helix-turn-helix domain-containing protein	NA	A8CGC0	Salmonella_phage	28.7	4.9e-12
WP_074838036.1|2901213_2901411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838033.1|2901411_2901738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838029.1|2901713_2902796_+	DUF2800 domain-containing protein	NA	Q6DMW2	Streptococcus_phage	43.1	7.0e-74
WP_074838027.1|2902838_2903789_+	ATP-binding protein	NA	A0A2K9V3B4	Faecalibacterium_phage	53.2	3.2e-70
WP_074838025.1|2903820_2904357_+	hypothetical protein	NA	Q5YA95	Bacillus_phage	47.0	1.0e-33
WP_143075356.1|2904353_2905970_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	55.1	3.0e-161
WP_074838021.1|2905981_2908102_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	44.6	9.0e-166
WP_074838016.1|2908469_2908910_+	RusA family crossover junction endodeoxyribonuclease	NA	X2CXX1	Lactobacillus_phage	34.2	8.7e-15
WP_074838014.1|2908978_2909368_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_074838012.1|2909375_2909828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838008.1|2910154_2910829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838006.1|2911084_2911654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074838003.1|2911715_2911937_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_074838001.1|2911939_2912209_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	46.5	2.1e-19
WP_143075355.1|2912358_2912691_+	hypothetical protein	NA	NA	NA	NA	NA
2912532:2912547	attR	TTTGGCGATATGCTGG	NA	NA	NA	NA
WP_074837997.1|2912860_2913304_+	lysozyme	NA	B7SSN6	Bacillus_phage	57.8	6.6e-39
2912532:2912547	attR	TTTGGCGATATGCTGG	NA	NA	NA	NA
WP_074837995.1|2913709_2913901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837993.1|2913876_2914371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837991.1|2914398_2915139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074837988.1|2915216_2917064_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	48.9	8.9e-162
WP_074837986.1|2917060_2917309_+	hypothetical protein	NA	A0A2K9V410	Faecalibacterium_phage	37.0	7.8e-05
WP_074838222.1|2917342_2918950_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	60.2	1.2e-165
WP_074837984.1|2918939_2920067_+|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	30.0	7.4e-34
WP_074837982.1|2920084_2920441_+|head	head decoration protein	head	NA	NA	NA	NA
WP_074837980.1|2920456_2921521_+|capsid	major capsid protein	capsid	A0A067ZI79	Vibrio_phage	43.7	5.6e-68
WP_074837978.1|2921520_2921721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837976.1|2921717_2922029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837975.1|2922030_2922597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837972.1|2922596_2923118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837970.1|2923131_2923413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837968.1|2923416_2924901_+	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	48.3	5.5e-130
WP_074837966.1|2924954_2925482_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	50.6	2.0e-42
WP_074837964.1|2925492_2925801_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_074837962.1|2925988_2928427_+|tail	phage tail tape measure protein	tail	F8UBC8	Clostridium_phage	30.4	2.6e-36
WP_074837960.1|2928423_2928675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074837957.1|2928723_2928939_+	hypothetical protein	NA	A0A2K9V482	Faecalibacterium_phage	46.5	6.3e-11
WP_074837955.1|2928926_2930036_+	hypothetical protein	NA	A0A067ZG47	Vibrio_phage	35.9	1.7e-54
WP_074837952.1|2930037_2930538_+|plate	phage baseplate assembly protein V	plate	A0A059WRL9	Vibrio_phage	43.4	4.1e-29
WP_074837950.1|2930546_2931656_+	hypothetical protein	NA	G4KK81	Yersinia_phage	46.3	9.2e-05
WP_164954448.1|2931874_2932549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954305.1|2932609_2933515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954304.1|2933627_2934032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074837944.1|2934609_2935044_+|tail	phage tail protein	tail	A0A0C5AN08	Bacteriophage	31.5	8.9e-12
WP_074837941.1|2935051_2935381_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	45.6	3.7e-18
WP_074837939.1|2935373_2936516_+|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	40.8	2.5e-74
WP_074837937.1|2936508_2937171_+|tail	phage tail protein I	tail	NA	NA	NA	NA
WP_074837935.1|2937184_2938294_+|tail	tail fiber protein	tail	A0A0B5A509	Achromobacter_phage	29.8	9.2e-05
WP_164954449.1|2938328_2938754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143075353.1|2938938_2939187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954450.1|2939436_2939679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074837930.1|2939675_2939909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074837923.1|2940825_2941971_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PGM3	Moraxella_phage	23.8	1.2e-12
2946340:2946356	attR	ATAGAGGTGTAACATGA	NA	NA	NA	NA
>prophage 13
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	3137688	3208311	3468545	transposase,tRNA	Salmonella_phage(14.29%)	59	NA	NA
WP_164954462.1|3137688_3138969_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	42.2	5.0e-79
WP_074841727.1|3139363_3141127_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	29.0	8.0e-11
WP_074841720.1|3141153_3141912_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_074841721.1|3142039_3143998_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.9	2.3e-35
WP_074841722.1|3144067_3144937_+	DUF5131 family protein	NA	R9TNA8	Rhizobium_phage	28.3	1.2e-20
WP_074841723.1|3145137_3146400_+	SLC13/DASS family transporter	NA	NA	NA	NA	NA
WP_074841724.1|3146463_3147324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074841725.1|3147476_3148319_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_074841726.1|3148498_3149476_-	glucokinase	NA	NA	NA	NA	NA
WP_164954537.1|3149717_3151088_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_164954463.1|3151063_3151420_-	DUF4277 domain-containing protein	NA	NA	NA	NA	NA
WP_074841180.1|3151867_3152713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841181.1|3153560_3154895_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_083396990.1|3154946_3155765_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074841183.1|3155857_3156895_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.1	6.6e-29
WP_074841184.1|3156887_3157568_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_074841185.1|3157577_3158906_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_074841186.1|3158938_3159694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841187.1|3159752_3160148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841188.1|3160720_3161665_+	BspA family leucine-rich repeat surface protein	NA	I7JC14	Campylobacter_virus	51.6	5.4e-06
WP_074841189.1|3161886_3162987_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_074841190.1|3163128_3164469_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_074841191.1|3164492_3165971_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_074841192.1|3165991_3166270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954464.1|3166391_3167357_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_074841194.1|3167382_3168144_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_074841195.1|3168345_3169095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841196.1|3169318_3171781_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_074841197.1|3171783_3172743_+	homoserine kinase	NA	NA	NA	NA	NA
WP_074841198.1|3172754_3174035_+	threonine synthase	NA	NA	NA	NA	NA
WP_164954465.1|3174269_3175559_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	40.3	3.4e-75
WP_074841865.1|3176156_3177416_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_074841866.1|3177890_3178115_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_074841867.1|3178114_3180343_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_031492934.1|3180494_3180716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841868.1|3180800_3182666_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.3	1.8e-69
WP_164954466.1|3182798_3183011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954467.1|3183275_3184469_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_164954468.1|3184530_3185148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954282.1|3185150_3185894_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	29.1	5.2e-12
WP_143075398.1|3185883_3186183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074840610.1|3186374_3186884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954469.1|3187058_3187784_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	32.0	3.2e-14
WP_074841436.1|3188094_3190545_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.2	1.7e-80
WP_074841435.1|3190541_3191000_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_074841434.1|3191040_3191997_+	Fe-S cluster assembly protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	50.0	2.4e-25
WP_074841433.1|3192011_3193262_+	cysteine desulfurase NifS	NA	NA	NA	NA	NA
WP_074841432.1|3193412_3193766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841431.1|3194091_3194784_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_074841430.1|3194916_3195516_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_074841429.1|3195977_3197123_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.6	8.1e-12
WP_164954470.1|3197166_3198327_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_074841427.1|3198340_3199585_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.0	2.5e-11
WP_074841437.1|3200945_3202166_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_074841425.1|3202223_3202874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841424.1|3203570_3203789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841423.1|3204230_3205367_-	MFS transporter	NA	NA	NA	NA	NA
WP_074841422.1|3205761_3206460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954471.1|3207006_3208311_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	3271679	3329773	3468545	transposase,protease,tRNA	Bacillus_virus(11.11%)	48	NA	NA
WP_074839320.1|3271679_3272141_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	40.3	8.5e-05
WP_074839228.1|3272336_3273752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074839226.1|3273993_3274617_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_074839223.1|3274635_3275079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074839221.1|3275289_3275868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074839218.1|3275948_3276986_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.1	8.0e-59
WP_074839216.1|3277277_3277958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074839214.1|3277966_3279112_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_074839212.1|3279108_3280380_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_083396862.1|3280469_3281777_-	hypothetical protein	NA	Q6DW11	Phage_TP	42.0	8.7e-71
WP_074839210.1|3281763_3282678_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	34.0	1.4e-38
WP_083396861.1|3282841_3285817_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	31.6	6.8e-87
WP_074839207.1|3285947_3287039_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	41.7	3.7e-75
WP_074839205.1|3287061_3288753_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.0	6.3e-21
WP_074839202.1|3288859_3290011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074839199.1|3290120_3291782_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	38.5	2.7e-85
WP_074839196.1|3292507_3293533_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_074839193.1|3293533_3294181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074839190.1|3294322_3295237_+	AEC family transporter	NA	NA	NA	NA	NA
WP_164954480.1|3295382_3295871_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_074839184.1|3295990_3296923_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074839182.1|3296944_3297505_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_074839179.1|3297752_3298691_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_074839176.1|3298677_3299445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074839312.1|3299879_3299966_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_164954481.1|3300089_3301319_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	52.7	7.6e-109
WP_074842008.1|3301517_3303092_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_164954482.1|3303268_3304558_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	40.7	6.2e-77
WP_164954483.1|3304627_3304885_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	56.8	1.7e-18
WP_074841973.1|3305081_3305951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841972.1|3306078_3307023_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.6	4.3e-43
WP_074842020.1|3307155_3308580_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_074842044.1|3308863_3310057_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_164954484.1|3310176_3311406_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	52.9	5.8e-109
WP_074841045.1|3311808_3312684_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_083396969.1|3312680_3313646_-	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	26.5	1.7e-10
WP_083396971.1|3313678_3314860_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	3.0e-30
WP_074841046.1|3315148_3316324_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_074841047.1|3316504_3318220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841048.1|3318260_3320138_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	48.9	4.0e-16
WP_074841049.1|3320661_3321903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841050.1|3321982_3322972_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_074841051.1|3322982_3323849_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	9.9e-47
WP_074841052.1|3323922_3325431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841053.1|3325621_3327247_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841054.1|3327380_3327665_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_074841055.1|3327783_3328635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841056.1|3328654_3329773_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.6	1.6e-17
>prophage 15
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	3338066	3390339	3468545	transposase	Helicobacter_phage(40.0%)	44	NA	NA
WP_164954538.1|3338066_3338447_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	53.6	2.2e-30
WP_164954485.1|3338545_3339910_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164954486.1|3340456_3341881_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164954487.1|3342367_3343480_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164954488.1|3343768_3345058_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	40.7	1.4e-76
WP_083397076.1|3345060_3345486_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_074841942.1|3345927_3347217_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_074841943.1|3347599_3348637_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_164954489.1|3348839_3350378_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_143075421.1|3350744_3351971_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_074841157.1|3351970_3352699_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_074841134.1|3352711_3353179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841135.1|3353175_3354348_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_074841136.1|3354351_3354978_-	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_074841137.1|3354964_3357367_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_074841138.1|3357359_3357971_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_083396982.1|3357963_3358413_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_074841140.1|3358445_3359465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841141.1|3359457_3360201_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_074841142.1|3360287_3360635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841143.1|3360627_3362076_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_074841144.1|3362062_3362635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074841145.1|3362640_3362889_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_074841146.1|3363029_3363287_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_074841147.1|3363295_3364102_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_074841148.1|3364102_3364897_-	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_074841149.1|3364898_3365972_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_074841150.1|3366188_3367802_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841151.1|3367928_3369548_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841152.1|3369730_3369976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841153.1|3370015_3370213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841154.1|3370389_3374178_-	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	25.3	5.2e-23
WP_164954490.1|3374285_3376064_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_074841837.1|3376676_3377771_+	porin	NA	NA	NA	NA	NA
WP_074841836.1|3378158_3379289_+	porin	NA	NA	NA	NA	NA
WP_074841835.1|3379540_3380665_+	porin	NA	NA	NA	NA	NA
WP_074841834.1|3381053_3381338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841833.1|3381610_3383368_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954491.1|3383404_3385162_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954492.1|3385197_3386955_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164954493.1|3387045_3388335_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	40.7	8.1e-77
WP_164954494.1|3388404_3388800_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.7	1.0e-35
WP_164954539.1|3388918_3389113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954495.1|3389151_3390339_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP047056	Succinivibrio dextrinosolvens strain Z6 chromosome, complete genome	3468545	3428645	3463312	3468545	integrase,transposase	Acidithiobacillus_phage(50.0%)	35	3436385:3436401	3457360:3457376
WP_164954540.1|3428645_3429467_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954503.1|3429726_3430713_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_164954504.1|3431178_3431940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954541.1|3432154_3432985_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_164954505.1|3432951_3433692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074842057.1|3433853_3434501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074842055.1|3434511_3434865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954506.1|3434987_3435821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954507.1|3435935_3438152_+|transposase	transposase	transposase	NA	NA	NA	NA
3436385:3436401	attL	CAATGCTTCGAATGCAT	NA	NA	NA	NA
WP_164954508.1|3438827_3439136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954158.1|3439147_3439564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954509.1|3439544_3440198_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.4	2.0e-15
WP_164954510.1|3440332_3440503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954511.1|3440574_3440934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954512.1|3440899_3441994_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_164954513.1|3443384_3445022_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164954308.1|3445538_3445988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164954514.1|3446117_3446981_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_164954542.1|3447299_3448964_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_164954113.1|3449226_3449571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954515.1|3449580_3450402_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_164954516.1|3450401_3450725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954517.1|3450909_3451509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074841981.1|3451870_3452860_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.7	1.1e-09
WP_074842021.1|3453219_3453555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954540.1|3453802_3454624_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_074841963.1|3454883_3455984_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_143075481.1|3456026_3457103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954518.1|3457376_3458855_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
3457360:3457376	attR	CAATGCTTCGAATGCAT	NA	NA	NA	NA
WP_074842057.1|3459016_3459664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074842055.1|3459674_3460028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954519.1|3460150_3460516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954520.1|3460674_3460983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954521.1|3461315_3462014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164954543.1|3461962_3463312_+|transposase	transposase	transposase	NA	NA	NA	NA
