The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	330850	338958	1395649		Staphylococcus_virus(16.67%)	7	NA	NA
WP_006730475.1|330850_331843_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.9	1.7e-138
WP_006733977.1|332034_333324_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.3	1.1e-68
WP_006737360.1|333327_334623_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	3.5e-19
WP_006730472.1|334736_335396_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.2	5.9e-07
WP_006735513.1|336261_337545_-	GTPase HflX	NA	NA	NA	NA	NA
WP_006735508.1|337578_338229_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	38.4	2.6e-07
WP_006728884.1|338322_338958_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	31.9	5.8e-28
>prophage 2
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	457418	484431	1395649	capsid,portal,tail,head,terminase,integrase	Lactobacillus_phage(59.09%)	34	446403:446418	463692:463707
446403:446418	attL	GGCACTTGCTGAAGAA	NA	NA	NA	NA
WP_164823923.1|457418_458540_-|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	48.3	7.4e-95
WP_164823924.1|458798_459770_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	52.0	4.5e-88
WP_164823925.1|460209_460626_-	ImmA/IrrE family metallo-endopeptidase	NA	X2CXW8	Lactobacillus_phage	39.5	2.2e-12
WP_164823926.1|460658_460961_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	60.6	1.1e-24
WP_164823927.1|461489_461714_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164823928.1|461761_462526_+	phage repressor protein/antirepressor Ant	NA	A0A075KJT3	Lactobacillus_phage	53.6	1.3e-66
WP_164824121.1|462580_462892_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164823929.1|463237_463387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164823930.1|463512_463989_+	hypothetical protein	NA	A0A2P0ZLB3	Lactobacillus_phage	39.9	7.2e-23
463692:463707	attR	GGCACTTGCTGAAGAA	NA	NA	NA	NA
WP_164824122.1|464046_464703_+	hypothetical protein	NA	Q6SE93	Lactobacillus_prophage	49.1	1.2e-20
WP_164823931.1|464718_465357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164823932.1|465353_465806_+	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	57.0	2.5e-41
WP_006737665.1|466038_466521_+	hypothetical protein	NA	Q20DE6	Lactobacillus_phage	57.4	1.7e-43
WP_006729801.1|467601_467790_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_006729802.1|467839_468235_+	antitoxin HicB	NA	I3NLB2	Bifidobacterium_phage	28.2	1.3e-06
WP_006730906.1|468339_468807_+	hypothetical protein	NA	A9D9R6	Lactobacillus_prophage	59.5	3.8e-45
WP_164823933.1|468796_470026_+|terminase	PBSX family phage terminase large subunit	terminase	X2CYF4	Lactobacillus_phage	57.2	7.8e-138
WP_006732591.1|470039_471470_+|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	45.5	2.8e-110
WP_006730975.1|471462_473055_+|capsid	minor capsid protein	capsid	Q6SED6	Lactobacillus_prophage	32.6	2.5e-43
WP_006730988.1|473059_473344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730954.1|473377_473869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730930.1|473865_474123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006738119.1|474577_475183_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_164823934.1|475196_476069_+	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	56.0	5.3e-80
WP_164823935.1|476085_476490_+|head,tail	phage head-tail connector protein	head,tail	A0A097BY74	Leuconostoc_phage	54.6	1.1e-24
WP_006730902.1|476473_476842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730949.1|476841_477222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006731470.1|477238_477811_+|tail	phage major tail protein, TP901-1 family	tail	A0A0A1ELH3	Lactobacillus_phage	46.8	8.6e-39
WP_006731482.1|477813_478125_+	hypothetical protein	NA	A0A0A1EKX8	Lactobacillus_phage	42.0	2.3e-14
WP_006731448.1|478185_478563_+	hypothetical protein	NA	A0A0A1EKY4	Lactobacillus_phage	45.1	5.1e-16
WP_006731490.1|478673_478988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164823936.1|479005_481861_+	tape measure protein	NA	A0A1P8BLX4	Lactococcus_phage	47.3	3.1e-89
WP_164823937.1|481864_482677_+|tail	phage tail protein	tail	A0A1P8BMI3	Lactococcus_phage	32.1	1.4e-21
WP_164823938.1|482673_484431_+	hypothetical protein	NA	A0A0A1ELH9	Lactobacillus_phage	30.9	2.1e-43
>prophage 3
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	601209	609513	1395649		Ectocarpus_siliculosus_virus(16.67%)	7	NA	NA
WP_164823973.1|601209_602349_+	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	25.5	1.3e-22
WP_164823974.1|602539_604378_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	37.1	8.4e-19
WP_006730037.1|604379_605066_+	class A sortase	NA	NA	NA	NA	NA
WP_164785776.1|605062_607348_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.5	1.3e-72
WP_006730035.1|607443_607971_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.0	6.7e-22
WP_006732879.1|608034_608991_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	58.0	1.0e-108
WP_006732882.1|609012_609513_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.0	1.4e-21
>prophage 4
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	671923	685559	1395649	protease,tRNA	unidentified_phage(12.5%)	13	NA	NA
WP_006730861.1|671923_673117_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	46.3	1.0e-41
WP_006729975.1|673214_673880_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_164799154.1|674006_674858_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.1	8.1e-17
WP_006731940.1|674866_675094_+	YozE family protein	NA	NA	NA	NA	NA
WP_164799155.1|675098_676481_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.8	1.5e-12
WP_006731946.1|676694_677534_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_006734115.1|677530_678283_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	39.6	2.0e-27
WP_006729969.1|678331_679177_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	34.1	8.3e-30
WP_164823989.1|679246_681334_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.2	3.7e-95
WP_164823990.1|681383_682697_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_006730858.1|682699_683623_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.6	3.0e-25
WP_164798704.1|683626_684151_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_164823991.1|684161_685559_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	24.4	1.4e-29
>prophage 5
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	927414	952765	1395649	transposase,integrase	Streptococcus_phage(85.71%)	24	927357:927374	931206:931223
927357:927374	attL	CTTTCCTTTATGGAAAGA	NA	NA	NA	NA
WP_006730188.1|927414_928722_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.6	1.8e-92
WP_006730099.1|929318_929792_+	universal stress protein	NA	NA	NA	NA	NA
WP_001291561.1|929976_931194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|931275_931479_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
931206:931223	attR	CTTTCCTTTATGGAAAGA	NA	NA	NA	NA
WP_000857133.1|931929_932160_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|932156_932579_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_001240982.1|933378_936297_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.1e-169
WP_000576156.1|936300_936855_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
WP_001038790.1|937209_937947_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
WP_001814874.1|938071_938155_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_000336323.1|938767_938935_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_000691736.1|939053_940973_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
WP_001791010.1|940988_941105_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224320.1|941349_942285_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_164824027.1|942281_943283_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	99.7	8.4e-191
WP_000804748.1|943279_945457_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_164824028.1|945459_947907_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	99.9	0.0e+00
WP_000506270.1|947890_948397_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|948371_948869_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|948985_949207_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|949249_950455_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000813488.1|950634_952020_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|952048_952435_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|952450_952765_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
>prophage 6
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	1069280	1080256	1395649		Bacillus_virus(28.57%)	8	NA	NA
WP_164824050.1|1069280_1071509_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.7	1.9e-129
WP_102695497.1|1071610_1072222_-	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	41.1	6.6e-21
WP_102695496.1|1072224_1072836_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_102695495.1|1073050_1074193_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.2	7.2e-61
WP_164824051.1|1074340_1077004_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.3	4.1e-75
WP_006729618.1|1077189_1078026_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.9	3.7e-67
WP_164824052.1|1078028_1079507_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.3	5.0e-107
WP_006734163.1|1079557_1080256_-	glycosyl transferase	NA	A0A2K9L2U7	Tupanvirus	28.1	4.9e-12
>prophage 7
NZ_CP049228	Lactobacillus iners strain C0210C1 chromosome, complete genome	1395649	1114237	1127233	1395649		Streptococcus_phage(37.5%)	9	NA	NA
WP_006729584.1|1114237_1114822_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	51.8	2.6e-51
WP_006730634.1|1114930_1116187_-	AAA domain-containing protein	NA	M1F3L1	Cronobacter_phage	27.6	5.9e-08
WP_164824066.1|1116202_1117696_-	hypothetical protein	NA	A0A191VYN2	Roseobacter_phage	23.0	3.9e-06
WP_006736366.1|1117688_1118633_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.1	7.0e-46
WP_006733566.1|1118632_1119667_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	52.7	2.1e-91
WP_006729579.1|1119679_1120555_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.3	1.0e-06
WP_164824067.1|1120606_1123423_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	1.4e-296
WP_164824068.1|1123450_1125448_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_006729576.1|1125505_1127233_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	45.8	1.3e-138
>prophage 1
NZ_CP049229	Lactobacillus iners strain C0210C1 plasmid pC0210C1, complete sequence	111803	33262	99591	111803	integrase,transposase	Lactobacillus_phage(30.0%)	57	24659:24718	52608:52672
24659:24718	attL	ATATAGTTATAAATAATTAGGTTAATTCAGTCATAAGGAATCATTTTGCGTGATTCCAAA	NA	NA	NA	NA
WP_164824148.1|33262_33691_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	46.2	9.3e-30
WP_164798948.1|33783_33954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102215558.1|34051_34270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734557.1|34398_34818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824149.1|34861_35236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824150.1|35247_35583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824183.1|35651_36704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824151.1|36716_38966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824152.1|38977_43456_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_145999005.1|43465_44185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734564.1|44562_45045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824153.1|45119_45728_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	42.3	3.7e-24
WP_164798958.1|45908_46115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824154.1|46128_46809_+	class A sortase	NA	NA	NA	NA	NA
WP_006734569.1|47289_47931_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	35.0	1.9e-18
WP_006734559.1|48277_48835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734566.1|48861_49629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824155.1|49780_50686_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_006735138.1|50890_51055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824156.1|51285_52377_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	23.6	3.1e-05
WP_164824157.1|52668_53001_-	hypothetical protein	NA	NA	NA	NA	NA
52608:52672	attR	TTTGGAATCACGCAAAATGATTCCTTATGACTGAATTAACCTAATTATTTATAACTATATTCTAA	NA	NA	NA	NA
WP_164824158.1|53377_54658_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_102215542.1|54667_57019_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_164824184.1|57218_57452_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_006734916.1|58008_58566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824159.1|58740_59655_+	LysM peptidoglycan-binding domain-containing protein	NA	D2KRB9	Lactobacillus_phage	31.3	3.8e-12
WP_164824160.1|59898_60240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824161.1|60245_60848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824162.1|61269_63516_-	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	26.1	2.9e-37
WP_164824163.1|63524_65576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824164.1|65585_66848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824165.1|66867_67854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824166.1|67979_68756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824167.1|68945_69659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102215533.1|70571_71330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824168.1|71610_74469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102215531.1|75290_75863_+	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	47.2	1.0e-23
WP_102215530.1|76176_77019_-	Eco47II family restriction endonuclease	NA	NA	NA	NA	NA
WP_102215529.1|77022_78021_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	48.9	1.6e-88
WP_164798920.1|78029_78194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164824169.1|79069_81172_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_164824170.1|82020_83490_+	replication initiation protein	NA	NA	NA	NA	NA
WP_164824171.1|83661_85158_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_006734637.1|85266_86211_-	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_006734645.1|86236_86716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006734644.1|86705_87020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102215527.1|87125_87542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824172.1|87624_88233_-	signal peptidase I	NA	NA	NA	NA	NA
WP_006734643.1|88372_88816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157750138.1|89165_89585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042745926.1|89797_92839_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_164798924.1|93398_94313_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_164798925.1|94410_95265_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_102215522.1|95650_96910_+	M23 family metallopeptidase	NA	Q6SEC2	Lactobacillus_prophage	42.9	1.6e-24
WP_164824173.1|96923_97559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734920.1|97558_98200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824174.1|98265_99591_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	37.4	1.9e-57
