The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	183046	195568	1398354	tRNA	Streptococcus_phage(45.45%)	16	NA	NA
WP_164824846.1|183046_185461_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	63.7	5.6e-305
WP_164824847.1|185482_187111_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_006732759.1|187134_187701_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	36.2	5.2e-20
WP_006730369.1|188192_189518_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	41.1	1.2e-35
WP_006730350.1|189544_189862_-	helix-turn-helix transcriptional regulator	NA	A0A141E255	Streptococcus_phage	59.6	1.1e-24
WP_006735923.1|189904_190624_-	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	44.3	2.5e-43
WP_006730335.1|190697_191366_-	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	41.5	4.1e-40
WP_006730355.1|191533_191710_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006730352.1|191835_191985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824848.1|192144_192324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824849.1|192837_193290_+	hypothetical protein	NA	B8R674	Lactobacillus_phage	70.2	3.1e-31
WP_164825120.1|193652_194036_+	MafB	NA	A0A1X9I626	Streptococcus_phage	50.0	1.2e-28
WP_006730332.1|194004_194205_+	hypothetical protein	NA	M1Q1V7	Streptococcus_phage	80.0	7.9e-24
WP_035507533.1|194750_194957_+	hypothetical protein	NA	Q708N1	Streptococcus_phage	68.2	4.5e-22
WP_006730340.1|194973_195168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824850.1|195151_195568_+	GTP pyrophosphokinase	NA	A0A141E1X8	Streptococcus_phage	47.2	1.6e-18
>prophage 2
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	401939	450825	1398354	terminase,portal,integrase,tRNA,tail,head,capsid	Lactobacillus_prophage(30.77%)	49	398342:398357	440911:440926
398342:398357	attL	ACAAGCCAAAATTAAA	NA	NA	NA	NA
WP_164824904.1|401939_402416_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_006729020.1|402493_403027_-	exonuclease	NA	M1PFD8	Streptococcus_phage	36.5	4.4e-21
WP_006731171.1|403140_404055_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_006730689.1|404109_405216_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.3	1.5e-34
WP_006730672.1|405202_406015_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006730696.1|406011_406812_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006735851.1|406808_407882_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006729026.1|407920_408763_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_006729027.1|408759_409728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006729028.1|409751_411104_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_006735496.1|411294_413106_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	38.2	3.4e-97
WP_006734931.1|413212_414736_+	membrane protein	NA	NA	NA	NA	NA
WP_006738068.1|414751_415150_+	CrcB family protein	NA	NA	NA	NA	NA
WP_164799103.1|415149_415500_+	protein CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.8	6.0e-11
WP_006737309.1|415551_416424_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_006737342.1|416698_416995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824905.1|417527_418319_+	Fic family protein	NA	NA	NA	NA	NA
WP_006729034.1|418501_419233_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_164824906.1|419304_420540_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_164799105.1|420551_421811_-	cytosine permease	NA	NA	NA	NA	NA
WP_164824907.1|421994_422441_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_006729038.1|422437_422869_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160807902.1|423019_423511_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_006732228.1|430806_431781_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_164824908.1|431752_432748_+	type II secretion system protein F	NA	NA	NA	NA	NA
WP_006731741.1|432762_433089_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_080550276.1|433072_433504_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_006729047.1|433493_433712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006735815.1|433698_434190_+	competence protein ComGF	NA	NA	NA	NA	NA
WP_164824909.1|434437_435439_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164824910.1|435449_436661_+	acetate kinase	NA	NA	NA	NA	NA
WP_006731471.1|437212_438334_-|integrase	tyrosine-type recombinase/integrase	integrase	Q6SEA7	Lactobacillus_prophage	48.1	2.6e-95
WP_006737543.1|439480_440050_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006729801.1|440743_440932_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
440911:440926	attR	ACAAGCCAAAATTAAA	NA	NA	NA	NA
WP_006729802.1|440981_441377_+	antitoxin HicB	NA	I3NLB2	Bifidobacterium_phage	28.2	1.3e-06
WP_006730906.1|441481_441949_+	hypothetical protein	NA	A9D9R6	Lactobacillus_prophage	59.5	3.8e-45
WP_006730944.1|441938_443168_+|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	58.7	1.6e-138
WP_006730946.1|443181_444612_+|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	45.5	4.7e-110
WP_006730975.1|444604_446197_+|capsid	minor capsid protein	capsid	Q6SED6	Lactobacillus_prophage	32.6	2.5e-43
WP_006730988.1|446201_446486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730954.1|446519_447011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730930.1|447007_447265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730958.1|447341_447602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006738119.1|447717_448323_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_164824911.1|448336_449209_+	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	55.8	2.4e-80
WP_164824912.1|449225_449630_+|head,tail	phage head-tail connector protein	head,tail	A0A097BY74	Leuconostoc_phage	55.7	5.0e-25
WP_006730902.1|449613_449982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730949.1|449981_450362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006730936.1|450378_450825_+|tail	phage major tail protein, TP901-1 family	tail	A0A0A1ELH3	Lactobacillus_phage	45.0	1.2e-24
>prophage 3
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	557818	588974	1398354	integrase,terminase,portal,capsid	Streptococcus_phage(35.71%)	42	554870:554890	575724:575744
554870:554890	attL	GGTTTTATTTTGCACAAAATT	NA	NA	NA	NA
WP_006731703.1|557818_559660_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.3	4.6e-134
WP_006731699.1|559728_560862_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	27.4	3.7e-25
WP_164824926.1|561050_562169_-|integrase	site-specific integrase	integrase	Q6SEA7	Lactobacillus_prophage	58.7	5.6e-127
WP_164824927.1|562169_562862_-	XRE family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	40.2	3.8e-41
WP_164824928.1|563014_563224_+	helix-turn-helix transcriptional regulator	NA	D2KRD7	Lactobacillus_phage	59.7	5.0e-13
WP_164824929.1|563331_563490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006732601.1|563507_563645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006731472.1|563646_563790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006731493.1|563939_564080_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_164824930.1|564082_564466_+	hypothetical protein	NA	A0A1X9I5P1	Streptococcus_phage	44.7	8.4e-14
WP_164824931.1|564486_564876_+	hypothetical protein	NA	B6SD57	Bacteriophage	30.8	7.7e-07
WP_164824932.1|564872_565634_+	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	58.6	6.2e-77
WP_164824933.1|565639_565855_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164824934.1|565867_566023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006735993.1|566552_566747_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164824935.1|566832_567201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824936.1|567187_568069_+	DUF1351 domain-containing protein	NA	Q6SE94	Lactobacillus_prophage	38.3	1.0e-51
WP_006735986.1|568071_568845_+	hypothetical protein	NA	Q6SEE8	Lactobacillus_prophage	68.6	1.3e-93
WP_164824937.1|570554_571013_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2D1GQ71	Lysinibacillus_phage	44.3	4.1e-15
WP_164824938.1|571013_571214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824939.1|571230_571713_+	hypothetical protein	NA	Q20DE6	Lactobacillus_phage	58.1	3.4e-44
WP_164824940.1|572295_572442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006735968.1|572632_572953_+	HNH endonuclease	NA	A0A1B1IMY5	Lactococcus_phage	70.1	4.3e-40
WP_164824941.1|573063_574377_+|portal	phage portal protein	portal	A0A1P8BMI8	Lactococcus_phage	59.7	2.7e-144
WP_164824942.1|575754_576264_+	N-6 DNA methylase	NA	A0A1S5S8X3	Streptococcus_phage	34.6	1.0e-19
575724:575744	attR	GGTTTTATTTTGCACAAAATT	NA	NA	NA	NA
WP_164824943.1|576244_577273_+	N-6 DNA methylase	NA	A0A1S5S9W3	Streptococcus_phage	28.6	4.2e-12
WP_164824944.1|577304_577523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824945.1|577673_579059_+|terminase	terminase	terminase	A0A1P8BMS5	Lactococcus_phage	62.5	1.5e-174
WP_006736002.1|579206_579659_+	hypothetical protein	NA	A0A126GGH5	Streptococcus_phage	28.6	8.1e-08
WP_006735961.1|579677_580580_+|capsid	phage major capsid protein	capsid	A0A141E166	Streptococcus_phage	71.8	4.9e-121
WP_006736000.1|580591_580735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006735953.1|580757_581156_+	hypothetical protein	NA	A0A1P8BMQ2	Lactococcus_phage	67.5	7.3e-37
WP_006735971.1|581174_581507_+	hypothetical protein	NA	Q7Y4I1	Streptococcus_phage	43.3	5.2e-20
WP_006735949.1|581503_581755_+	hypothetical protein	NA	M1NS01	Streptococcus_phage	45.6	4.5e-08
WP_006735958.1|581747_582077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006736001.1|582092_582707_+	hypothetical protein	NA	M1PKG8	Streptococcus_phage	45.3	2.3e-37
WP_164824946.1|582699_582987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006735946.1|583007_583376_+	hypothetical protein	NA	E8ZDP6	Streptococcus_phage	49.2	1.0e-21
WP_006736008.1|583368_583899_+	hypothetical protein	NA	A0A1P8BMM1	Lactococcus_phage	55.3	2.0e-45
WP_006735979.1|584338_586231_+	hypothetical protein	NA	A0A141E161	Streptococcus_phage	35.2	1.6e-20
WP_006735988.1|586227_586956_+	hypothetical protein	NA	A0A0A8WHP7	Clostridium_phage	26.8	2.7e-13
WP_006736018.1|586952_588974_+	phage minor structural protein, N-terminal domain protein	NA	A0A0A8WIC9	Clostridium_phage	30.0	8.6e-33
>prophage 4
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	592743	601110	1398354		Lactobacillus_phage(16.67%)	7	NA	NA
WP_164824949.1|592743_593847_+	glycosyl hydrolase family 25	NA	Q38317	Lactobacillus_phage	49.5	4.2e-50
WP_006731694.1|594136_595975_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.0	6.4e-19
WP_006736527.1|595976_596663_+	class A sortase	NA	NA	NA	NA	NA
WP_164824950.1|596659_598945_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.3	1.6e-72
WP_006730727.1|599041_599569_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.0	2.3e-22
WP_006735980.1|599631_600588_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	57.6	1.3e-108
WP_006731693.1|600609_601110_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	37.6	2.4e-21
>prophage 5
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	658840	672475	1398354	tRNA,protease	unidentified_phage(12.5%)	13	NA	NA
WP_160807844.1|658840_660034_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.9	1.1e-40
WP_164824958.1|660130_660796_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_164799154.1|660922_661774_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.1	8.1e-17
WP_006731940.1|661782_662010_+	YozE family protein	NA	NA	NA	NA	NA
WP_164824959.1|662014_663397_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.8	1.1e-12
WP_164824960.1|663610_664450_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_006731927.1|664446_665199_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	39.6	2.0e-27
WP_006731930.1|665247_666093_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	34.1	4.8e-30
WP_102695365.1|666162_668250_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.1	1.1e-94
WP_164823990.1|668299_669613_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_164798703.1|669615_670539_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	27.2	5.1e-25
WP_006729965.1|670542_671067_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_009310273.1|671077_672475_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	24.4	1.8e-29
>prophage 6
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	922020	942041	1398354	integrase	Streptococcus_phage(94.74%)	22	921963:921980	925812:925829
921963:921980	attL	CTTTCCTTTATGGAAAGA	NA	NA	NA	NA
WP_006730188.1|922020_923328_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.6	1.8e-92
WP_006730099.1|923924_924398_+	universal stress protein	NA	NA	NA	NA	NA
WP_164825019.1|924582_925800_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	99.8	1.1e-232
WP_000814511.1|925881_926085_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
925812:925829	attR	CTTTCCTTTATGGAAAGA	NA	NA	NA	NA
WP_001224508.1|926550_926781_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	88.2	2.6e-31
WP_005957428.1|926777_927203_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	98.6	1.4e-70
WP_001227347.1|927707_928061_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
WP_000336323.1|928120_928288_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_164825020.1|928406_930326_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	98.9	0.0e+00
WP_001791010.1|930341_930458_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224320.1|930702_931638_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
WP_000769868.1|931634_932636_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000804748.1|932632_934810_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
WP_164825021.1|934812_937260_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	97.5	0.0e+00
WP_025186755.1|937243_937636_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	1.2e-68
WP_002368312.1|937649_938147_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	94.5	9.6e-87
WP_001009056.1|938263_938485_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|938527_939733_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000879507.1|939755_939908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813488.1|939910_941296_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|941324_941711_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|941726_942041_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
>prophage 7
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	1055047	1066025	1398354		Bacillus_virus(28.57%)	8	NA	NA
WP_164825043.1|1055047_1057276_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.7	4.1e-129
WP_006733924.1|1057377_1057989_-	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	40.4	1.9e-20
WP_164825044.1|1057991_1058603_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_006729620.1|1058819_1059962_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	32.4	1.9e-61
WP_164825045.1|1060108_1062772_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	30.1	1.2e-74
WP_006729618.1|1062958_1063795_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.9	3.7e-67
WP_006731299.1|1063797_1065276_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.3	2.9e-107
WP_006729616.1|1065326_1066025_-	glycosyl transferase	NA	A0A2K9L2U7	Tupanvirus	27.7	1.4e-11
>prophage 8
NZ_CP049226	Lactobacillus iners strain C0011D1 chromosome, complete genome	1398354	1100500	1113499	1398354		Streptococcus_phage(37.5%)	9	NA	NA
WP_006729584.1|1100500_1101085_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	51.8	2.6e-51
WP_164825050.1|1101193_1102450_-	AAA domain-containing protein	NA	M1F3L1	Cronobacter_phage	27.6	5.9e-08
WP_006734834.1|1102465_1103962_-	hypothetical protein	NA	A0A191VYN2	Roseobacter_phage	23.2	1.7e-06
WP_006731198.1|1103954_1104899_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.1	7.0e-46
WP_006729580.1|1104898_1105933_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	52.7	3.5e-91
WP_006729579.1|1105945_1106821_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.3	1.0e-06
WP_164825051.1|1106872_1109689_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.9	2.9e-297
WP_164825052.1|1109716_1111714_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_006737223.1|1111771_1113499_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	45.8	5.8e-139
>prophage 1
NZ_CP049227	Lactobacillus iners strain C0011D1 plasmid pC0011D1, complete sequence	105257	9629	59621	105257	integrase,transposase	Bacillus_phage(20.0%)	46	35262:35278	58681:58697
WP_164825141.1|9629_9815_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	55.4	1.3e-09
WP_164825142.1|9979_11770_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_164825143.1|11750_12272_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_164825144.1|12325_12784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825145.1|13012_14680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164825146.1|14874_15690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145999009.1|15655_16180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825147.1|16202_17018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825148.1|17417_19004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734626.1|19513_21013_+	ATPase AAA	NA	NA	NA	NA	NA
WP_006734632.1|21309_21645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164825149.1|21650_22871_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_164825150.1|23110_26467_+	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_164825180.1|26842_28093_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006734629.1|28299_29364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734625.1|29382_30414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825151.1|30415_31702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102215578.1|31829_32348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825152.1|32501_33830_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.8	7.3e-57
WP_006734667.1|34117_34678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825153.1|34826_35096_+	hypothetical protein	NA	NA	NA	NA	NA
35262:35278	attL	TGGTTCCTTTTTGTTTT	NA	NA	NA	NA
WP_164825154.1|35321_36827_+	DUF3854 domain-containing protein	NA	NA	NA	NA	NA
WP_164824143.1|37320_37500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825155.1|37659_38490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102215561.1|38579_39401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825156.1|39444_40356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824147.1|40420_40834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825157.1|40929_41358_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	46.2	9.3e-30
WP_164798948.1|41450_41621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102215558.1|41717_41936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825181.1|42064_42484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734556.1|42527_42902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164824150.1|42913_43249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825158.1|43317_44370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825159.1|44382_46632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825160.1|46643_51122_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_164825161.1|51248_51857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825162.1|52191_53076_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_164825163.1|53145_53754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825164.1|53828_54437_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	72.6	7.3e-20
WP_164798958.1|54617_54824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825165.1|54837_55518_+	class A sortase	NA	NA	NA	NA	NA
WP_164825166.1|55821_56463_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	34.5	7.2e-18
WP_006734559.1|56809_57367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006734566.1|57393_58161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164825167.1|58715_59621_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
58681:58697	attR	TGGTTCCTTTTTGTTTT	NA	NA	NA	NA
