The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049298	Chryseobacterium sp. POL2 chromosome, complete genome	3243462	430318	486345	3243462	integrase,transposase	Cellulophaga_phage(28.57%)	53	423486:423545	484522:484704
423486:423545	attL	AACGAAAAAGTATTGGCGAAGTGCGGGCTTTCGAAGAACGAAAAGTTCAAGAAAGACTGT	NA	NA	NA	NA
WP_165131054.1|430318_431557_+|integrase	site-specific integrase	integrase	S0A3I4	Cellulophaga_phage	24.9	5.4e-22
WP_165131056.1|431563_432709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131058.1|432711_433629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131060.1|434359_435577_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	25.3	2.3e-12
WP_165131062.1|435632_436709_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	33.4	5.4e-50
WP_165131064.1|436888_437260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131066.1|437339_437609_+	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_165131068.1|437595_438279_+	SCO family protein	NA	NA	NA	NA	NA
WP_165131070.1|438282_438651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131072.1|438740_439568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131074.1|439560_440634_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_165131076.1|440633_441581_+	transporter	NA	NA	NA	NA	NA
WP_165131078.1|441653_442562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131080.1|442651_442930_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165131082.1|443071_445252_+	virulence-associated E family protein	NA	M1NXJ3	Cellulophaga_phage	37.3	1.5e-62
WP_165131084.1|445675_446680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131085.1|446679_448356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131086.1|448355_448979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131087.1|448975_449419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131088.1|449415_449895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131089.1|450857_451283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131090.1|451481_451760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131091.1|451749_452013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131092.1|452025_452478_-	hypothetical protein	NA	A0A1B1IRB1	uncultured_Mediterranean_phage	32.9	2.3e-15
WP_165131094.1|452557_453361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131096.1|453469_453961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131098.1|454070_454508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131100.1|454813_456388_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131102.1|456513_456921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131104.1|458853_459243_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_165131106.1|460374_461106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131108.1|461613_463119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131100.1|463440_465015_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131110.1|465134_465452_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_165131112.1|465454_465694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131114.1|465743_465977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131116.1|465956_466700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131118.1|466923_467496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131120.1|467712_468414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131122.1|469128_469866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131124.1|469956_472155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131126.1|472338_473109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131128.1|473127_473658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131130.1|474149_475313_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_165131132.1|475313_476411_-	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	33.6	2.1e-25
WP_165131134.1|476710_477010_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_165131136.1|477009_477258_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_165131100.1|477604_479179_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131138.1|479291_479870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131140.1|480121_480589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131142.1|480841_481630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131144.1|481644_484428_-	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	25.3	2.7e-37
WP_165131100.1|484770_486345_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
484522:484704	attR	AACGAAAAAGTATTGGCGAAGTGCGGGCTTTCGAAGAACGAAAAGTTCAAGAAAGACTGTACGAAGCAAATTGCTTTTTCAGATTGTTAAATTACAAAAATAATCAATATGAAAAGCAAGTTGCGACTAAAAAAGTAGAGTAGTTCAACTCAGACTTAACCCCGCATTTTGCCAATACAATGT	NA	NA	NA	NA
>prophage 2
NZ_CP049298	Chryseobacterium sp. POL2 chromosome, complete genome	3243462	585709	617667	3243462	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	33	NA	NA
WP_165131100.1|585709_587284_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131236.1|587381_587846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131272.1|588015_588528_-	DUF2947 family protein	NA	NA	NA	NA	NA
WP_165131274.1|588749_589244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131276.1|589247_589445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055041231.1|589461_589767_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_055041230.1|589748_589991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131278.1|590271_590769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131100.1|591753_593328_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131280.1|593438_594005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131282.1|594224_595094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005783159.1|595969_597136_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_165131284.1|598085_598595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131286.1|598608_600177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131288.1|600455_600845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131289.1|600878_601244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131100.1|601580_603155_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131110.1|603274_603592_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_165131112.1|603594_603834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131238.1|603883_604117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131100.1|604866_606441_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131149.1|606553_607501_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014043450.1|607856_608486_+	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	33.5	3.3e-23
WP_038694170.1|608689_609193_-	dihydrofolate reductase	NA	U5J9P6	Bacillus_phage	41.3	8.7e-27
WP_165131291.1|609761_610988_+	EreD family erythromycin esterase	NA	NA	NA	NA	NA
WP_014043450.1|611383_612013_+	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	33.5	3.3e-23
WP_165131293.1|612978_613512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131100.1|613789_615364_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_165131295.1|615443_615671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165131297.1|615878_616601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131299.1|616634_616961_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165131301.1|616978_617266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165131303.1|617232_617667_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP049298	Chryseobacterium sp. POL2 chromosome, complete genome	3243462	1314393	1366217	3243462	transposase,tRNA	Lake_Baikal_phage(28.57%)	52	NA	NA
WP_165133007.1|1314393_1314867_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_165133009.1|1314955_1316293_-	peptidoglycan synthetase	NA	NA	NA	NA	NA
WP_165133011.1|1316332_1316932_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_165133014.1|1316939_1318718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133017.1|1318926_1319727_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_165133020.1|1319774_1320404_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_165133021.1|1320469_1321825_-	TolC family protein	NA	NA	NA	NA	NA
WP_165137548.1|1321968_1322658_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	1.4e-35
WP_165133022.1|1322734_1323964_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165133023.1|1324039_1325311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_165133024.1|1325346_1326543_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_165133025.1|1326584_1328327_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.9e-49
WP_165133026.1|1328330_1329068_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_165133027.1|1329319_1329814_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_165133028.1|1329810_1330305_+	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_165133029.1|1330307_1330856_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_165133030.1|1330931_1331576_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_165133031.1|1331605_1332415_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_165133033.1|1332464_1332851_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_165137551.1|1332987_1334184_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.3	1.7e-28
WP_165133035.1|1334593_1336327_-	organic solvent tolerance protein OstA	NA	NA	NA	NA	NA
WP_165133037.1|1336330_1336804_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_165133039.1|1336864_1338826_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.0	1.3e-65
WP_165133041.1|1339278_1339467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165133043.1|1339463_1339994_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_165133045.1|1340035_1340875_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_165133047.1|1340990_1342193_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_165133049.1|1342310_1343219_+	endonuclease	NA	NA	NA	NA	NA
WP_165133052.1|1343333_1343528_-	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	48.5	1.3e-10
WP_165133055.1|1343549_1343978_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_165133058.1|1344569_1344896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_165133061.1|1344908_1345196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133064.1|1345162_1345588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_165133067.1|1345715_1347206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133070.1|1347315_1350420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133073.1|1350438_1350969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133076.1|1351187_1351814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133080.1|1352091_1352637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133083.1|1352870_1353065_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	48.5	5.7e-11
WP_165133086.1|1353148_1353412_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_165133089.1|1354377_1355586_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_165133092.1|1356363_1356885_-|transposase	transposase family protein	transposase	S5WIU1	Leptospira_phage	46.2	1.2e-31
WP_165133095.1|1356877_1357246_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_165133098.1|1357278_1357548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_165133101.1|1357632_1358904_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_165133104.1|1359335_1359881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133107.1|1360533_1361205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133110.1|1361272_1361863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133113.1|1362143_1364957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133116.1|1365039_1365636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165133119.1|1365750_1366074_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_165133122.1|1365968_1366217_-|transposase	transposase	transposase	NA	NA	NA	NA
