The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	293809	315601	4930938	transposase	Salmonella_phage(66.67%)	15	NA	NA
WP_000090707.1|293809_294652_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|294638_296762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|296761_298210_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|298250_299807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262423.1|299818_300745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|301097_301397_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000124023.1|301668_304656_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
WP_001089729.1|305355_306489_-	permease	NA	NA	NA	NA	NA
WP_050901219.1|306594_306909_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001351729.1|308660_309053_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|309190_310075_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|310106_311306_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_039045916.1|311411_312047_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_112324593.1|312185_314891_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	74.3	0.0e+00
WP_001067855.1|314896_315601_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	1212720	1290599	4930938	plate,holin,integrase,transposase,capsid,portal,head,terminase,tRNA,tail	Salmonella_phage(87.5%)	78	1225519:1225563	1261609:1261653
WP_095055964.1|1212720_1213832_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
WP_023138944.1|1214004_1214442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023138943.1|1214657_1215830_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_023138942.1|1215850_1216771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135733575.1|1217051_1217342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139760054.1|1217420_1217966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139760055.1|1218315_1219302_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_135733578.1|1219276_1220758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112324634.1|1220750_1221746_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_162623953.1|1222499_1224029_+	histidine kinase	NA	NA	NA	NA	NA
WP_033903661.1|1224123_1225353_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	88.5	2.0e-210
1225519:1225563	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1225680_1226706_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000616878.1|1226709_1227342_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1227461_1227704_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460858.1|1227736_1228246_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_023138936.1|1228253_1228454_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	98.5	1.6e-32
WP_000963479.1|1228417_1228759_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_023138935.1|1228826_1229060_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	83.1	3.7e-25
WP_000785510.1|1229059_1229287_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|1229283_1229868_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_023138934.1|1229864_1230725_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.1	3.4e-132
WP_023138933.1|1230715_1233145_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_023138932.1|1233298_1233487_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	4.6e-26
WP_001217575.1|1233497_1233731_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1233844_1234522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001655629.1|1234873_1235980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024138933.1|1235992_1236427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023138931.1|1236426_1237092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023138930.1|1237161_1238196_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.0	5.5e-177
WP_023138929.1|1238195_1239962_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.8	0.0e+00
WP_023138928.1|1240104_1240938_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	99.6	6.9e-130
WP_023138927.1|1240954_1242019_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.4	2.7e-195
WP_023138926.1|1242022_1242673_+|terminase	phage terminase	terminase	A0A1S6KZX1	Salmonella_phage	99.5	3.2e-114
WP_000673535.1|1242766_1243231_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_023138925.1|1243230_1243434_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_023138924.1|1243437_1243653_+|holin	holin family protein	holin	E5G6N0	Salmonella_phage	98.6	1.3e-32
WP_001069919.1|1243633_1244143_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|1244147_1244525_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_024133383.1|1244521_1244950_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	98.6	1.5e-67
WP_001039961.1|1245045_1245477_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_023138923.1|1245469_1245916_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.4	1.5e-59
WP_023138922.1|1245934_1247026_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.2	1.4e-18
WP_024148874.1|1247027_1247672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001672413.1|1247745_1248324_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000177408.1|1248320_1248680_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_023138920.1|1248666_1249575_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.3	2.2e-158
WP_023138919.1|1249567_1250173_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	5.8e-118
WP_023262363.1|1250169_1251825_+|tail	phage tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	98.9	0.0e+00
WP_023138916.1|1251827_1252367_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.2	6.1e-95
WP_077908642.1|1252370_1252988_-|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	98.5	1.4e-111
WP_023262362.1|1252957_1253947_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.7	4.3e-187
WP_001165558.1|1253976_1254534_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_023138915.1|1254636_1255809_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
WP_001207653.1|1255818_1256334_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280967.1|1256388_1256691_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763316.1|1256705_1256825_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_023138914.1|1256817_1259625_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.0	0.0e+00
WP_023138913.1|1259621_1260107_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.8	7.2e-71
WP_023138912.1|1260103_1261204_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	2.4e-194
WP_000980498.1|1261272_1261491_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_075321944.1|1262042_1263206_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1261609:1261653	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023138910.1|1263213_1265394_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_112324624.1|1265390_1266800_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_112324625.1|1266864_1278339_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1278953_1279436_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1279585_1280062_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1280051_1280342_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1280507_1280846_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1280994_1282656_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1282741_1283620_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_023138907.1|1283743_1284334_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1284368_1284974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1285094_1286381_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1286400_1287192_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1287357_1288719_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1288971_1289220_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1289238_1289787_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469813.1|1289831_1290599_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	1547374	1590361	4930938	lysis,integrase,transposase,coat,portal	Salmonella_phage(67.8%)	64	1569240:1569256	1590643:1590659
WP_001208732.1|1547374_1547578_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
WP_023138683.1|1547674_1548049_-	hypothetical protein	NA	A0A1V0E5M6	Salmonella_phage	100.0	2.0e-65
WP_023138681.1|1548292_1548559_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	100.0	1.5e-46
WP_023138676.1|1550678_1550849_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	92.9	4.8e-22
WP_017441417.1|1550859_1551153_-	DUF2856 family protein	NA	A0A2H4FNA1	Salmonella_phage	96.9	1.4e-48
WP_001253476.1|1551199_1551484_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_023138675.1|1551483_1552191_-	hypothetical protein	NA	I6R0N0	Salmonella_phage	88.5	7.2e-120
WP_000613174.1|1552198_1552387_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
WP_001181693.1|1552474_1552669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000983401.1|1552653_1552788_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	75.6	2.8e-09
WP_000401881.1|1552873_1553128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112324622.1|1553300_1553801_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	5.2e-32
WP_000213981.1|1553884_1554079_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_000216184.1|1554157_1554493_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	86.9	5.0e-47
WP_125866875.1|1554513_1554696_-	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	96.7	6.3e-28
WP_001297096.1|1554871_1555651_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255946.1|1555650_1556673_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_162623949.1|1556686_1556992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020838491.1|1557047_1557392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023253052.1|1557427_1558351_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	94.5	5.1e-174
WP_020838493.1|1558462_1559095_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.4	1.3e-32
WP_020838494.1|1559193_1559412_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	67.6	4.9e-19
WP_000424167.1|1559520_1559799_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|1559833_1559980_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067077.1|1559972_1560806_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	99.3	4.2e-151
WP_112324612.1|1560802_1562179_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	99.3	1.8e-252
WP_020898888.1|1562175_1562445_+	hypothetical protein	NA	I6S1N5	Salmonella_phage	97.8	3.2e-44
WP_058115773.1|1562516_1562798_+	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	9.1e-42
WP_000344577.1|1563018_1563270_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	65.5	2.9e-23
WP_024150883.1|1563272_1563569_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
WP_112324613.1|1563525_1563972_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	1.2e-80
WP_024147316.1|1563968_1564142_+	hypothetical protein	NA	Q8HAF7	Salmonella_phage	98.2	3.4e-31
WP_000113766.1|1564108_1564291_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	5.7e-29
WP_020898882.1|1564287_1564458_+	NinF family protein	NA	I6R994	Salmonella_phage	83.3	2.4e-21
WP_001749499.1|1564450_1564687_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
WP_020898881.1|1564667_1565138_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	96.2	6.3e-88
WP_023138244.1|1565125_1565308_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	96.7	4.2e-24
WP_001235461.1|1565304_1565928_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000286100.1|1566602_1566806_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_112324617.1|1566783_1567281_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	98.2	4.2e-90
WP_023253534.1|1567369_1567837_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	88.4	1.9e-68
WP_001530409.1|1568046_1568544_+	DNA-binding protein	NA	A0A1V0E5R9	Salmonella_phage	100.0	1.4e-93
WP_001283924.1|1568540_1568798_+	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_000807788.1|1569093_1569336_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
1569240:1569256	attL	CCAGTCAGGCGGCGCTA	NA	NA	NA	NA
WP_001140559.1|1569339_1569729_+	hypothetical protein	NA	C6ZR72	Salmonella_phage	98.4	3.3e-74
WP_000013070.1|1569728_1570133_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	1.7e-65
WP_000729924.1|1570136_1570625_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_017441431.1|1570602_1572102_+	DNA packaging protein	NA	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
WP_023138248.1|1572101_1574279_+|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.6	0.0e+00
WP_112324614.1|1574292_1575204_+	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	4.1e-160
WP_112324615.1|1575203_1576496_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.1	2.1e-242
WP_000538675.1|1576536_1577097_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
WP_001166101.1|1577080_1577581_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
WP_023138249.1|1577540_1578959_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
WP_023138250.1|1578962_1579601_+	hypothetical protein	NA	A0A088CPT1	Enterobacteria_phage	98.1	6.5e-88
WP_023138251.1|1579600_1580056_+	DUF2824 family protein	NA	I6R0L6	Salmonella_phage	98.7	1.5e-86
WP_023259240.1|1580058_1580748_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	93.4	4.3e-93
WP_023138707.1|1580757_1582107_+	phage DNA ejection protein	NA	B9UDL0	Salmonella_phage	98.7	1.2e-243
WP_031609731.1|1582103_1583924_+	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	93.3	4.1e-276
WP_112324616.1|1584508_1586296_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	87.5	8.9e-58
WP_024137322.1|1586327_1587782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023138703.1|1587771_1588698_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	92.8	2.2e-161
WP_023138702.1|1588694_1589057_-	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
WP_017441447.1|1589191_1590361_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	99.2	7.7e-228
1590643:1590659	attR	TAGCGCCGCCTGACTGG	NA	NA	NA	NA
>prophage 4
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	1832479	1841650	4930938	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1832479_1833427_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1833410_1834142_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1834122_1834230_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1834289_1835021_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1835243_1836929_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1836925_1837645_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1837691_1838159_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023138368.1|1838215_1838746_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1838917_1839376_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023138369.1|1839616_1841650_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	2019873	2027140	4930938		Morganella_phage(33.33%)	8	NA	NA
WP_023137976.1|2019873_2020293_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	6.5e-36
WP_001728934.1|2020295_2021564_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	3.2e-227
WP_000208509.1|2022018_2022231_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|2022241_2022430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023137975.1|2022688_2023900_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.7	4.9e-108
WP_000107443.1|2024549_2024861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023137974.1|2024940_2025636_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
WP_001157305.1|2025709_2027140_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	4055269	4141102	4930938	lysis,integrase,portal,terminase,tRNA,tail,protease	Enterobacteria_phage(50.94%)	91	4063620:4063635	4145337:4145352
WP_023138574.1|4055269_4055956_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001541509.1|4056355_4056496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194359.1|4056591_4057308_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000749515.1|4057574_4057889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811635.1|4058273_4058945_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000482235.1|4059283_4059829_+	fimbrial protein SthA	NA	NA	NA	NA	NA
WP_000680522.1|4059899_4060583_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_033903619.1|4060628_4063166_+	fimbrial outer membrane usher protein	NA	NA	NA	NA	NA
WP_001584421.1|4063183_4063741_+	fimbrial protein SthD	NA	NA	NA	NA	NA
4063620:4063635	attL	ATATCAACAGTAATAC	NA	NA	NA	NA
WP_023138572.1|4063781_4064867_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000920383.1|4064924_4066274_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_017441769.1|4066331_4067756_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.1	2.7e-09
WP_001187046.1|4067755_4068445_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_000875811.1|4068457_4068931_-	protein CreA	NA	NA	NA	NA	NA
WP_000371685.1|4069142_4070012_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_023138571.1|4070008_4070656_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000554315.1|4070704_4071220_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000192003.1|4071321_4071648_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000373272.1|4071705_4073643_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
WP_023138570.1|4073851_4075519_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.3e-42
WP_023138569.1|4075636_4076869_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	3.3e-88
WP_001029710.1|4077019_4078402_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132983.1|4078485_4079454_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000090067.1|4079570_4080215_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_023138568.1|4080248_4081265_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_023138567.1|4081575_4082265_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_000722272.1|4082312_4083002_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_001112028.1|4083079_4083787_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023138566.1|4083800_4086209_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017441766.1|4086205_4086778_+	membrane protein	NA	NA	NA	NA	NA
WP_000224864.1|4086815_4087535_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816454.1|4087744_4088968_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_023138565.1|4089019_4090342_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	2.3e-79
WP_001127752.1|4090465_4091263_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_023138564.1|4091504_4093055_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001064939.1|4093026_4093890_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_023138563.1|4093922_4094696_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531540.1|4094692_4095766_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490276.1|4095888_4096050_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
WP_000178963.1|4096178_4096796_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_023138562.1|4097197_4098784_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	4.1e-30
WP_001217546.1|4099003_4099252_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_000348577.1|4099789_4099987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023138561.1|4100129_4100711_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.5e-104
WP_077908628.1|4100710_4103833_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	52.8	4.7e-54
WP_023138558.1|4103897_4104497_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	88.4	4.5e-99
WP_023138557.1|4104564_4108053_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.7	0.0e+00
WP_153274582.1|4108119_4108458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028127181.1|4108530_4109172_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
WP_033903618.1|4109069_4109813_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001179670.1|4109817_4110516_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	4.9e-129
WP_023138555.1|4110515_4110845_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	95.4	5.4e-54
WP_112324602.1|4110841_4113916_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.9	0.0e+00
WP_001161009.1|4113887_4114217_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001372042.1|4114225_4114612_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_000211106.1|4114671_4115415_-|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_001079419.1|4115425_4115827_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677106.1|4115823_4116402_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|4116413_4116689_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|4116681_4117005_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_065311213.1|4117091_4119119_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_015953980.1|4119063_4120644_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|4120571_4120784_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023138551.1|4120780_4122883_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
WP_000373425.1|4122882_4123377_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001139680.1|4124052_4124205_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001341210.1|4124192_4124660_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135251.1|4124656_4125154_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	99.4	1.7e-91
WP_000839596.1|4125153_4125369_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_023138550.1|4125435_4126488_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	8.0e-208
WP_000917730.1|4126638_4126842_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_023138549.1|4127242_4128106_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	40.8	2.4e-40
WP_077908626.1|4128118_4128484_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.4e-56
WP_033903617.1|4128499_4129489_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001061380.1|4129496_4130306_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_000767103.1|4130325_4130715_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_000210170.1|4130711_4131038_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|4131034_4131688_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_015364395.1|4131687_4132182_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	3.3e-87
WP_000061519.1|4132178_4132997_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000620697.1|4132993_4133218_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	1.3e-38
WP_023138547.1|4133214_4134363_-	antirepressor from phage	NA	K7PLX4	Enterobacteria_phage	87.5	2.2e-179
WP_023138546.1|4134359_4134911_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	99.5	1.3e-100
WP_001191669.1|4134903_4135164_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001345148.1|4135261_4135954_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_072208138.1|4136470_4137019_+	hypothetical protein	NA	U5P4J6	Shigella_phage	98.3	1.2e-98
WP_000081297.1|4137084_4137909_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_023138545.1|4138036_4138573_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	4.1e-99
WP_071591280.1|4138807_4139083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|4139285_4139618_+	protein flxA	NA	NA	NA	NA	NA
WP_001218281.1|4139878_4141102_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
4145337:4145352	attR	GTATTACTGTTGATAT	NA	NA	NA	NA
>prophage 7
NZ_CP043509	Salmonella enterica subsp. enterica serovar Rissen strain GJ0703-2 chromosome, complete genome	4930938	4492495	4555489	4930938	transposase,plate,tRNA,tail	Burkholderia_phage(29.63%)	63	NA	NA
WP_164528041.1|4492495_4493724_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.3e-169
WP_000389245.1|4494265_4494898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168322.1|4495937_4496468_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
WP_000357725.1|4496715_4499541_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
WP_001609612.1|4499672_4500128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023138079.1|4500114_4500453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155665.1|4500453_4500810_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270392.1|4500812_4501229_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_000724435.1|4501357_4502071_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_112324618.1|4502257_4503451_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147297.1|4503636_4504716_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_000918353.1|4504747_4506163_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235550.1|4506227_4507211_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891417.1|4507385_4507628_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_023138081.1|4507795_4508794_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4508881_4510192_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4510438_4510954_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4511053_4511263_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4511284_4511398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4511394_4512720_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4512898_4513507_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4513615_4513984_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4514154_4516575_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_023138082.1|4516673_4517546_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4517559_4518057_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4518237_4519155_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973644.1|4519318_4520677_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4520765_4521875_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4522236_4523427_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023138083.1|4523558_4525103_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4525117_4526008_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4526173_4526584_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4526726_4528823_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023138084.1|4528822_4529560_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_161126850.1|4529556_4530225_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4530258_4530501_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790033.1|4530944_4532594_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4532938_4534288_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4534418_4534766_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4535342_4535630_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001270445.1|4535632_4536238_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.0	5.9e-62
WP_023138085.1|4536250_4536565_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000875313.1|4537175_4537373_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_023138087.1|4537362_4538790_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
WP_023138088.1|4538789_4539314_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	6.2e-68
WP_001003638.1|4539365_4539683_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001728452.1|4539642_4539771_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023138089.1|4539867_4542234_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.1	2.4e-66
WP_023138090.1|4542233_4543187_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4543186_4543396_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023138091.1|4543383_4544427_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
WP_023138092.1|4544436_4545159_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4545485_4545848_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023138093.1|4545844_4546774_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.4	6.1e-151
WP_023138094.1|4546773_4548321_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_023138095.1|4548484_4548844_+|plate	baseplate	plate	Q6QIA0	Burkholderia_phage	62.4	4.0e-34
WP_023138096.1|4548834_4549950_+|plate	phage baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	5.3e-101
WP_000359503.1|4549942_4550575_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023138097.1|4550577_4552323_+|tail	phage tail fiber protein H	tail	A0A0M3ULH6	Salmonella_phage	40.5	1.9e-52
WP_031607397.1|4552327_4552933_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017465885.1|4552929_4553385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132246.1|4553765_4554182_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587738.1|4554760_4555489_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
