The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	1084983	1118420	4293243	transposase,integrase	Erysipelothrix_phage(40.0%)	24	1084449:1084463	1090525:1090539
1084449:1084463	attL	TATTAAATGTACGAT	NA	NA	NA	NA
WP_001218618.1|1084983_1086225_-|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.8	1.3e-76
WP_001995600.1|1086226_1086496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|1086498_1087473_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000348524.1|1087937_1088381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156734129.1|1090554_1093533_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
1090525:1090539	attR	ATCGTACATTTAATA	NA	NA	NA	NA
WP_165122344.1|1095014_1095782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078081115.1|1097020_1097896_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001255015.1|1098959_1099265_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156734112.1|1099381_1100365_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_165122345.1|1100437_1101205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082987283.1|1101961_1102207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502095.1|1102501_1102879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064754130.1|1102875_1104039_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_077782102.1|1104056_1104917_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001120888.1|1106625_1108119_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_156734127.1|1108370_1109993_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	29.5	3.9e-28
WP_156734125.1|1110063_1110693_-	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	34.7	1.4e-18
WP_156734123.1|1110921_1111371_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_165122346.1|1111391_1111781_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_165122347.1|1112251_1113046_+	aminoglycoside 3'-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	38.6	9.8e-41
WP_156734117.1|1113045_1113471_+	hypothetical protein	NA	A0A2K5B2B6	Erysipelothrix_phage	43.2	2.2e-07
WP_156734115.1|1113753_1115253_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_084929516.1|1115593_1116466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734113.1|1116926_1118420_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	1573007	1615731	4293243	tRNA,lysis,terminase,capsid,tail,integrase,holin	Salmonella_phage(26.09%)	66	1578073:1578128	1616155:1616210
WP_165122572.1|1573007_1574399_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	27.5	5.0e-40
WP_165122573.1|1574488_1574932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122574.1|1575168_1576110_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_165122575.1|1576761_1576974_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_075673948.1|1576977_1577850_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
1578073:1578128	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTACCATTTAAAATCAA	NA	NA	NA	NA
WP_063073711.1|1578138_1579296_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.1	1.4e-176
WP_165122576.1|1579529_1579724_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	90.6	9.3e-30
WP_165122577.1|1579820_1580354_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	61.1	1.7e-57
WP_165122578.1|1580629_1581682_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7RAB5	Vibrio_phage	47.5	1.4e-95
WP_165122579.1|1581754_1582108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122580.1|1582117_1582297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165126517.1|1582326_1582656_-	hypothetical protein	NA	Q6IWP7	Burkholderia_phage	50.8	9.0e-25
WP_165122581.1|1582728_1583181_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	80.0	2.2e-53
WP_165122582.1|1583180_1583735_-	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	64.4	5.9e-61
WP_165122583.1|1583734_1584559_-	exonuclease VIII	NA	A0A0M5M5Y6	Salmonella_phage	67.5	1.8e-106
WP_165122584.1|1584555_1584810_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	1.9e-38
WP_165122585.1|1584819_1584996_-	hypothetical protein	NA	A0A1P8DTG5	Proteus_phage	93.1	8.5e-22
WP_165122586.1|1585197_1585407_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_165121736.1|1585457_1585811_-	hypothetical protein	NA	A0A249XWT3	Proteus_phage	51.3	1.5e-17
WP_165122587.1|1585823_1586060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122588.1|1586113_1586302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001966870.1|1586333_1586573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122589.1|1586670_1586856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122590.1|1586866_1587139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233854.1|1587649_1588057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233857.1|1588083_1588761_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	55.9	1.2e-55
WP_049216808.1|1588839_1589067_+	transcriptional regulator	NA	G9L677	Escherichia_phage	68.0	2.9e-22
WP_069367909.1|1589200_1589581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164484703.1|1589672_1589849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122591.1|1589841_1591326_+	replication protein	NA	E5AGE9	Erwinia_phage	46.3	5.9e-47
WP_165122592.1|1591325_1592702_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.1	2.7e-155
WP_165122593.1|1592725_1593061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165126520.1|1593067_1593397_+	hypothetical protein	NA	A0A2I7S754	Vibrio_phage	55.9	6.9e-25
WP_165122594.1|1593410_1593620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122595.1|1593830_1594019_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_165122596.1|1594011_1594221_+	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	96.8	2.0e-30
WP_165122597.1|1594222_1594666_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	55.3	3.6e-37
WP_109395754.1|1594662_1594896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122598.1|1595007_1595298_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	77.9	8.2e-38
WP_165122599.1|1595294_1595660_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	3.0e-37
WP_165122600.1|1595646_1595841_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	84.1	2.0e-24
WP_165122601.1|1595837_1596341_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	87.4	3.4e-79
WP_036906009.1|1596884_1597181_+|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_165122602.1|1597177_1597570_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	96.8	3.3e-50
WP_165122603.1|1597566_1598019_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	79.9	1.6e-51
WP_071425414.1|1598460_1599147_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	77.2	4.4e-98
WP_165122604.1|1599240_1599399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165121737.1|1599391_1599574_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	72.4	1.4e-19
WP_060556615.1|1599590_1600016_+	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_159287681.1|1599999_1601316_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	84.9	7.6e-224
WP_165122605.1|1601315_1602671_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	61.1	2.2e-157
WP_063073747.1|1602621_1603551_+|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.0	3.0e-89
WP_165122606.1|1603554_1604829_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.2	4.1e-150
WP_121909253.1|1604828_1605278_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.1	3.7e-45
WP_004247762.1|1605290_1606385_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
WP_004247764.1|1606394_1606568_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_165122607.1|1606624_1607023_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.7e-55
WP_049257615.1|1607022_1607364_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	53.4	7.2e-25
WP_165122608.1|1607365_1607734_+	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	67.2	7.7e-41
WP_165122609.1|1607730_1608099_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	4.9e-11
WP_036908275.1|1608163_1608919_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	79.7	5.7e-107
WP_159287689.1|1608968_1609661_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.6	3.8e-89
WP_165122610.1|1609731_1609896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122611.1|1610021_1612271_+|tail	tail fiber domain-containing protein	tail	F1C5A8	Cronobacter_phage	56.9	2.3e-47
WP_165122612.1|1612522_1614520_+	acyltransferase	NA	C6ZR20	Salmonella_phage	34.3	9.0e-59
WP_165122613.1|1614726_1615731_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	9.5e-09
1616155:1616210	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTACCATTTAAAATCAA	NA	NA	NA	NA
>prophage 3
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	1621201	1656748	4293243	lysis,terminase,capsid,tail,integrase,portal,protease,head,holin	Klebsiella_phage(21.21%)	42	1649601:1649616	1659532:1659547
WP_165122623.1|1621201_1621654_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	38.0	4.9e-05
WP_049199086.1|1621802_1622210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199087.1|1622200_1622983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122624.1|1623303_1623972_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	54.5	1.7e-62
WP_165122625.1|1624077_1624296_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	75.0	5.2e-21
WP_072065067.1|1624288_1624537_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	4.0e-17
WP_165122626.1|1624797_1626363_+	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	69.3	3.9e-219
WP_165122627.1|1626359_1627334_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	53.5	7.1e-102
WP_165122628.1|1627333_1627717_+	antitermination protein	NA	A0A088CD47	Shigella_phage	71.4	7.2e-50
WP_036934641.1|1627957_1629124_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.6	8.6e-86
WP_159363451.1|1629245_1629488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115350921.1|1629499_1629748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161711122.1|1629987_1630305_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	60.0	6.2e-31
WP_161711123.1|1630297_1630717_+	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.4	5.7e-24
WP_075673907.1|1630916_1631495_+	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	66.7	1.5e-70
WP_161711143.1|1631565_1631940_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	41.1	4.8e-14
WP_165126523.1|1632141_1632396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165121738.1|1632932_1633364_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	75.6	8.4e-47
WP_161751966.1|1633450_1633798_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	92.2	5.9e-59
WP_161706117.1|1634031_1634526_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	75.6	2.0e-68
WP_161769682.1|1634522_1636253_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	82.0	8.9e-289
WP_006533924.1|1636249_1636411_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	66.0	1.5e-12
WP_161769683.1|1636400_1637630_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	88.0	9.6e-213
WP_006533922.1|1637619_1638225_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JP53	Morganella_phage	79.0	6.9e-87
WP_161769694.1|1638240_1639464_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.6	3.4e-186
WP_165126526.1|1639552_1639855_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	68.0	1.7e-33
WP_165122629.1|1639858_1640188_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	42.7	1.3e-15
WP_161769685.1|1640174_1640564_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.9e-30
WP_161711054.1|1640563_1640965_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	56.2	4.6e-31
WP_165122630.1|1640976_1641450_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	70.1	1.1e-58
WP_036904969.1|1641449_1641800_+|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	42.2	1.3e-16
WP_165122631.1|1642058_1645370_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	39.1	2.6e-164
WP_161769686.1|1645370_1645970_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	56.0	3.6e-56
WP_161769687.1|1645966_1646548_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.4e-49
WP_161769688.1|1646571_1647180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161769689.1|1647236_1647635_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	48.5	1.3e-33
WP_165122632.1|1647635_1650518_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.8	1.0e-188
1649601:1649616	attL	TTTGATGATTTAGATA	NA	NA	NA	NA
WP_161769848.1|1650511_1650880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098943252.1|1650881_1651496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122633.1|1651546_1653043_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	64.9	7.2e-154
WP_156733893.1|1653583_1655140_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_161769845.1|1655521_1656748_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	8.6e-36
1659532:1659547	attR	TTTGATGATTTAGATA	NA	NA	NA	NA
>prophage 4
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	1666877	1713886	4293243	transposase,plate	Cronobacter_phage(33.33%)	37	NA	NA
WP_165121832.1|1666877_1667333_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_165122647.1|1667453_1669190_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_165122648.1|1669250_1670582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122649.1|1670621_1674170_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_165122650.1|1674175_1675630_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_165122651.1|1675635_1676286_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_165122652.1|1676282_1677080_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_165122653.1|1677076_1679713_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	3.7e-84
WP_165122654.1|1679722_1680478_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_165122655.1|1680470_1681829_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_165122656.1|1681831_1682386_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_165122657.1|1682387_1683629_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_165122658.1|1683634_1684684_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_165122659.1|1684647_1686432_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_165122660.1|1686433_1686871_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_165122661.1|1686876_1688355_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_165122662.1|1688375_1688873_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_165122663.1|1689618_1690104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122664.1|1690211_1690700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122665.1|1690713_1690956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165126529.1|1691398_1692067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122666.1|1692989_1693454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165126532.1|1693450_1698151_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.2	3.2e-22
WP_165122667.1|1698358_1698715_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_165122668.1|1698707_1699919_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_165122669.1|1699929_1702050_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_036939804.1|1702151_1702670_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_088494837.1|1703644_1705060_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_165122670.1|1705333_1705861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122671.1|1706379_1706673_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_165126535.1|1706821_1707553_-	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	34.6	8.5e-07
WP_165122672.1|1707972_1708614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122673.1|1708624_1710010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088494841.1|1710095_1710524_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_165122674.1|1710526_1711084_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_165122675.1|1711064_1712159_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_165122676.1|1712122_1713886_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	2190215	2196611	4293243	holin,lysis	Enterobacteria_phage(37.5%)	9	NA	NA
WP_165122948.1|2190215_2190953_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	46.3	1.4e-57
WP_165122949.1|2191190_2192006_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	42.3	5.5e-55
WP_088495157.1|2192368_2192677_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	54.5	5.3e-27
WP_165122950.1|2192669_2193074_+	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	48.1	3.4e-26
WP_165122951.1|2193070_2193520_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.4	2.5e-09
WP_165122952.1|2193617_2194130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165122953.1|2194138_2195626_+	DUF3383 domain-containing protein	NA	Q6IWV2	Burkholderia_phage	31.0	2.5e-58
WP_075674211.1|2195636_2196089_+	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_075674210.1|2196152_2196611_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	7.4e-25
>prophage 6
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	2715138	2728625	4293243		Escherichia_phage(57.14%)	10	NA	NA
WP_165123602.1|2715138_2717196_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.4	2.2e-31
WP_165123604.1|2717207_2718911_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_165123606.1|2719224_2719911_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_165123608.1|2719910_2720372_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	6.5e-13
WP_161711314.1|2720458_2721070_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	2.0e-30
WP_165123610.1|2721244_2722102_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.7	7.6e-23
WP_023582154.1|2722103_2722721_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	1.7e-72
WP_165123612.1|2722732_2725171_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	9.8e-217
WP_165126610.1|2725847_2727218_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_165123614.1|2727218_2728625_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	23.4	9.2e-18
>prophage 7
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	3070299	3083863	4293243	tRNA	Tupanvirus(55.56%)	13	NA	NA
WP_165124282.1|3070299_3072282_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
WP_100158097.1|3072281_3073262_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.4	2.5e-38
WP_165124284.1|3073262_3074408_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.5	5.9e-39
WP_165124287.1|3074542_3075292_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L407	Tupanvirus	26.6	1.2e-08
WP_165124290.1|3075293_3076304_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_023582381.1|3076683_3076980_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_165124293.1|3076984_3079372_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	2.1e-09
WP_023582383.1|3079386_3080370_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_120655563.1|3080545_3080593_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006537111.1|3080700_3081057_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004263702.1|3081099_3081297_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_036937410.1|3081391_3081931_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_075673357.1|3081934_3083863_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
>prophage 8
NZ_CP047639	Proteus sp. ZN5 chromosome, complete genome	4293243	3607647	3618449	4293243		Mycobacterium_phage(25.0%)	12	NA	NA
WP_165125287.1|3607647_3608859_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.8	4.0e-102
WP_036912266.1|3609059_3609323_+	YbeD family protein	NA	NA	NA	NA	NA
WP_088493458.1|3609483_3610128_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_075671558.1|3610229_3611195_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_072070253.1|3611208_3611583_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.0	1.9e-23
WP_023581133.1|3611681_3611891_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_165125291.1|3612088_3612562_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_165125294.1|3612845_3613070_+	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_165125297.1|3613081_3613510_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	35.9	3.7e-10
WP_165125300.1|3613506_3615633_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	7.0e-203
WP_165125303.1|3615657_3616626_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	5.7e-136
WP_165125306.1|3617249_3618449_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
>prophage 1
NZ_CP047640	Proteus sp. ZN5 plasmid pZN5-103kb, complete sequence	103912	4432	59271	103912	integrase,transposase	Escherichia_phage(38.46%)	54	11979:11993	40585:40599
WP_001339197.1|4432_5641_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000679427.1|6303_6651_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_070342367.1|6798_7620_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_002075262.1|7743_8376_-	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
WP_164561312.1|8634_9246_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	72.7	3.2e-39
WP_000376623.1|9752_10253_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|10380_11220_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000347577.1|11400_11598_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032491313.1|11755_12235_-	trimethoprim-resistant dihydrofolate reductase DfrA3b	NA	A0A0N9RSY5	Escherichia_phage	30.7	1.8e-10
11979:11993	attL	AAAGCCTTGAAGTGT	NA	NA	NA	NA
WP_000050481.1|12590_14132_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|14536_15376_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|15369_15717_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012695458.1|15885_16440_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_109912820.1|16478_17270_-	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000845054.1|17415_18429_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|18734_19292_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|19294_22267_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_109910876.1|22273_22528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910875.1|22544_22970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125894510.1|22966_23263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910873.1|23259_24093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071547973.1|24354_24582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072070757.1|24584_25421_-	replication initiation protein	NA	NA	NA	NA	NA
WP_023159976.1|26756_27248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072070758.1|27258_27639_-	hypothetical protein	NA	A0A222YWJ6	Escherichia_phage	40.5	7.0e-13
WP_071547977.1|27643_28603_-	recombinase	NA	A0A222YXF2	Escherichia_phage	70.2	1.7e-124
WP_165126819.1|28899_29055_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_165126822.1|29729_30929_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002333497.1|31131_31509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002333496.1|31827_32631_+	lincosamide nucleotidyltransferase Lnu(G)	NA	NA	NA	NA	NA
WP_029396327.1|33118_34153_-	permease	NA	NA	NA	NA	NA
WP_000349485.1|34264_34579_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_165126825.1|34682_35363_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_023159979.1|35686_36106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023159980.1|36441_36900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125894524.1|37386_37935_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_159227764.1|37924_38479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125894528.1|38475_39036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125894530.1|39035_39347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125894532.1|41582_41771_-	hypothetical protein	NA	NA	NA	NA	NA
40585:40599	attR	ACACTTCAAGGCTTT	NA	NA	NA	NA
WP_125894534.1|42432_43605_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125894536.1|43607_44117_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_164526958.1|44216_45944_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_159227766.1|45888_47253_-	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_125894541.1|47263_48625_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_125894543.1|50141_51026_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014204953.1|51099_51606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125894545.1|52796_53867_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_125894547.1|54058_54391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526960.1|54521_54683_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_125894549.1|54790_55111_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_125894551.1|55652_56816_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_125894553.1|57144_58155_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.3e-183
WP_164526961.1|58347_59271_-|transposase	IS5-like element ISSpu20 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	84.9	8.7e-150
>prophage 2
NZ_CP047640	Proteus sp. ZN5 plasmid pZN5-103kb, complete sequence	103912	94351	102680	103912		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_109910889.1|94351_94975_+	AAA family ATPase	NA	D4HTX7	Vibrio_phage	35.4	1.6e-22
WP_096864993.1|95075_95303_+	DNA partition complex ParG	NA	NA	NA	NA	NA
WP_109910890.1|95400_95769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910891.1|96117_96510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048821775.1|96519_96942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159242431.1|96934_97261_-	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	35.9	5.4e-06
WP_072070749.1|97281_98328_-	ParB/RepB/Spo0J family partition protein	NA	D5LGX9	Escherichia_phage	31.8	1.0e-29
WP_109910892.1|98679_99690_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	63.9	9.9e-123
WP_024008861.1|100330_101182_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.1	1.5e-50
WP_024008860.1|101192_102680_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	77.3	5.2e-213
