The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	0	50249	4659400	portal,tail,holin,lysis,tRNA,terminase,plate,head,capsid	Escherichia_phage(52.78%)	52	NA	NA
WP_164538391.1|0_2277_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
WP_021530418.1|2764_4309_-	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	99.0	1.4e-288
WP_072731811.1|4704_5739_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	1.9e-201
WP_118014781.1|5738_7511_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001074418.1|7684_8539_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.3e-136
WP_016237184.1|8597_9671_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_021548483.1|9674_10418_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	4.6e-125
WP_000988633.1|10517_11027_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|11026_11230_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|11233_11515_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|11514_12012_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_162107463.1|12026_12452_+	protein lysA	NA	U5N096	Enterobacteria_phage	94.3	1.2e-56
WP_118014779.1|12439_12865_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	1.2e-66
WP_072146842.1|12836_13010_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_001406878.1|12972_13440_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_001001780.1|13432_13885_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_118014777.1|13951_14587_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	9.3e-111
WP_118014775.1|14583_14931_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
WP_118014773.1|14935_15844_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	2.2e-161
WP_089560875.1|15836_16448_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_164538392.1|16444_17746_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.1	1.9e-174
WP_164538393.1|17745_18339_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.4	2.5e-57
WP_001752131.1|18310_18745_-|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	43.4	6.5e-23
WP_164538737.1|18747_19596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905108.1|19623_20217_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_118014769.1|20276_21467_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|21479_21998_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|22054_22330_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|22362_22482_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_164538395.1|22474_24922_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.3	0.0e+00
WP_000978896.1|24936_25416_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_164538396.1|25415_26579_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	2.0e-204
WP_000468308.1|26660_26879_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|27198_29481_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|29535_30393_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|30798_32559_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|32688_33381_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057138.1|33579_34668_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|34738_36022_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|36190_36955_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|37127_37811_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|37921_39595_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|39754_40039_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|40246_42511_+	ComEC family protein	NA	NA	NA	NA	NA
WP_164538397.1|42547_44296_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	8.7e-58
WP_000570539.1|44292_45279_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056538.1|45315_46548_+	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000350058.1|46599_46782_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011603.1|46778_47525_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|47678_48572_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|48548_49328_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|49463_50249_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	59001	69971	4659400	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|59001_59550_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|59576_60224_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|60445_61636_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|61820_62909_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|63511_64912_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|65080_66283_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|66548_69161_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|69203_69971_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 3
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	85889	87797	4659400		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|85889_87797_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 4
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	100396	102451	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_164538577.1|100396_102451_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 5
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	106684	107344	4659400	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|106684_107344_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 6
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	126609	138924	4659400		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|126609_126822_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|126832_127021_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|126995_127226_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|127215_127389_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|127437_128511_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|128582_131327_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|131409_132438_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|132410_133103_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|133232_134405_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|134404_136951_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209868.1|136947_137547_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|137698_138004_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|138003_138924_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 7
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	144006	146281	4659400		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|144006_144180_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001338446.1|144437_145766_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|145786_146281_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 8
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	160919	161984	4659400		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|160919_161984_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 9
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	168803	171069	4659400	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409873.1|168803_170162_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_164538400.1|170202_171069_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.3e-50
>prophage 10
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	177321	178155	4659400		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|177321_178155_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 11
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	183066	183600	4659400		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|183066_183600_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 12
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	192907	193828	4659400		Morganella_phage(100.0%)	1	NA	NA
WP_100032090.1|192907_193828_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 13
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	198488	198734	4659400		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|198488_198734_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 14
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	214617	215559	4659400		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|214617_215559_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 15
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	227916	229098	4659400		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|227916_228651_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|228861_229098_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 16
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	232370	234013	4659400		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|232370_233012_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|233008_234013_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 17
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	246319	246577	4659400		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|246319_246577_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 18
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	253865	257606	4659400		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|253865_254567_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|254566_255811_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|255839_256751_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|256766_257606_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 19
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	260863	262841	4659400		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|260863_261721_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|261704_262841_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 20
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	267862	269233	4659400		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|267862_269233_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 21
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	272369	276101	4659400		Enterobacteria_phage(66.67%)	5	NA	NA
WP_164538404.1|272369_273620_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|273722_274046_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|274581_274692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|274744_275149_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|275369_276101_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 22
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	281921	284315	4659400	transposase	Salmonella_phage(100.0%)	2	NA	NA
WP_000608644.1|281921_283184_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|283439_284315_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
>prophage 23
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	295732	297420	4659400		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|295732_296152_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|296151_297420_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 24
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	325642	328394	4659400		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|325642_327322_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|327446_328394_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 25
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	331530	335538	4659400		Pseudomonas_phage(50.0%)	5	NA	NA
WP_164538407.1|331530_332613_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|332612_333446_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|333442_333835_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|333838_334648_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_164538408.1|334683_335538_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	3.7e-46
>prophage 26
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	338637	338868	4659400		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|338637_338868_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 27
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	350122	363164	4659400	transposase	Escherichia_phage(20.0%)	11	NA	NA
WP_000702660.1|350122_351661_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|351657_352368_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|352367_353045_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|354300_355143_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|355192_355651_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|355763_356669_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_164538410.1|356760_357774_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|357975_358884_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|359027_359441_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|360045_360663_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_088895425.1|361935_363164_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 28
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	372185	374200	4659400		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|372185_373199_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|373195_374200_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 29
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	385858	388816	4659400		Acinetobacter_phage(100.0%)	2	NA	NA
WP_021570766.1|385858_387217_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|387220_388816_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 30
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	395785	401077	4659400	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_164538411.1|395785_396544_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	5.7e-06
WP_000422045.1|396763_397813_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|397848_398100_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|398479_401077_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 31
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	406001	406592	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|406001_406592_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 32
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	414409	420066	4659400		Lactococcus_phage(50.0%)	5	NA	NA
WP_021570768.1|414409_416344_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|416411_417539_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|417682_418471_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072134956.1|418838_419192_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|419259_420066_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 33
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	432981	434247	4659400		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|432981_434247_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 34
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	448252	449335	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057985.1|448252_449335_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 35
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	465953	466469	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|465953_466469_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 36
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	472795	480843	4659400	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628058.1|472795_474028_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|474282_475266_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|475743_477117_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|477245_478181_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|479134_479569_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|479709_480843_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 37
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	485803	486793	4659400		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|485803_486793_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 38
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	509750	510979	4659400	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|509750_510979_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 39
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	519085	522988	4659400		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|519085_522988_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 40
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	526926	527875	4659400		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|526926_527457_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|527701_527875_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 41
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	539681	549855	4659400	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_064735206.1|539681_540890_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	89.1	6.2e-196
WP_001326689.1|540929_542144_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|542196_542733_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001303492.1|542805_544767_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|544858_545089_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|545310_545487_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|545532_545949_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_164538416.1|546027_547434_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|547678_548824_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|548841_549855_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 42
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	556987	559090	4659400		Salmonella_phage(100.0%)	1	NA	NA
WP_164538417.1|556987_559090_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 43
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	563996	568712	4659400		Ralstonia_phage(100.0%)	1	NA	NA
WP_164538419.1|563996_568712_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	3.2e-22
>prophage 44
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	576082	577627	4659400		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|576082_577627_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 45
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	584511	584802	4659400		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|584511_584802_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 46
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	591171	592612	4659400		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|591171_591456_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_001568846.1|591601_592612_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	4.7e-24
>prophage 47
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	595885	597791	4659400		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|595885_596812_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_021570789.1|596804_597791_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 48
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	602107	605914	4659400		Klosneuvirus(50.0%)	2	NA	NA
WP_001360132.1|602107_604507_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|604531_605914_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 49
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	617207	618893	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_164538421.1|617207_618893_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	7.7e-11
>prophage 50
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	638852	643623	4659400	transposase,integrase	Shigella_phage(50.0%)	4	NA	NA
WP_088895425.1|638852_640081_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_041124212.1|640156_641764_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000169496.1|642460_642760_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000878219.1|642756_643623_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 51
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	656162	657698	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_021570792.1|656162_657698_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.2e-20
>prophage 52
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	665579	666998	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_000558029.1|665579_666998_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
>prophage 53
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	674744	675128	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|674744_675128_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 54
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	678130	679021	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|678130_679021_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 55
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	684385	699822	4659400		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|684385_684589_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|684623_686084_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000151243.1|686172_687540_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000836066.1|687597_688617_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|688628_689843_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|690048_690375_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|690509_690851_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|690885_691446_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|691448_692159_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|692266_692572_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041681.1|692770_695197_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001340362.1|695257_697681_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|697691_698309_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|698310_699165_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|699207_699822_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 56
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	728962	730774	4659400		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|728962_730774_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 57
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	750650	751925	4659400	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|750650_751925_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 58
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	758836	760335	4659400		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|758836_759358_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|759438_760335_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 59
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	769138	778019	4659400		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|769138_769954_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|770081_770663_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_164538425.1|770897_772067_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|772232_772322_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_021570807.1|772620_773646_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	6.3e-32
WP_000269501.1|773642_774575_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|774687_775899_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|776189_777338_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|777377_778019_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 60
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	783529	785796	4659400		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|783529_784342_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|784345_785131_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|785127_785796_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 61
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	794085	799169	4659400		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|794085_795306_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|795302_796574_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|796548_797295_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000089364.1|797304_798792_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|798800_799169_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 62
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	817905	837445	4659400	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000869246.1|817905_819552_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
WP_000069375.1|819608_821987_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|822319_823153_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|823309_824356_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|824487_824679_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175606.1|824682_826119_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001301292.1|826181_826895_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|827141_827606_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_032176331.1|827683_828433_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-08
WP_001154168.1|828432_828984_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|829046_830027_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|830127_830427_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|830431_832819_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|832833_833817_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|834100_834145_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|834267_834624_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|834676_834874_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|834970_835513_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|835516_837445_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 63
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	848741	851003	4659400		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|848741_851003_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 64
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	857332	858160	4659400		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|857332_858160_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 65
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	865635	866856	4659400		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|865635_866856_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 66
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	873620	874274	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|873620_874274_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 67
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	879872	881834	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|879872_881834_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 68
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	886760	890846	4659400		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|886760_887402_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_164538431.1|887494_888853_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|888970_889729_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723723.1|889865_890846_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 69
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	899656	900511	4659400		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|899656_900511_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 70
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	903829	908406	4659400		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|903829_905113_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|905259_906735_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_164538433.1|906915_908406_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 71
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	922935	931041	4659400	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|922935_924621_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|924825_925407_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|925446_926142_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_164538435.1|926199_928110_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	2.6e-92
WP_001295493.1|928241_928586_+	RidA family protein	NA	NA	NA	NA	NA
WP_071840897.1|928947_929307_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|929426_929606_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|929679_931041_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 72
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	934903	936460	4659400		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|934903_936460_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 73
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	942100	942310	4659400		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|942100_942310_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 74
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	947640	949689	4659400		Moraxella_phage(100.0%)	1	NA	NA
WP_001055779.1|947640_949689_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 75
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	957185	961655	4659400		Escherichia_phage(33.33%)	7	NA	NA
WP_164538437.1|957185_957842_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	5.2e-56
WP_000976472.1|958237_958579_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|958591_959464_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|959467_959842_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|959980_960211_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|960312_960969_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|960992_961655_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 76
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	969711	971187	4659400		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|969711_971187_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 77
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	975185	1045390	4659400	transposase,tRNA	Salmonella_phage(26.09%)	62	NA	NA
WP_001184045.1|975185_976508_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|976523_977456_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|977534_978290_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|978286_979072_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|979218_980229_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|980237_980849_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072134965.1|980987_981053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|981123_981726_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|981727_982249_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|982283_983024_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|983052_983505_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258678.1|983622_985395_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_164538439.1|985704_986271_+	hydrolase	NA	NA	NA	NA	NA
WP_000639274.1|986267_987086_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|987138_987534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019590.1|987574_988318_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_064670318.1|988314_989286_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176782.1|989450_991880_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214290.1|991904_993005_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|993392_994139_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001326725.1|994152_994719_-	VOC family protein	NA	NA	NA	NA	NA
WP_164538440.1|994934_996668_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	1.7e-85
WP_064670317.1|996844_997333_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|997452_997845_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_164538441.1|997844_999923_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|999915_1001064_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1001265_1001910_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1001920_1002310_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|1002324_1003374_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_000204337.1|1003376_1004237_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|1004255_1005857_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_001297437.1|1005902_1007564_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1007708_1008212_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1008232_1010197_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_164538442.1|1010201_1011128_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906340.1|1011124_1012012_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001556670.1|1012138_1012717_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1012719_1013070_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1013849_1014278_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1014284_1015709_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1015683_1016484_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100205.1|1016650_1017637_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|1017651_1019166_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|1019235_1020225_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000608644.1|1020506_1021769_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000134999.1|1022008_1022650_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_072037363.1|1023085_1023331_+	transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	81.5	2.7e-34
WP_001067855.1|1025314_1026019_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_034167704.1|1026258_1026765_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_034167705.1|1026761_1028096_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_034167706.1|1028092_1030114_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_034167707.1|1030123_1032586_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_001067855.1|1032928_1033633_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032319017.1|1033780_1036054_+	thiosulfate reductase PhsA	NA	NA	NA	NA	NA
WP_016153548.1|1036068_1036647_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
WP_032319018.1|1036643_1037411_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001323889.1|1037990_1039568_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001323888.1|1039721_1039889_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|1039877_1040438_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|1040441_1043408_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001067855.1|1043462_1044167_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_031942297.1|1044421_1045390_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
>prophage 78
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1058223	1058976	4659400		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1058223_1058976_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 79
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1071197	1071866	4659400		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334608.1|1071197_1071866_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	7.3e-82
>prophage 80
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1083206	1096977	4659400	transposase	Bacillus_phage(25.0%)	14	NA	NA
WP_001564714.1|1083206_1084901_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|1085138_1085321_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1085399_1086317_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001507517.1|1086489_1087410_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1087398_1087869_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_164538447.1|1087849_1089268_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	1.8e-101
WP_000365561.1|1089334_1090030_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|1090069_1090435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072134966.1|1091001_1091811_+	porin	NA	Q1MVN1	Enterobacteria_phage	50.3	8.1e-67
WP_088895425.1|1091899_1093127_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_089660501.1|1093168_1093396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218214.1|1093988_1094840_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826787.1|1094947_1096306_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_001339045.1|1096305_1096977_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 81
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1100521	1104203	4659400	integrase	Escherichia_phage(33.33%)	4	1102699:1102758	1117035:1117114
WP_001079074.1|1100521_1101052_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001442913.1|1101804_1102602_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1102699:1102758	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_000055688.1|1102940_1103471_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	6.8e-30
WP_001292569.1|1103564_1104203_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
1117035:1117114	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 82
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1123769	1124786	4659400	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001407551.1|1123769_1124786_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 83
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1132673	1133840	4659400		Stx2-converting_phage(100.0%)	1	NA	NA
WP_016247321.1|1132673_1133840_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	6.5e-227
>prophage 84
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1141041	1141941	4659400		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1141041_1141941_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 85
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1149285	1165966	4659400		Paramecium_bursaria_Chlorella_virus(10.0%)	14	NA	NA
WP_000704860.1|1149285_1150452_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043472.1|1150700_1152107_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
WP_063117690.1|1152283_1153111_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.1	8.4e-11
WP_000472516.1|1153894_1154563_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_064670360.1|1154562_1155441_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.0	6.0e-15
WP_001048966.1|1156740_1157997_-	O5 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000564888.1|1157999_1159103_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
WP_000971201.1|1159099_1159567_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001025599.1|1159563_1159959_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000676086.1|1159962_1160826_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	2.0e-111
WP_000699411.1|1160825_1161911_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000183034.1|1162282_1163176_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_000999466.1|1163418_1164414_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_064670358.1|1164571_1165966_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 86
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1171679	1178561	4659400		Bacillus_phage(25.0%)	6	NA	NA
WP_001360303.1|1171679_1173050_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.2	1.3e-32
WP_000079280.1|1173330_1174767_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699721.1|1174769_1175993_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001298845.1|1175989_1176469_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043654.1|1176471_1177437_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_000048190.1|1177439_1178561_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 87
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1182804	1193215	4659400		uncultured_marine_virus(20.0%)	8	NA	NA
WP_064670355.1|1182804_1183644_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137111.1|1183736_1185899_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1185901_1186345_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_064670354.1|1186357_1187491_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001296218.1|1188149_1189733_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252340.1|1190025_1191879_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1191900_1192482_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1192573_1193215_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 88
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1197940	1199293	4659400		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_004016760.1|1197940_1199293_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	3.2e-07
>prophage 89
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1212741	1219614	4659400	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|1212741_1214145_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|1214141_1214864_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|1215054_1215387_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|1215595_1215892_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|1215893_1216190_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476014.1|1216292_1217654_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000716757.1|1217983_1218301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|1218714_1219614_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 90
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1228832	1232389	4659400		Serratia_phage(50.0%)	4	NA	NA
WP_064670345.1|1228832_1229837_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	1.3e-13
WP_064670344.1|1229833_1230799_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1230772_1231519_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064670343.1|1231570_1232389_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	3.3e-23
>prophage 91
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1241657	1243691	4659400	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001300883.1|1241657_1243691_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 92
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1256811	1266252	4659400		Enterobacteria_phage(85.71%)	10	NA	NA
WP_064670439.1|1256811_1257948_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
WP_001402348.1|1257944_1259945_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001295429.1|1260069_1260531_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1260570_1261041_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1261087_1261807_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1261803_1263489_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1263710_1264442_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1264501_1264609_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1264589_1265321_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|1265325_1266252_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 93
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1286483	1288004	4659400		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_164538456.1|1286483_1288004_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 94
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1291698	1295484	4659400		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1291698_1292367_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|1292624_1293461_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|1293492_1295484_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 95
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1299554	1300412	4659400		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|1299554_1300412_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 96
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1314959	1319260	4659400		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001491191.1|1314959_1316426_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	8.7e-43
WP_000198822.1|1316543_1317530_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001300998.1|1317568_1318282_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1318693_1319260_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 97
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1325014	1332662	4659400		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|1325014_1326604_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1326607_1326952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|1327284_1328475_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|1328502_1329198_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|1329346_1331107_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|1331231_1331516_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|1331654_1332662_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 98
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1344536	1345154	4659400		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1344536_1345154_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 99
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1354489	1360294	4659400		Bacillus_phage(33.33%)	5	NA	NA
WP_000422188.1|1354489_1356133_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_164538458.1|1356208_1356859_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000710372.1|1356858_1357923_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_000406085.1|1357996_1359052_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865600.1|1359163_1360294_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.1e-117
>prophage 100
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1364571	1367421	4659400		Hokovirus(100.0%)	1	NA	NA
WP_000876011.1|1364571_1367421_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 101
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1384341	1386969	4659400		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|1384341_1386969_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 102
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1392413	1398560	4659400		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|1392413_1394699_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|1394932_1396063_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|1396062_1396317_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|1396370_1397021_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|1397483_1398560_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 103
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1404452	1408963	4659400	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|1404452_1405352_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|1405364_1405550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|1405590_1406394_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_016242281.1|1406411_1407701_-	MFS transporter	NA	NA	NA	NA	NA
WP_164538461.1|1407757_1408963_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 104
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1412566	1417569	4659400		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|1412566_1413169_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|1413475_1414615_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|1414618_1415587_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|1415586_1417569_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 105
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1452758	1455986	4659400		Salmonella_phage(50.0%)	3	NA	NA
WP_021570895.1|1452758_1453358_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1453416_1455249_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|1455335_1455986_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 106
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1466545	1468406	4659400		Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|1466545_1467436_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|1467632_1468406_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 107
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1472617	1474135	4659400		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1472617_1474135_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 108
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1480611	1481748	4659400		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|1480611_1481748_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 109
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1490284	1491370	4659400		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|1490284_1491370_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 110
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1510022	1559788	4659400	protease,integrase,transposase	Enterobacteria_phage(44.44%)	46	1499412:1499471	1514127:1514895
1499412:1499471	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000368140.1|1510022_1510955_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_164538583.1|1511266_1512424_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	6.9e-221
WP_096997721.1|1512705_1514049_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_000638547.1|1514999_1515131_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
1514127:1514895	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTCGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTACGTCGGTGCTAAATCACGTCAGCGCTGGCTGTTTTACGCGTATGACAGGATACGGAGGACAGTTGTGGCGCACGTTTTCGGTGAACGCACTCTGGCCACACTGGAGCGTCTTCTGAGCCTGCTGTCGGCCTTTGAGGTCGTGGTATGGATGACGGATGGCTGGCCGCTGTATGAATCACGCCTGAAGGGAAAGCTGCACGTTATCAGCAAGCGTTACACTCAGCGCATTGAGCGACATAATCTGAATCTGAGACAACATCTGGCAAGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCG	NA	NA	NA	NA
WP_001243355.1|1515115_1515268_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031367.1|1515524_1516130_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_164538466.1|1516129_1516279_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	98.0	6.1e-21
WP_000878219.1|1516306_1517173_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169496.1|1517169_1517469_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005119049.1|1517597_1517774_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	98.3	4.8e-25
WP_164538467.1|1517797_1518094_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	96.9	9.5e-50
WP_001214453.1|1518104_1518272_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_164538468.1|1518268_1518568_+	hypothetical protein	NA	Q716F3	Shigella_phage	98.0	7.3e-58
WP_001277767.1|1519300_1519480_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_001163428.1|1519611_1519812_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000556048.1|1520855_1522193_+	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000426426.1|1522210_1523539_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001018731.1|1523646_1525185_-	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_000435167.1|1525184_1526348_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_000991370.1|1526763_1527378_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001355656.1|1527382_1530976_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_164538469.1|1531031_1532177_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_164538470.1|1532250_1533195_-	transporter YfdV	NA	NA	NA	NA	NA
WP_164538471.1|1533264_1534959_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000106759.1|1535012_1536263_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_088895425.1|1536832_1538060_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000825600.1|1538111_1538747_-	YfdX family protein	NA	NA	NA	NA	NA
WP_000867631.1|1539042_1539318_+	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000609275.1|1539394_1539637_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484404.1|1539989_1540910_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_010723117.1|1541265_1541337_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000785931.1|1541401_1542640_-	alanine transaminase	NA	NA	NA	NA	NA
WP_000544359.1|1543015_1544713_+	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_001295458.1|1544727_1545462_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000646835.1|1545474_1546332_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000955906.1|1546334_1548830_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000366028.1|1548854_1549892_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000173291.1|1549891_1550977_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000985359.1|1550991_1552239_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000038456.1|1552260_1552587_-	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000170346.1|1552805_1553771_-	glucokinase	NA	NA	NA	NA	NA
WP_000903148.1|1553974_1555231_+	ion channel protein	NA	NA	NA	NA	NA
WP_000490072.1|1555345_1555672_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000186369.1|1555812_1557051_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000376337.1|1557386_1558589_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_001300563.1|1558675_1559788_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 111
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1572505	1585159	4659400		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|1572505_1574521_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|1574591_1575578_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1575807_1576569_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1576753_1577725_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1578108_1578366_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|1578410_1580138_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|1580178_1580688_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|1580730_1581582_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|1581686_1582061_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|1582093_1582828_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|1583016_1583928_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|1584061_1585159_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 112
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1588176	1588968	4659400		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|1588176_1588968_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 113
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1592446	1597566	4659400		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|1592446_1593751_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1593990_1594890_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|1594985_1595561_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|1595621_1596071_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|1596057_1596483_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|1596696_1597566_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 114
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1617669	1618620	4659400		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1617669_1618620_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 115
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1635908	1636622	4659400		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1635908_1636622_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 116
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1657873	1661875	4659400		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1657873_1659163_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1659248_1659875_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|1660199_1661237_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|1661236_1661875_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 117
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1668898	1675381	4659400		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|1668898_1669051_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|1669068_1669260_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|1669570_1670089_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|1670104_1670644_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|1670736_1672314_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1672382_1673849_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|1674010_1675381_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 118
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1684211	1684643	4659400		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1684211_1684643_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 119
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1694853	1701310	4659400		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|1694853_1696137_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1696314_1696515_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1696526_1696862_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1696863_1698714_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1698730_1699246_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1699341_1699665_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1699681_1700068_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1700095_1701310_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 120
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1716446	1717958	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001556163.1|1716446_1717958_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.5e-13
>prophage 121
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1723850	1735140	4659400		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1723850_1725104_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|1725431_1726622_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717691.1|1726666_1727005_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|1727065_1728400_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_164538481.1|1728389_1729103_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_024187693.1|1729267_1730695_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_021570910.1|1731252_1735140_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 122
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1739259	1739520	4659400		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1739259_1739520_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 123
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1742979	1746721	4659400		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1742979_1743660_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|1743931_1744906_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1744921_1746721_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 124
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1752492	1758751	4659400	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1752492_1753827_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_053286107.1|1754035_1754917_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063080541.1|1755019_1755607_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1755662_1756046_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1756350_1757040_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1757087_1758125_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1758331_1758751_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 125
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1764044	1765343	4659400		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1764044_1765343_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 126
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1771197	1773771	4659400		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1771197_1773771_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 127
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1779677	1780748	4659400		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|1779677_1780748_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 128
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1794493	1801382	4659400	transposase	Staphylococcus_phage(25.0%)	7	NA	NA
WP_000162574.1|1794493_1794976_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000878219.1|1796141_1797008_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169496.1|1797004_1797304_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001572958.1|1798357_1798633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151178.1|1798881_1799181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000795662.1|1799201_1799408_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	6.5e-05
WP_088895425.1|1800154_1801382_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 129
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1807243	1807462	4659400		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|1807243_1807462_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 130
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1813836	1817888	4659400		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|1813836_1815117_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001295173.1|1815354_1816755_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1816775_1817438_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1817438_1817888_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 131
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1821824	1827119	4659400		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1821824_1822070_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|1822066_1822477_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|1822449_1824594_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|1824603_1825563_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|1825916_1827119_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 132
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1840203	1845589	4659400	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1840203_1840389_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|1840623_1843254_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|1843381_1843882_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1843950_1845012_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1845091_1845589_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 133
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1851055	1852021	4659400		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|1851055_1852021_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 134
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1859496	1860507	4659400		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001394680.1|1859496_1860507_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 135
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1878335	1891518	4659400		Escherichia_phage(54.55%)	13	NA	NA
WP_085438572.1|1878335_1880897_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	7.8e-31
WP_001141322.1|1881002_1881659_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|1881709_1882477_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|1882672_1883581_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_164538485.1|1883577_1884354_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	63.3	7.0e-84
WP_094190907.1|1884360_1884840_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	58.2	2.6e-41
WP_001278994.1|1884836_1885475_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1885479_1886256_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|1886344_1887709_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1887802_1888795_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1888857_1889997_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1890136_1890763_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1890756_1891518_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 136
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1894630	1896663	4659400		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1894630_1895236_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|1895235_1896663_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 137
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1915695	1916481	4659400		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1915695_1916481_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 138
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1920954	1925874	4659400		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|1920954_1921626_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|1921764_1921905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|1921918_1922791_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1922850_1924149_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1924236_1925874_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 139
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1929906	1934021	4659400		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001556187.1|1929906_1931208_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	3.3e-38
WP_000186450.1|1931264_1934021_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 140
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1941556	1942405	4659400		Vibrio_phage(100.0%)	1	NA	NA
WP_000100417.1|1941556_1942405_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 141
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1947173	1948019	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_001214598.1|1947173_1948019_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 142
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1959544	1974982	4659400	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|1959544_1960750_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|1960749_1961193_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1961243_1962050_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|1962288_1963386_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_047643759.1|1963854_1965108_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1965339_1966671_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|1966732_1968559_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_164538488.1|1968558_1972101_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_061351893.1|1972093_1974982_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 143
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1980458	1987231	4659400		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1980458_1981253_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1981259_1982135_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|1982285_1984532_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1984544_1985075_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|1985759_1986449_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1986517_1987231_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 144
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	1996861	2000133	4659400		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1996861_1998280_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|1999371_2000133_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 145
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2012385	2013141	4659400		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|2012385_2013141_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 146
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2037420	2052812	4659400	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|2037420_2038821_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001299798.1|2038838_2040155_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2040190_2041558_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838422.1|2041593_2042082_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001300605.1|2042081_2044001_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2044436_2045885_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|2045886_2046012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2046008_2046080_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192790.1|2046134_2046683_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001618837.1|2046725_2048243_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001701073.1|2048252_2049351_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813201.1|2049441_2051175_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	2.4e-60
WP_000715214.1|2051180_2051891_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2051915_2052812_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 147
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2056736	2061209	4659400		Pandoravirus(50.0%)	2	NA	NA
WP_001514525.1|2056736_2058170_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.4	3.0e-32
WP_004017789.1|2058335_2061209_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 148
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2069344	2070577	4659400		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2069344_2070577_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 149
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2094856	2156107	4659400	protease,integrase,tRNA,transposase	Escherichia_phage(28.57%)	49	2084468:2084483	2125591:2125606
2084468:2084483	attL	CAACCAGTTCACCTTC	NA	NA	NA	NA
WP_001326497.1|2094856_2095615_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|2095820_2096741_-	agmatinase	NA	NA	NA	NA	NA
WP_001300904.1|2096878_2098855_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2098863_2098995_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|2099130_2099346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300469.1|2099342_2099510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2099649_2100804_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2101227_2102622_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001300769.1|2102698_2103196_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2103290_2103998_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|2104077_2104809_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2104821_2105772_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|2105808_2106444_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|2106443_2106860_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001295381.1|2107043_2108024_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2108041_2108746_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2108763_2109330_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2109326_2109617_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|2109624_2110218_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|2110210_2111347_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|2111501_2112509_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394131.1|2112625_2113672_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2113847_2114567_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2114750_2115077_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2115076_2115796_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|2115956_2117009_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2117036_2117312_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|2117376_2118456_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001299430.1|2118657_2119914_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839760.1|2119963_2122099_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|2122496_2123204_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_137565924.1|2123562_2124780_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	5.0e-129
WP_008913927.1|2124899_2125184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538491.1|2126459_2126990_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
2125591:2125606	attR	GAAGGTGAACTGGTTG	NA	NA	NA	NA
WP_000081909.1|2126999_2129393_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
WP_001407551.1|2129470_2130487_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_152931452.1|2131910_2135954_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_152931451.1|2135957_2138663_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_161997713.1|2138662_2140834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152931450.1|2140830_2144268_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_152931449.1|2144264_2145758_-	lipopolysaccharide kinase	NA	NA	NA	NA	NA
WP_152931448.1|2145754_2146483_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_152931447.1|2146475_2147057_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_152931446.1|2147058_2148789_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_152931445.1|2148785_2150933_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	31.6	5.3e-57
WP_152931444.1|2150935_2152507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2152556_2153785_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_152931510.1|2153873_2154560_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_164538492.1|2155090_2156107_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	2.2e-186
>prophage 150
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2173571	2173811	4659400		Vibrio_phage(100.0%)	1	NA	NA
WP_152931422.1|2173571_2173811_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	42.6	2.0e-05
>prophage 151
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2184615	2184807	4659400		Escherichia_phage(100.0%)	1	NA	NA
WP_024241676.1|2184615_2184807_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.9e-06
>prophage 152
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2204202	2205375	4659400		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|2204202_2205375_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 153
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2227146	2228031	4659400		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|2227146_2228031_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 154
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2234107	2243458	4659400		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|2234107_2234935_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|2235134_2236061_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2236111_2236369_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_164538495.1|2236411_2238631_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	1.1e-102
WP_000059388.1|2238741_2240154_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|2240228_2240966_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|2241199_2243458_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 155
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2246737	2247130	4659400		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2246737_2247130_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 156
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2250957	2261920	4659400		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|2250957_2252850_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|2252878_2253460_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|2253459_2254287_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2254311_2254734_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_164538496.1|2254734_2255364_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.1	1.6e-17
WP_000735278.1|2255568_2257050_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2257197_2257869_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2257874_2259035_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|2259072_2259888_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2260003_2260777_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2260834_2261005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2261266_2261920_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 157
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2266139	2267573	4659400		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2266139_2267573_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 158
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2272710	2273949	4659400	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|2272710_2273949_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 159
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2280350	2296546	4659400	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|2280350_2281364_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2281601_2281817_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2281927_2283673_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|2283867_2285709_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2285787_2286294_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|2286547_2287312_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|2287599_2288223_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094721.1|2288376_2289897_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_164538497.1|2290203_2291694_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	4.8e-33
WP_000450594.1|2291735_2292068_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|2292286_2293270_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|2293453_2296546_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 160
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2309300	2310266	4659400		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2309300_2310266_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 161
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2330844	2333139	4659400		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2330844_2333139_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 162
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2341345	2342491	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|2341345_2342491_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 163
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2365500	2373294	4659400		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|2365500_2366361_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_164538499.1|2366425_2368462_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246830.1|2368419_2368815_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2368834_2369425_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2369434_2370010_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|2370123_2371164_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|2371236_2371872_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2371999_2372518_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2372497_2372941_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|2372991_2373294_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 164
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2378996	2380886	4659400		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2378996_2380886_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 165
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2386367	2393006	4659400		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2386367_2389040_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2389064_2390552_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2390579_2391032_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2391662_2393006_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 166
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2397088	2399961	4659400	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2397088_2397937_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2398026_2399961_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 167
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2406735	2408214	4659400		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|2406735_2407707_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445404.1|2407935_2408214_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	5.8e-17
>prophage 168
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2412282	2427077	4659400		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2412282_2413092_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2413301_2414279_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2414292_2415279_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2415299_2415866_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2415862_2416438_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2416406_2416964_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2416970_2417696_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|2417743_2419177_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2419199_2419487_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2419604_2420096_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2420141_2420996_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|2420992_2421265_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2421478_2422111_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|2422107_2422836_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2422832_2423486_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2423715_2426052_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|2426147_2427077_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 169
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2439654	2444402	4659400		Salmonella_phage(50.0%)	5	NA	NA
WP_000445116.1|2439654_2440782_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|2440841_2441306_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|2441302_2442178_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2442174_2442864_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|2442911_2444402_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 170
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2448105	2448603	4659400	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2448105_2448603_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 171
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2452569	2455094	4659400	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|2452569_2453937_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|2454026_2455094_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 172
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2471870	2472914	4659400		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2471870_2472914_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 173
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2483479	2484364	4659400		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|2483479_2484364_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 174
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2490868	2495022	4659400		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|2490868_2491894_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|2491961_2493143_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|2493152_2494256_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|2494263_2495022_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 175
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2505517	2506989	4659400	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2505517_2506027_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|2506041_2506989_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 176
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2528204	2530157	4659400		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|2528204_2530157_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 177
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2538987	2547546	4659400		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|2538987_2541681_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|2541972_2543157_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|2543227_2545342_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2545438_2545909_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2546005_2546380_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|2546505_2546793_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|2546800_2547160_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|2547159_2547546_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 178
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2553116	2562657	4659400		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2553116_2555030_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|2555029_2556052_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2556045_2556264_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2556317_2557187_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2557241_2557646_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2557947_2558580_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_152924783.1|2558630_2560721_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|2560787_2562008_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|2562093_2562657_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 179
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2586904	2587741	4659400		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|2586904_2587741_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 180
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2604645	2608412	4659400		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|2604645_2606268_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_164538503.1|2606343_2607696_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2607692_2608412_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 181
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2614994	2615873	4659400		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|2614994_2615873_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 182
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2621907	2624301	4659400		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|2621907_2624301_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 183
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2628680	2629907	4659400		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|2628680_2629907_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 184
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2635962	2638410	4659400		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|2635962_2638410_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 185
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2657315	2659126	4659400		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073613.1|2657315_2658059_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	5.8e-11
WP_000907792.1|2658055_2659126_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 186
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2662669	2664152	4659400		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416891.1|2662669_2663383_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|2663384_2664152_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 187
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2669885	2672704	4659400		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|2669885_2670740_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|2670984_2672043_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2672035_2672704_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 188
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2675710	2679842	4659400		Dickeya_phage(50.0%)	4	NA	NA
WP_053898938.1|2675710_2676337_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.1	1.8e-29
WP_000106551.1|2676410_2678609_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|2678710_2678956_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|2679176_2679842_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 189
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2687735	2693387	4659400		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|2687735_2688542_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|2688547_2688949_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_164538506.1|2689151_2693387_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 190
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2696762	2699498	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|2696762_2699498_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 191
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2707941	2710019	4659400		Bacillus_phage(100.0%)	2	NA	NA
WP_001211180.1|2707941_2709342_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|2709338_2710019_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 192
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2715113	2718600	4659400		Listeria_phage(50.0%)	3	NA	NA
WP_000287501.1|2715113_2715851_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|2715884_2716082_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|2716122_2718600_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
>prophage 193
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2725743	2729072	4659400		Bacillus_phage(66.67%)	4	NA	NA
WP_000697969.1|2725743_2726424_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555736.1|2726416_2727898_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|2728142_2728574_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000647571.1|2728721_2729072_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
>prophage 194
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2746292	2748335	4659400		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2746292_2748335_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 195
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2751680	2759054	4659400	transposase	uncultured_Caudovirales_phage(60.0%)	7	NA	NA
WP_000008957.1|2751680_2752034_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|2752087_2753377_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|2753389_2753815_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_001407551.1|2754672_2755689_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001057453.1|2757112_2757679_+	outer membrane lipoprotein Slp	NA	NA	NA	NA	NA
WP_000478619.1|2757834_2758365_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001296814.1|2758406_2759054_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 196
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2790655	2792640	4659400		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|2790655_2791660_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2791656_2792640_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 197
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2802852	2805186	4659400		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|2802852_2805186_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 198
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2808840	2810840	4659400	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2808840_2809053_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|2809239_2809392_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|2809471_2810840_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 199
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2814678	2815674	4659400		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|2814678_2815674_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 200
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2820992	2822534	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2820992_2822534_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 201
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2841865	2852014	4659400	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582468.1|2841865_2843710_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|2843706_2845098_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2845195_2845804_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_164538515.1|2846031_2850165_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.1e-25
WP_000072850.1|2850185_2851028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063121680.1|2851180_2852014_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	8.7e-24
>prophage 202
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2868817	2879546	4659400		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|2868817_2869069_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2869210_2869642_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2869886_2871431_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2871440_2872724_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|2872727_2873687_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|2873673_2874708_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|2874946_2875972_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2875981_2877178_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|2877452_2878310_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|2878613_2879546_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 203
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2891477	2896040	4659400		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_032231556.1|2891477_2891957_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	6.3e-27
WP_001114533.1|2891995_2892805_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2892902_2893070_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2893090_2893327_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2893543_2894212_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|2894383_2895604_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|2895581_2896040_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 204
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2899413	2906162	4659400		Morganella_phage(25.0%)	6	NA	NA
WP_001300958.1|2899413_2900238_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|2900527_2901145_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_164538517.1|2901141_2902824_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	1.9e-22
WP_001295237.1|2903081_2903705_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2903759_2904035_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2904053_2906162_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 205
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2910598	2911990	4659400		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2910598_2911990_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 206
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2924108	2925443	4659400		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|2924108_2925443_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 207
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2932749	2941770	4659400		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|2932749_2934438_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|2934543_2934642_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|2935206_2935296_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|2935575_2936760_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|2936767_2937265_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2937261_2937624_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2937613_2937961_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|2938068_2938518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|2938564_2940058_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|2940054_2941770_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 208
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2948122	2949076	4659400		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2948122_2948551_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2948662_2949076_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 209
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2953503	2954652	4659400		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2953503_2954652_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 210
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2959358	2966727	4659400		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2959358_2961773_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2961801_2962875_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2962874_2963975_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2963979_2965383_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|2965679_2965760_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2965989_2966130_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2966146_2966506_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2966469_2966727_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 211
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2976925	2978263	4659400		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|2976925_2978263_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 212
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	2989252	2996860	4659400		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2989252_2990026_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251978.1|2990208_2991099_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2991098_2992058_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2992144_2993185_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_164538526.1|2993498_2995328_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	3.3e-132
WP_000933736.1|2995489_2996860_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 213
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3008814	3009807	4659400		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|3008814_3009807_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 214
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3012975	3018828	4659400		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3012975_3014844_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|3015010_3015430_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|3015437_3016943_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3016947_3017913_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3017937_3018828_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 215
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3032219	3033866	4659400		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|3032219_3033866_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 216
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3042338	3047752	4659400		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|3042338_3044360_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001295254.1|3044406_3045891_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3046026_3047292_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3047422_3047752_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 217
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3051794	3057938	4659400		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3051794_3052925_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|3052921_3054184_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226602.1|3054183_3055251_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_164538527.1|3055269_3056151_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	1.5e-106
WP_001145183.1|3056128_3056803_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|3056807_3057938_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 218
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3066022	3067678	4659400		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000406041.1|3066022_3067678_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 219
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3077981	3081840	4659400		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3077981_3078878_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3078877_3079594_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3079677_3081840_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 220
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3087558	3089388	4659400		Catovirus(100.0%)	1	NA	NA
WP_164538585.1|3087558_3089388_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	4.3e-84
>prophage 221
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3101920	3105207	4659400		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187535.1|3101920_3103561_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3103639_3103909_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_001724133.1|3103912_3104428_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3104430_3105207_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 222
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3114088	3114703	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|3114088_3114703_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 223
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3128561	3131348	4659400		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3128561_3131348_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 224
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3135459	3137930	4659400		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3135459_3136869_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3136880_3137930_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 225
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3149405	3152185	4659400		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|3149405_3150302_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_164538530.1|3150469_3151366_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3151399_3152185_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 226
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3159502	3162553	4659400		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|3159502_3162553_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 227
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3179149	3184010	4659400		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|3179149_3179770_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_023281577.1|3180029_3181013_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|3181161_3181836_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|3181941_3183315_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|3183311_3184010_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 228
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3195621	3200124	4659400		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|3195621_3196467_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3196891_3197137_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3197221_3197707_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3197799_3198726_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3198792_3200124_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 229
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3217422	3224669	4659400		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424841.1|3217422_3218085_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
WP_023281599.1|3218096_3220598_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|3220906_3221986_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|3222000_3222321_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|3222371_3224669_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 230
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3242015	3243899	4659400		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591385.1|3242015_3243899_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	26.8	2.0e-07
>prophage 231
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3252405	3255458	4659400		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3252405_3253356_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3254273_3255458_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 232
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3259574	3267903	4659400		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3259574_3263603_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3263679_3267903_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 233
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3277120	3278884	4659400		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|3277120_3277792_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|3277834_3278425_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3278611_3278884_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 234
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3284246	3285836	4659400		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|3284246_3285836_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 235
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3302396	3306080	4659400		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|3302396_3306080_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 236
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3325366	3326482	4659400		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3325366_3326482_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 237
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3335697	3336306	4659400		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3335697_3336306_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 238
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3342896	3345444	4659400		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3342896_3344312_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_023281607.1|3344364_3345444_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.8e-29
>prophage 239
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3349631	3353244	4659400		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|3349631_3352454_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3352707_3353244_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 240
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3357061	3358411	4659400		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3357061_3358411_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 241
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3363994	3365953	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|3363994_3365953_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 242
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3375575	3377723	4659400		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3375575_3377723_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 243
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3382968	3389337	4659400		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066021.1|3382968_3384954_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.2e-148
WP_001171687.1|3385226_3386156_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|3386139_3386835_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|3386845_3387826_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235246.1|3387804_3389337_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
>prophage 244
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3395467	3397017	4659400		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|3395467_3396148_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|3396258_3397017_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 245
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3402605	3403394	4659400		Pithovirus(100.0%)	1	NA	NA
WP_001565372.1|3402605_3403394_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.5e-12
>prophage 246
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3408830	3410333	4659400		Burkholderia_virus(100.0%)	1	NA	NA
WP_001401452.1|3408830_3410333_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.8	1.6e-55
>prophage 247
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3431529	3434741	4659400	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3431529_3433047_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_164538535.1|3433283_3434741_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	4.0e-48
>prophage 248
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3443274	3445454	4659400		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692350.1|3443274_3443496_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_063091579.1|3443582_3444059_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860074.1|3444074_3444554_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234688.1|3444635_3445454_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	2.3e-45
>prophage 249
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3449869	3452241	4659400	integrase	Escherichia_phage(66.67%)	3	3445152:3445164	3453156:3453168
3445152:3445164	attL	AATAATTTCAGGG	NA	NA	NA	NA
WP_001603498.1|3449869_3450091_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053270478.1|3450090_3450468_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	2.7e-57
WP_063078140.1|3450978_3452241_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	2.6e-80
3453156:3453168	attR	AATAATTTCAGGG	NA	NA	NA	NA
>prophage 250
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3460575	3462559	4659400		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|3460575_3460869_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3460912_3462559_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 251
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3467063	3467600	4659400		Morganella_phage(100.0%)	1	NA	NA
WP_001238379.1|3467063_3467600_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
>prophage 252
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3472520	3473498	4659400		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3472520_3473498_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 253
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3481701	3482247	4659400		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3481701_3482247_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 254
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3486162	3499193	4659400	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|3486162_3487500_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122513.1|3487509_3489357_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_001280345.1|3489349_3490300_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3490385_3490694_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3490769_3492050_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3492135_3493395_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3493397_3494402_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089296.1|3494483_3494681_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3494784_3496083_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|3496287_3496713_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3496751_3499193_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 255
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3503125	3504289	4659400		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|3503125_3504289_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 256
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3544340	3550828	4659400		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3544340_3544871_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|3545180_3546137_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|3546276_3547779_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001297255.1|3547792_3548815_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3548801_3549797_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3549829_3550828_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 257
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3555016	3557778	4659400		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106239.1|3555016_3555481_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187776.1|3555639_3557778_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 258
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3561416	3567513	4659400		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_023281621.1|3561416_3562364_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3562548_3562602_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3562742_3565439_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_023281622.1|3565644_3566031_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3566103_3566565_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3566577_3567513_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 259
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3575869	3585145	4659400	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416391.1|3575869_3578725_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|3578724_3579168_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3579521_3581033_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3581299_3582400_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3582399_3583482_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053272848.1|3583642_3585145_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 260
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3590274	3593042	4659400	integrase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	3580481:3580493	3597127:3597139
3580481:3580493	attL	TAATCCCGGCGGC	NA	NA	NA	NA
WP_000061766.1|3590274_3591294_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
WP_001219052.1|3591773_3593042_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.0	4.8e-82
3597127:3597139	attR	TAATCCCGGCGGC	NA	NA	NA	NA
>prophage 261
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3599832	3601293	4659400		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3599832_3601293_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 262
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3607861	3608416	4659400		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|3607861_3608416_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 263
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3620995	3626362	4659400		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919544.1|3620995_3622660_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|3622708_3624070_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091573.1|3624286_3625201_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106021.1|3625339_3626362_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.7	2.7e-11
>prophage 264
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3629589	3630869	4659400		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3629589_3630327_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098830.1|3630329_3630869_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 265
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3638807	3641683	4659400		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3638807_3640397_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3640789_3641395_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3641521_3641683_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 266
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3647621	3648944	4659400		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3647621_3648944_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 267
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3655687	3661042	4659400		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|3655687_3656920_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|3657226_3658894_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_095157621.1|3659104_3661042_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 268
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3664325	3666439	4659400		Bacillus_phage(50.0%)	2	NA	NA
WP_001188664.1|3664325_3665015_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219615.1|3665014_3666439_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	1.4e-08
>prophage 269
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3678207	3688625	4659400	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130189.1|3678207_3679161_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|3679275_3679863_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3679897_3680464_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|3680612_3681326_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|3681351_3681756_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3682132_3684049_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118473.1|3684137_3685268_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	3.6e-28
WP_001300563.1|3685414_3686527_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|3686720_3686930_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|3687458_3688625_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 270
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3695663	3698480	4659400	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286865.1|3695663_3698480_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 271
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3702923	3704072	4659400		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3702923_3704072_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 272
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3709666	3715327	4659400		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000351353.1|3709666_3711220_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
WP_001565450.1|3711293_3712511_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3712639_3713782_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787118.1|3713812_3715327_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.6e-07
>prophage 273
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3723224	3725978	4659400		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|3723224_3723704_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_089642142.1|3724002_3724470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094322565.1|3724505_3725105_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_164538539.1|3725129_3725978_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	8.1e-09
>prophage 274
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3733737	3739159	4659400		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001116994.1|3733737_3736644_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035666.1|3736807_3739159_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	1.0e-37
>prophage 275
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3745607	3746306	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_001565455.1|3745607_3746306_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 276
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3759008	3760733	4659400		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|3759008_3760733_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 277
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3786822	3787866	4659400		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3786822_3787866_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 278
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3792111	3792663	4659400		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3792111_3792663_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 279
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3801290	3802715	4659400		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3801290_3802715_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 280
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3810364	3816987	4659400		Mamastrovirus(33.33%)	5	NA	NA
WP_001189600.1|3810364_3811915_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|3812116_3814507_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3814712_3815249_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3815289_3815952_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3816060_3816987_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 281
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3820249	3821152	4659400		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|3820249_3821152_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 282
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3824542	3831348	4659400	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174632.1|3824542_3825961_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937398.1|3825999_3826926_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3826962_3827418_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_032256326.1|3827595_3828300_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294674.1|3828314_3828845_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001300640.1|3828918_3831348_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.9	7.9e-41
>prophage 283
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3836543	3837341	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3836543_3837341_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 284
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3843252	3843597	4659400		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3843252_3843597_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 285
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3847526	3848951	4659400	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3847526_3848951_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 286
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3861548	3862307	4659400		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3861548_3862307_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 287
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3871135	3875251	4659400		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|3871135_3871732_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|3871768_3875251_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 288
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3888254	3889286	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3888254_3889286_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 289
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3895796	3903428	4659400		Indivirus(25.0%)	9	NA	NA
WP_000997050.1|3895796_3896600_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
WP_000648577.1|3896596_3897511_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3897751_3898552_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016012.1|3898555_3899179_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|3899226_3900585_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052717.1|3900656_3901412_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|3901445_3902168_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3902164_3902632_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|3902696_3903428_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
>prophage 290
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3918944	3922863	4659400		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|3918944_3919523_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3919728_3920496_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3920466_3921207_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|3921362_3921641_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|3921643_3921904_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_024192679.1|3922113_3922863_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
>prophage 291
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3936829	3939787	4659400		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|3936829_3937225_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_001143108.1|3937342_3939787_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.2	7.2e-34
>prophage 292
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3968907	3980255	4659400	integrase	Enterobacteria_phage(37.5%)	13	3970393:3970407	3977746:3977760
WP_000749863.1|3968907_3969963_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3970250_3971354_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
3970393:3970407	attL	TGACGTCGGGCGCGA	NA	NA	NA	NA
WP_000893278.1|3971365_3972619_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_089592180.1|3972974_3974189_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	1.4e-134
WP_077580828.1|3974332_3975052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048241341.1|3975267_3975465_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	3.0e-07
WP_023063312.1|3975464_3975899_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.7	3.8e-31
WP_096159113.1|3975977_3976682_+	ash family protein	NA	NA	NA	NA	NA
WP_164538549.1|3976674_3976854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096171345.1|3976850_3977165_+	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
WP_063100848.1|3977161_3977425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106719819.1|3977479_3977821_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	47.2	1.4e-23
3977746:3977760	attR	TGACGTCGGGCGCGA	NA	NA	NA	NA
WP_164538550.1|3977813_3980255_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.6	1.6e-137
>prophage 293
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	3984293	3986492	4659400		Acinetobacter_phage(100.0%)	1	NA	NA
WP_053286015.1|3984293_3986492_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	26.1	1.9e-38
>prophage 294
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4005317	4006643	4659400		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|4005317_4006643_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 295
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4012218	4018138	4659400	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|4012218_4013889_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|4013902_4015375_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|4015388_4015976_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4016104_4018138_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 296
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4029525	4030575	4659400		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|4029525_4030575_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 297
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4039347	4041234	4659400		Staphylococcus_phage(100.0%)	1	NA	NA
WP_164538553.1|4039347_4041234_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.6e-52
>prophage 298
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4044432	4045332	4659400		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|4044432_4045332_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 299
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4050644	4054924	4659400		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_164538554.1|4050644_4053719_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.8	0.0e+00
WP_000805902.1|4053841_4054924_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 300
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4060334	4062295	4659400		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4060334_4061285_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4061281_4062295_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 301
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4065874	4066984	4659400		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4065874_4066984_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 302
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4072282	4073050	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|4072282_4073050_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 303
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4076772	4077639	4659400	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_164538400.1|4076772_4077639_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.3e-50
>prophage 304
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4082597	4083755	4659400		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|4082597_4083755_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 305
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4091170	4092286	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4091170_4092286_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 306
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4096575	4106651	4659400		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|4096575_4097487_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|4097611_4098520_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|4098766_4099951_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001556449.1|4100076_4103220_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001564482.1|4103216_4104419_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113939.1|4104608_4105298_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	5.7e-37
WP_001556452.1|4105355_4106651_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	3.8e-26
>prophage 307
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4113603	4122584	4659400	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4113603_4114731_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4114753_4115086_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4115113_4116961_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4116971_4117943_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_021570705.1|4118071_4118419_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4118595_4119480_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|4119778_4120318_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4120468_4120918_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|4120921_4122025_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|4122113_4122584_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 308
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4144144	4149191	4659400	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4144144_4144768_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_164538557.1|4144893_4146168_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.6	8.7e-132
WP_001295325.1|4146355_4148710_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4148918_4149191_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 309
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4152319	4153015	4659400		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|4152319_4153015_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 310
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4156338	4159885	4659400		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|4156338_4158111_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|4158103_4159885_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 311
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4168721	4171871	4659400		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4168721_4171871_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 312
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4178879	4187441	4659400		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4178879_4179431_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4179559_4181491_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4181543_4181873_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4181872_4182478_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_053286022.1|4182587_4184462_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.1	4.7e-118
WP_001220233.1|4184642_4185287_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|4185522_4186485_+	ferrochelatase	NA	NA	NA	NA	NA
WP_164538558.1|4186481_4187441_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 313
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4195685	4198847	4659400		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|4195685_4196027_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|4196342_4198847_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 314
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4203386	4204064	4659400		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4203386_4204064_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 315
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4207200	4207887	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|4207200_4207887_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 316
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4215790	4217019	4659400	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_088895425.1|4215790_4217019_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 317
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4223496	4225278	4659400		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_164538560.1|4223496_4225278_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	2.7e-38
>prophage 318
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4232245	4233391	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|4232245_4233391_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 319
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4244968	4248099	4659400	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|4244968_4246354_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|4246389_4246911_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4247018_4247231_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4247232_4248099_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 320
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4255097	4256114	4659400	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001407551.1|4255097_4256114_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 321
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4262182	4262866	4659400		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|4262182_4262866_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 322
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4266136	4269280	4659400		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|4266136_4269280_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 323
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4275224	4276593	4659400	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_085947770.1|4275224_4276593_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 324
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4283012	4289055	4659400		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|4283012_4286894_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|4287109_4288243_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4288239_4289055_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 325
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4303602	4305425	4659400		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502936.1|4303602_4304232_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
WP_000029825.1|4304204_4305425_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 326
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4308608	4310723	4659400		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|4308608_4310174_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|4310294_4310723_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 327
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4326148	4326795	4659400		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4326148_4326358_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|4326411_4326795_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 328
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4332385	4334824	4659400		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4332385_4333597_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|4333735_4334824_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 329
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4341834	4344417	4659400	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|4341834_4344417_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 330
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4351356	4354889	4659400		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|4351356_4353027_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|4353110_4354046_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4354163_4354889_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 331
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4360772	4361852	4659400		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4360772_4361852_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 332
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4365947	4367612	4659400		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4365947_4367612_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 333
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4372378	4376257	4659400	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|4372378_4374325_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4374592_4376257_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 334
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4380537	4381302	4659400		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4380537_4381302_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 335
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4389555	4402276	4659400		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|4389555_4390233_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|4390229_4392914_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|4392906_4393479_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|4393487_4395536_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741131.1|4395558_4397232_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4397231_4397321_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4397633_4397840_+	YbfA family protein	NA	NA	NA	NA	NA
WP_164538563.1|4398082_4402276_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
>prophage 336
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4408783	4411833	4659400		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|4408783_4410202_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|4410351_4411833_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 337
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4415211	4416003	4659400		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|4415211_4416003_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 338
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4452180	4455700	4659400		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|4452180_4452900_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|4452896_4453838_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4453951_4454332_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|4454647_4455700_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 339
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4460053	4466627	4659400		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|4460053_4461070_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|4461330_4462803_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|4462870_4463659_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4463787_4463937_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|4464103_4464877_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|4464876_4465566_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4465568_4466627_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 340
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4476983	4478273	4659400		Klosneuvirus(100.0%)	1	NA	NA
WP_164538564.1|4476983_4478273_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	4.1e-20
>prophage 341
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4484754	4485663	4659400		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4484754_4485663_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 342
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4496260	4508223	4659400		Anomala_cuprea_entomopoxvirus(16.67%)	11	NA	NA
WP_000996107.1|4496260_4497997_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976400.1|4497989_4498988_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4498987_4499659_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|4499887_4501252_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|4501483_4501966_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|4502085_4504236_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|4504263_4505226_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_164538565.1|4505366_4506452_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4506680_4506941_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4507205_4507472_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|4507545_4508223_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
>prophage 343
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4511588	4511849	4659400		Erwinia_phage(100.0%)	1	NA	NA
WP_000710619.1|4511588_4511849_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 344
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4515532	4520757	4659400		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|4515532_4516255_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|4516251_4516911_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4517049_4517796_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4518199_4518703_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4519001_4519889_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4520123_4520189_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4520241_4520757_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 345
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4525754	4534096	4659400		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|4525754_4527347_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|4527587_4528853_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|4529004_4529820_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|4529965_4532398_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|4532403_4533303_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|4533433_4534096_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 346
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4537311	4539183	4659400		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4537311_4539183_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 347
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4551295	4552498	4659400		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|4551295_4552498_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 348
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4559006	4648648	4659400	portal,tail,lysis,tRNA,terminase,plate,protease,integrase,head,capsid	Salmonella_phage(58.06%)	93	4556047:4556062	4652360:4652375
4556047:4556062	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_001471277.1|4559006_4560038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
WP_001321204.1|4560224_4560416_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_016245839.1|4560431_4561001_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
WP_001247707.1|4561126_4561348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538567.1|4561380_4561890_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.2e-86
WP_000956182.1|4561897_4562098_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|4562061_4562403_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244167.1|4562470_4562704_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000752613.1|4562703_4562931_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104155.1|4562927_4563782_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	91.9	3.6e-150
WP_001420002.1|4563787_4564609_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_164538568.1|4564608_4566981_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_001154431.1|4567134_4567323_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|4567333_4567567_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_039516388.1|4567892_4569095_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	36.2	2.9e-60
WP_039516390.1|4569057_4569975_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_039516393.1|4570022_4571051_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	4.0e-172
WP_001098411.1|4571050_4572817_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_001459608.1|4572959_4573793_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	3.1e-122
WP_000742510.1|4573809_4574868_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_164538569.1|4574871_4575522_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	4.7e-110
WP_000673523.1|4575617_4576082_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|4576081_4576285_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4576288_4576504_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4576484_4576997_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727851.1|4576998_4577376_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_023135316.1|4577372_4577801_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_001595569.1|4577896_4578328_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_023135313.1|4578320_4578767_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_039516405.1|4578835_4579414_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_001583421.1|4579410_4579770_+	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	1.5e-52
WP_164538570.1|4579756_4580665_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086820.1|4580657_4581263_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_164538738.1|4581259_4582783_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.3	1.3e-195
WP_164538393.1|4582782_4583376_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.4	2.5e-57
WP_001752131.1|4583347_4583782_-|tail	caudovirales tail fiber assembly family protein	tail	A0A0F7LDZ0	Escherichia_phage	43.4	6.5e-23
WP_164538739.1|4583784_4584633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103488341.1|4584660_4585227_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	8.4e-87
WP_103488340.1|4585369_4586542_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.0e-203
WP_001504081.1|4586551_4587067_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281016.1|4587121_4587424_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001513105.1|4587438_4587558_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_164538572.1|4587550_4590628_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.4	0.0e+00
WP_000980384.1|4590624_4591110_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_164538573.1|4591106_4592207_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	1.2e-177
WP_000972391.1|4592297_4592516_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4592751_4594437_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|4594706_4595084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|4595113_4595371_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4595530_4595818_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|4596583_4597486_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4597573_4598050_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|4598400_4599513_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|4599607_4600741_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|4600750_4601704_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|4601700_4602546_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4602605_4603094_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|4603134_4604262_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|4604460_4605192_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4605482_4606151_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|4606150_4606867_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|4606873_4607605_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4607622_4608351_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|4608568_4609084_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4609209_4609533_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|4609529_4610360_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_164538589.1|4610356_4611370_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136577.1|4611468_4612899_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|4612909_4613911_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|4613947_4615666_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178677.1|4615798_4616767_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|4616778_4618431_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|4618574_4619474_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|4619968_4620664_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|4621089_4622748_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001340333.1|4622744_4623695_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|4623851_4624967_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188144.1|4624963_4626910_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4626982_4627207_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4627529_4627850_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4627880_4630157_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4630841_4631060_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4631344_4632049_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|4632090_4633812_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043598.1|4633812_4635579_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|4635701_4636667_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4637211_4637706_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_164538574.1|4637840_4641830_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4641988_4642600_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|4642610_4643954_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4644044_4645337_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|4645575_4648020_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|4648030_4648648_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
4652360:4652375	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 349
NZ_CP047461	Escherichia coli strain ZF34 chromosome, complete genome	4659400	4654956	4659139	4659400	integrase	Escherichia_phage(33.33%)	9	4649156:4649167	4656906:4656917
4649156:4649167	attL	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000067977.1|4654956_4655754_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|4655785_4656781_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|4656874_4657186_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
4656906:4656917	attR	GTTGTTGAGTCT	NA	NA	NA	NA
WP_000022051.1|4657290_4657647_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001005162.1|4657657_4657828_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217682.1|4657824_4658325_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|4658388_4658613_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|4658612_4658915_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113264.1|4658914_4659139_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
>prophage 1
NZ_CP047466	Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence	114813	0	57600	114813	integrase,transposase	Escherichia_phage(24.0%)	55	13741:13800	55092:55912
WP_000843497.1|378_576_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|616_3094_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_164538509.1|3191_3632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219104.1|3718_6865_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
WP_001381488.1|6875_8168_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|8281_8635_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|8662_10048_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|10237_10918_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|10910_12386_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|12636_13068_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_025670887.1|13211_13520_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.6	8.8e-14
WP_077881175.1|13513_13828_-	hypothetical protein	NA	U5P0U6	Shigella_phage	100.0	5.4e-35
13741:13800	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|13804_14509_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001814923.1|15274_15391_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_025989258.1|15406_17326_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_012477564.1|17438_18029_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|18165_18738_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|18774_20166_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|20945_21602_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_071779647.1|23054_25943_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
WP_164538740.1|26042_26702_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	9.7e-127
WP_164538742.1|26806_27109_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	98.0	3.3e-50
WP_164538595.1|26999_27638_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|27846_28158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000734776.1|28193_28508_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_000220560.1|29320_29602_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_000121743.1|29591_29843_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001050931.1|31076_31913_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000456533.1|32535_32892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245156.1|32888_33866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185482.1|33890_34172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516402.1|34269_34932_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_000203396.1|35312_35957_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_000565612.1|36111_36195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011264039.1|37240_37480_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|37625_38489_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|38526_38772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|39240_40032_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|40034_40310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|41211_41544_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|41713_42505_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|42597_43857_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|44118_44910_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|44915_45161_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|45317_45815_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|45959_46973_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|47175_47526_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|47651_48212_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067855.1|49975_50680_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|51904_52573_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|52608_52845_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|52841_53204_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001067855.1|54382_55087_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_046788546.1|56409_56811_+	hypothetical protein	NA	NA	NA	NA	NA
55092:55912	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTGCCGCACGTCAAGATCACCGAACTGCTGCTCGAAGTCGATGAGTGGACGGGCTTCACCCGGCACTTCACGCACTTGAAATCGGGCGATCTGGCCAAGGACAAGAACCTGTTGTTGACCACGATCCTGGCCGACGCGATCAACCTGGGCCTGACCAAGATGGCCGAGTCCTGCCCCGGCACGACCTACGCGAAGCTCGCTTGGCTGCAAGCCTGGCATACCCGCGACGAAACGTACTCGACAGCGTTGGCTGAACTGGTCAACGCTCAGTTTCGGCATCCCTTTGCCGGGCACTGGGGCGATGGCACCACATCATCATCGGACGGACAGAATTTCCGAACCGCTAGCAAGGCAAAGAGCACGGGGCACATCAACCCAAAATATGGCAGCAGCCCAGGACGGACTTTCTACACCCACATCTCCGACCAATACGCGCCATTCCACACCAAGGTGGTCAATGTCGGCCTGCGCGACTCAACCTACGTGCTCGACGGCCTGCTGTACCACGAATCCGACCTGCGGATCGAGGAGCACTACACCGACACGGCGGGCTTCACCGATCACGTCTTCGCCCTGATGCACCTCTTGGGCTTCCGCTTCGCGCCGCGCATCCGCGACCTGGGCGACACCAAGCTCTACATCCCGAAGGGCGATGCCGCCTATGACGCGCTCAAGCCGATGATCGGCGGCACGCTCAACATCAAGCACGTCCGCGCCCATTGGGACGAAATCCTGCGGCTGGCCACCTCGATCAAGCAGGGC	NA	NA	NA	NA
WP_001067784.1|56895_57600_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
>prophage 2
NZ_CP047466	Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence	114813	66025	67648	114813		Tupanvirus(100.0%)	1	NA	NA
WP_094315248.1|66025_67648_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	9.9e-32
>prophage 3
NZ_CP047466	Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence	114813	71321	71834	114813		Bacillus_phage(100.0%)	1	NA	NA
WP_086371372.1|71321_71834_+	dihydrofolate reductase	NA	U5J9P6	Bacillus_phage	42.9	9.4e-29
>prophage 4
NZ_CP047466	Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence	114813	83008	90163	114813	transposase	Salmonella_phage(33.33%)	8	NA	NA
WP_058657119.1|83008_84223_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|84250_84556_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001445143.1|86197_86449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|86342_86645_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|86731_87547_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|87636_88726_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_072202717.1|88923_89403_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_001067855.1|89458_90163_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 5
NZ_CP047466	Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence	114813	96565	106674	114813		Macacine_betaherpesvirus(28.57%)	11	NA	NA
WP_000200069.1|96565_97576_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.9	6.7e-87
WP_000523812.1|98316_99483_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000817037.1|99482_100454_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	89.7	1.7e-156
WP_000534920.1|101401_101707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181753.1|101760_102012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457544.1|102090_103362_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_001776124.1|103361_103787_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_023281075.1|104238_105204_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.3e-58
WP_013438824.1|105375_105552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776120.1|105683_106115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232861.1|106146_106674_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
>prophage 6
NZ_CP047466	Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence	114813	111214	113652	114813	integrase,transposase	Gordonia_phage(50.0%)	2	102467:102479	112921:112933
102467:102479	attL	GCAAAAGGGGATG	NA	NA	NA	NA
WP_052935737.1|111214_112204_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
WP_001067855.1|112947_113652_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
112921:112933	attR	CATCCCCTTTTGC	NA	NA	NA	NA
