The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	1015150	1025991	3944857		Mycobacterium_phage(22.22%)	12	NA	NA
WP_075671546.1|1015150_1016350_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
WP_075671548.1|1016973_1017942_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.8	7.5e-136
WP_164530353.1|1017966_1020093_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	3.5e-202
WP_075671552.1|1020098_1020518_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.6	8.0e-10
WP_075671554.1|1020529_1020754_-	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_075671556.1|1021037_1021511_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	35.8	5.0e-16
WP_023581133.1|1021708_1021918_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_023581134.1|1022055_1022430_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_075671558.1|1022443_1023409_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_164530354.1|1023510_1024155_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036912266.1|1024315_1024579_-	YbeD family protein	NA	NA	NA	NA	NA
WP_164530355.1|1024779_1025991_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	8.0e-103
>prophage 2
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	1327629	1383681	3944857	head,integrase,tail,lysis,terminase	Morganella_phage(52.17%)	77	1332302:1332318	1386094:1386110
WP_099659754.1|1327629_1329681_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.9	3.9e-17
WP_075673145.1|1329682_1330141_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_075673146.1|1330278_1330692_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_036912304.1|1330770_1331088_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_075673147.1|1331288_1331570_+	acylphosphatase	NA	NA	NA	NA	NA
WP_023581360.1|1331613_1331943_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
1332302:1332318	attL	ATGTCTCTTGAAAGCTC	NA	NA	NA	NA
WP_161747994.1|1332378_1333563_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	51.3	1.7e-113
WP_004244695.1|1333566_1333773_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	6.7e-10
WP_161747976.1|1333802_1333997_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	93.8	7.1e-30
WP_164530393.1|1334081_1334684_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.7	7.9e-59
WP_161747978.1|1334670_1334898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530394.1|1334894_1335212_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	41.6	6.5e-12
WP_164530395.1|1336346_1336931_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	44.7	1.5e-35
WP_082239454.1|1336933_1337185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530396.1|1337203_1337482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530397.1|1337497_1338025_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	54.3	5.3e-51
WP_109849932.1|1338024_1338636_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.3	1.8e-74
WP_109373564.1|1338637_1338958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530398.1|1338954_1339107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530399.1|1339103_1339379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530400.1|1339634_1339862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162556818.1|1339950_1340175_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	39.2	1.8e-08
WP_164530401.1|1340187_1340406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530402.1|1340439_1341060_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	42.6	3.7e-35
WP_164530403.1|1341228_1341516_+	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
WP_164530404.1|1341500_1341662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530405.1|1341676_1341997_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	1.1e-19
WP_164530406.1|1342444_1344070_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	48.9	2.1e-98
WP_164530407.1|1344119_1344845_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	54.9	2.7e-61
WP_161769463.1|1344948_1345134_+	hypothetical protein	NA	A0A0U1UNM4	Pseudomonas_phage	41.0	1.4e-06
WP_004247478.1|1345276_1345624_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004247479.1|1345718_1345892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530408.1|1345888_1346656_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_164530799.1|1346655_1348041_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_026090523.1|1348068_1348398_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036919942.1|1348465_1348915_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1348993_1349284_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1349280_1349637_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_164530800.1|1349636_1350269_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	33.8	9.5e-23
WP_072062620.1|1350508_1350967_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_041701226.1|1351547_1351760_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.5e-25
WP_164530409.1|1352408_1352816_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_109372766.1|1352916_1353912_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_109850509.1|1353936_1354446_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	73.2	4.9e-70
WP_098943665.1|1354932_1355202_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	4.6e-19
WP_109850508.1|1355201_1355672_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	2.3e-50
WP_004244729.1|1355653_1355812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530410.1|1355814_1356276_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.9	2.6e-22
WP_036976683.1|1356781_1357210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530411.1|1357494_1357659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530412.1|1357738_1358347_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	77.9	6.1e-75
WP_164530413.1|1358349_1359834_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.5	6.1e-270
WP_164530414.1|1359835_1361218_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	80.2	7.3e-217
WP_109850503.1|1361220_1362282_+|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	76.2	4.6e-155
WP_089503223.1|1362348_1363035_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	77.1	4.3e-69
WP_164530415.1|1363040_1363991_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	86.5	4.3e-152
WP_098943655.1|1364033_1364411_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	72.8	4.0e-45
WP_164530416.1|1364412_1364754_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	81.4	5.3e-52
WP_164530417.1|1364756_1365125_+	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	82.8	1.7e-51
WP_164530418.1|1365121_1365493_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.9e-47
WP_164530419.1|1365557_1366313_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	79.3	1.7e-106
WP_164530420.1|1366362_1367055_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	69.6	1.4e-88
WP_164530421.1|1367160_1367601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530422.1|1367677_1368607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530423.1|1368683_1369016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530424.1|1369366_1370569_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_164530425.1|1370569_1371715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530426.1|1371788_1372139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530427.1|1372454_1372937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109850496.1|1372955_1373273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530428.1|1373412_1373793_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_164530429.1|1373856_1377213_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	46.3	7.2e-210
WP_109850493.1|1377252_1377582_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	7.3e-43
WP_164530430.1|1377578_1378277_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	5.8e-114
WP_164530431.1|1378280_1379000_+|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	75.3	1.1e-110
WP_089503237.1|1378936_1379503_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	78.2	1.8e-49
WP_164530432.1|1379502_1383681_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	76.1	0.0e+00
1386094:1386110	attR	ATGTCTCTTGAAAGCTC	NA	NA	NA	NA
>prophage 3
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	1599051	1612615	3944857	tRNA	Tupanvirus(55.56%)	13	NA	NA
WP_075673357.1|1599051_1600980_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
WP_036937410.1|1600983_1601523_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_004263702.1|1601617_1601815_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006537111.1|1601857_1602214_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|1602322_1602370_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_023582383.1|1602545_1603529_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_075673356.1|1603543_1605931_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	3.5e-09
WP_023582381.1|1605935_1606232_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_164530467.1|1606611_1607622_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_164530468.1|1607623_1608373_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L090	Tupanvirus	28.1	7.1e-09
WP_164530469.1|1608506_1609652_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.2	1.7e-38
WP_075673352.1|1609652_1610633_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.7	1.1e-38
WP_075673351.1|1610632_1612615_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
>prophage 4
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	2406643	2415453	3944857		Escherichia_phage(14.29%)	10	NA	NA
WP_164530566.1|2406643_2407420_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	40.2	8.6e-42
WP_075674189.1|2407494_2408037_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	7.7e-21
WP_036912664.1|2408735_2408915_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_075674190.1|2409291_2410194_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164530567.1|2410290_2411766_-	hypothetical protein	NA	A5X9J3	Aeromonas_virus	61.2	1.1e-21
WP_164530568.1|2411771_2412428_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	42.3	3.6e-41
WP_164530569.1|2412424_2413612_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	36.9	7.2e-72
WP_075674204.1|2413604_2413949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674205.1|2413945_2414638_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	35.6	8.2e-36
WP_164530570.1|2414640_2415453_-	hypothetical protein	NA	W5S7J0	Pseudomonas_phage	29.0	1.5e-15
>prophage 5
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	2418631	2425026	3944857	lysis,holin	Burkholderia_phage(25.0%)	9	NA	NA
WP_075674210.1|2418631_2419090_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	7.4e-25
WP_075674211.1|2419152_2419605_-	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_164530573.1|2419615_2421103_-	DUF3383 domain-containing protein	NA	Q6IWV2	Burkholderia_phage	30.6	2.5e-58
WP_164530574.1|2421111_2421624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099660644.1|2421719_2422169_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.4	2.1e-08
WP_075674215.1|2422165_2422570_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	4.5e-26
WP_075674216.1|2422562_2422871_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	55.4	3.1e-27
WP_099660645.1|2423234_2424050_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	44.8	1.1e-55
WP_075674218.1|2424288_2425026_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	46.3	1.8e-57
>prophage 6
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	2853907	2917878	3944857	integrase,protease,plate,tRNA	Tupanvirus(22.22%)	53	2848137:2848153	2902569:2902585
2848137:2848153	attL	AAATGTGATTTAGATCT	NA	NA	NA	NA
WP_164530633.1|2853907_2855671_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_164530634.1|2855634_2856732_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_099659268.1|2856706_2857270_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_075674113.1|2857272_2857707_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_075674114.1|2857786_2859169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530635.1|2859179_2859800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075674117.1|2860215_2860947_+	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	33.8	6.5e-07
WP_075674116.1|2861090_2861384_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075674163.1|2861903_2862431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674162.1|2862699_2864115_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164530636.1|2864606_2865026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530637.1|2865225_2865720_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_075674159.1|2866101_2866410_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075674158.1|2866555_2867095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530638.1|2868400_2869186_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_164530639.1|2870065_2871097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530812.1|2871347_2871749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530640.1|2871846_2872332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530641.1|2872546_2873248_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_164530642.1|2873461_2874298_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.1	1.6e-41
WP_164530643.1|2874311_2874737_-	antirestriction protein	NA	NA	NA	NA	NA
WP_164530644.1|2874828_2875692_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_164530645.1|2875753_2876695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530646.1|2877126_2877714_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_164530647.1|2877811_2878021_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_164530648.1|2879443_2879797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530649.1|2879859_2882016_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.8e-19
WP_164530650.1|2882019_2883588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530651.1|2883605_2884892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530652.1|2884888_2889175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530653.1|2889185_2890034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024223197.1|2890036_2891194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530654.1|2891183_2892869_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_164530813.1|2893005_2893419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530655.1|2893415_2894885_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.0	1.1e-10
WP_164530656.1|2895202_2897875_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_164530657.1|2897956_2899207_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.9	1.7e-84
WP_164530658.1|2899436_2900642_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.7	2.6e-125
WP_075673948.1|2901083_2901956_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
WP_075673947.1|2901959_2902172_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_075673946.1|2902824_2903766_+	1-phosphofructokinase	NA	NA	NA	NA	NA
2902569:2902585	attR	AAATGTGATTTAGATCT	NA	NA	NA	NA
WP_075673945.1|2904000_2904444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075673944.1|2904533_2905925_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	4.7e-38
WP_036934689.1|2906300_2906795_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_075673943.1|2906807_2907530_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_075673942.1|2907664_2908186_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_156733948.1|2908182_2909250_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_156733950.1|2909373_2910633_+	MFS transporter	NA	NA	NA	NA	NA
WP_075673939.1|2910700_2911726_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_099660128.1|2911902_2914065_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_156733951.1|2914153_2916595_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_075673936.1|2916591_2917278_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	8.5e-09
WP_075673935.1|2917248_2917878_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 7
NZ_CP047349	Proteus cibarius strain ZN2 chromosome, complete genome	3944857	3273819	3326758	3944857	integrase,transposase	Escherichia_phage(25.0%)	42	3267007:3267038	3287665:3287696
3267007:3267038	attL	CCTATGTGGACTCGGTTAGATAGATTGAAGAA	NA	NA	NA	NA
WP_063962748.1|3273819_3274797_-|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.0	6.0e-48
WP_000777554.1|3275128_3275602_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_164530706.1|3275712_3276069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164530707.1|3276284_3276716_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_164530708.1|3276998_3278615_-	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_087529691.1|3280143_3281811_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087529690.1|3281807_3283916_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_087529689.1|3283902_3284724_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_054103802.1|3287748_3288687_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
3287665:3287696	attR	CCTATGTGGACTCGGTTAGATAGATTGAAGAA	NA	NA	NA	NA
WP_002026815.1|3288679_3289471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530709.1|3289691_3290078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530710.1|3290074_3290647_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_164530711.1|3290721_3292011_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_164530816.1|3292013_3292910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025441422.1|3292893_3293520_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_000433891.1|3293516_3293798_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_164530712.1|3293978_3294302_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	44.6	1.3e-15
WP_000058216.1|3294298_3294577_+	helix-turn-helix domain-containing protein	NA	A0A088CD40	Shigella_phage	36.3	2.2e-08
WP_164530713.1|3294602_3295238_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_164530714.1|3295224_3295785_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_164530715.1|3295794_3297615_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_164530716.1|3297663_3299805_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_164530717.1|3299906_3302780_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_164530718.1|3302783_3304427_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	40.9	7.1e-86
WP_055647235.1|3304416_3306051_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	41.9	2.9e-79
WP_164530719.1|3306097_3306865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082389613.1|3306867_3309615_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.5	8.8e-182
WP_164530720.1|3309705_3310638_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000284112.1|3310959_3311259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196208.1|3311346_3312252_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	25.6	8.1e-07
WP_000182836.1|3312634_3312892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116661.1|3312890_3313340_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_001883756.1|3313347_3313617_+	hypothetical protein	NA	A0A218MNF2	uncultured_virus	76.3	9.3e-28
WP_001043260.1|3316045_3316861_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3316921_3317725_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3317724_3318561_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|3318532_3319072_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3319183_3319489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3319516_3320731_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3320953_3321838_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|3321868_3323362_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000985631.1|3323779_3326758_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP047350	Proteus cibarius strain ZN2 plasmid pZN2-tetX-171kb, complete sequence	171208	28313	67352	171208	transposase	Escherichia_phage(36.36%)	38	NA	NA
WP_000792636.1|28313_28847_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210551.1|29020_29149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210549.1|29818_30160_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|30196_30901_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|31083_31899_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000019441.1|32052_33033_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_001067855.1|33217_33922_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_164526951.1|34154_35015_+	aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000587837.1|35027_35570_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|36051_36243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526952.1|36266_36494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|36544_37681_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|37647_37797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|37795_39166_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|39307_39433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|39986_40847_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|41261_42098_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|42097_42901_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_140114247.1|43086_46068_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.3	1.7e-32
WP_001120888.1|46485_47979_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_079879887.1|48009_48234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086371372.1|48324_48837_+	dihydrofolate reductase	NA	U5J9P6	Bacillus_phage	42.9	9.4e-29
WP_072161421.1|49328_50297_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_084929516.1|50637_51510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526953.1|51970_53470_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_082987283.1|53500_53746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502095.1|54040_54418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064754130.1|54414_55578_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_164526954.1|55595_56456_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001120888.1|57100_58594_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094315248.1|59191_60814_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	9.9e-32
WP_164526955.1|61399_62128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094315246.1|62072_62402_+	GrpB family protein	NA	NA	NA	NA	NA
WP_164526953.1|62657_64157_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_164526956.1|64187_64931_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|65153_66368_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|66395_66701_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120891.1|66812_67352_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
