The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	1071143	1081980	4310124		Mycobacterium_phage(25.0%)	12	NA	NA
WP_164526021.1|1071143_1072343_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	4.2e-27
WP_164526022.1|1072964_1073933_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	4.4e-136
WP_072070257.1|1073957_1076084_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.9	3.2e-203
WP_072070256.1|1076089_1076509_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	35.3	1.0e-09
WP_072070255.1|1076520_1076745_-	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	47.1	2.0e-12
WP_072070254.1|1077028_1077502_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_023581133.1|1077699_1077909_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_072070253.1|1078042_1078417_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.0	1.9e-23
WP_036938585.1|1078430_1079396_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_072070252.1|1079497_1080142_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036912266.1|1080304_1080568_-	YbeD family protein	NA	NA	NA	NA	NA
WP_072070251.1|1080768_1081980_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	50.7	7.3e-104
>prophage 2
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	1445147	1489601	4310124	holin,integrase,head,tail,portal,capsid,terminase,protease,lysis	Proteus_phage(25.53%)	61	1436595:1436609	1454941:1454955
1436595:1436609	attL	CAGCACTATTAAAAA	NA	NA	NA	NA
WP_164526096.1|1445147_1445561_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	41.0	8.4e-20
WP_164526097.1|1445607_1445793_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	52.5	1.4e-11
WP_164526098.1|1445902_1446064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526099.1|1447599_1448253_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	76.4	1.0e-96
WP_164526100.1|1448362_1448593_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	89.0	1.2e-28
WP_164526101.1|1448953_1449613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526102.1|1449612_1450038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526103.1|1450027_1450876_-	AAA family ATPase	NA	E9LUK9	Lactobacillus_phage	33.5	8.0e-25
WP_164526104.1|1450956_1452132_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.2	3.0e-30
WP_164526105.1|1452133_1452346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526106.1|1452406_1452799_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	53.7	5.7e-26
WP_164526107.1|1452801_1453464_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	45.5	3.1e-40
WP_164526108.1|1453465_1453921_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.0	2.5e-25
WP_164526109.1|1453929_1454427_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	60.6	9.4e-50
WP_164526110.1|1454485_1455313_-	YfdQ family protein	NA	U5P439	Shigella_phage	54.0	1.6e-78
1454941:1454955	attR	TTTTTAATAGTGCTG	NA	NA	NA	NA
WP_006533955.1|1455378_1455753_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	4.6e-41
WP_161770161.1|1456157_1456586_+	hypothetical protein	NA	U5P096	Shigella_phage	33.8	1.8e-17
WP_164526111.1|1456942_1457632_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	57.8	1.1e-69
WP_069368310.1|1457729_1457945_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	45.1	2.2e-08
WP_164526112.1|1458001_1458460_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	1.0e-26
WP_164526113.1|1458548_1458758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099660103.1|1458747_1458927_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	6.2e-12
WP_164526114.1|1458936_1460058_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	54.9	1.3e-46
WP_164526115.1|1460054_1460714_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	66.7	1.8e-85
WP_164526116.1|1460665_1461082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526117.1|1461081_1461246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526908.1|1461310_1461958_+	site-specific DNA-methyltransferase	NA	A0A2I7QM56	Vibrio_phage	67.3	1.9e-82
WP_109373182.1|1462024_1462408_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	54.5	1.3e-27
WP_164526118.1|1462426_1463134_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.2	8.7e-57
WP_164526119.1|1463133_1464159_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	2.2e-85
WP_164526120.1|1464186_1464858_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	48.6	1.1e-50
WP_115370633.1|1464959_1465208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109373189.1|1465536_1465926_+	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.9	2.7e-12
WP_109373190.1|1465922_1466222_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	32.9	2.2e-06
WP_109373191.1|1466199_1466619_+	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.5	1.5e-24
WP_109373192.1|1466615_1467068_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	31.8	7.3e-09
WP_164526121.1|1467937_1468303_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	75.6	9.6e-44
WP_164526122.1|1468367_1468715_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	97.3	5.7e-62
WP_164526123.1|1468714_1469116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526124.1|1469265_1469739_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	95.5	5.2e-82
WP_164526125.1|1469742_1471476_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.3	0.0e+00
WP_164526126.1|1471475_1472807_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	99.3	1.0e-255
WP_164526127.1|1472811_1473663_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	99.3	2.3e-152
WP_164526128.1|1473674_1474889_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.5	5.6e-221
WP_164526129.1|1474932_1475157_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	98.0	2.9e-19
WP_069368412.1|1475156_1475483_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	95.4	2.7e-53
WP_069368413.1|1475491_1475821_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	33.9	1.6e-05
WP_069368414.1|1475810_1476284_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.7	5.7e-12
WP_164526130.1|1476288_1476630_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_069368416.1|1476639_1477314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069368417.1|1477348_1477762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072063870.1|1477758_1478037_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_164526131.1|1478080_1481365_+|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	32.3	6.9e-40
WP_156733248.1|1481365_1481962_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	50.3	7.8e-51
WP_156733249.1|1481961_1482543_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	2.0e-51
WP_156733250.1|1482601_1483429_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	37.1	4.0e-05
WP_156733251.1|1483449_1483848_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	49.2	1.1e-32
WP_164526132.1|1483847_1486787_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	52.0	1.7e-202
WP_164526133.1|1486790_1487822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526134.1|1487857_1489288_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	65.5	4.6e-150
WP_164526135.1|1489367_1489601_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.7	5.0e-30
>prophage 3
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	1593098	1632662	4310124	integrase,head,tail,tRNA,portal,capsid,terminase,protease,lysis	Morganella_phage(24.14%)	48	1596883:1596905	1638032:1638054
WP_164526156.1|1593098_1594202_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_164526157.1|1594311_1594761_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_072069873.1|1594753_1595383_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_006537208.1|1595521_1596775_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
1596883:1596905	attL	AAACTCTTCCCCAAAACTGTTCA	NA	NA	NA	NA
WP_164526158.1|1596906_1598040_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.0	1.9e-154
WP_017628380.1|1598014_1598266_-	excisionase	NA	NA	NA	NA	NA
WP_135052057.1|1598352_1598877_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	60.8	1.5e-53
WP_017628378.1|1599155_1599788_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|1599888_1600095_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_036976726.1|1600132_1600609_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	3.0e-45
WP_164526159.1|1600870_1601050_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	53.4	6.4e-09
WP_006537200.1|1601607_1602123_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_164526160.1|1602144_1602951_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	61.7	1.3e-88
WP_164526161.1|1602947_1603973_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.5	1.1e-84
WP_164526162.1|1604000_1604399_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	3.5e-31
WP_004244726.1|1604739_1604952_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_164526163.1|1605283_1605742_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_164526164.1|1606028_1607141_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_164526165.1|1607907_1609236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526166.1|1609434_1610193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526167.1|1610744_1611167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026090477.1|1611232_1611502_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.3	4.6e-19
WP_164526168.1|1611501_1611972_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	2.3e-50
WP_017628365.1|1611953_1612112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036976737.1|1612114_1612576_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	51.2	1.1e-23
WP_036937625.1|1612848_1613052_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_164526169.1|1613879_1614464_+	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	44.3	5.3e-20
WP_108716960.1|1614460_1614670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526170.1|1614701_1615109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526171.1|1615105_1615444_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.2e-40
WP_006537822.1|1615562_1616030_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_164526172.1|1615983_1617717_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	6.9e-148
WP_164526173.1|1617716_1618985_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	1.3e-201
WP_164526174.1|1619002_1619671_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	64.8	4.3e-82
WP_087802799.1|1619674_1620841_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.3e-169
WP_164526175.1|1620879_1621179_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	62.2	1.1e-32
WP_087802803.1|1621178_1621508_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_087802806.1|1621497_1621971_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.5	1.3e-11
WP_087802809.1|1621976_1622318_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1622327_1622993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526176.1|1623057_1623474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|1623470_1623749_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1623773_1623965_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_164526177.1|1624091_1627367_+|tail	phage tail tape measure protein	tail	A0A2I2L6P9	Escherichia_phage	28.1	2.7e-44
WP_164526178.1|1627367_1627964_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	7.1e-52
WP_036937593.1|1627963_1628545_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	9.0e-52
WP_164526179.1|1628601_1629000_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.0	1.2e-31
WP_164526180.1|1628999_1632662_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	50.7	4.0e-198
1638032:1638054	attR	AAACTCTTCCCCAAAACTGTTCA	NA	NA	NA	NA
>prophage 4
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	1697588	1712402	4310124	tRNA	Tupanvirus(45.45%)	14	NA	NA
WP_164526205.1|1697588_1698284_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.5	2.1e-07
WP_164526206.1|1698357_1698588_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	1.8e-32
WP_072070370.1|1698866_1700795_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	2.3e-128
WP_036937410.1|1700798_1701338_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_004263702.1|1701431_1701629_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_036937406.1|1701670_1702027_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_072070368.1|1702354_1703338_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_072070366.1|1703352_1705740_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	4.6e-09
WP_036937394.1|1705744_1706041_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_164526207.1|1706402_1707410_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_072070363.1|1707411_1708158_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L407	Tupanvirus	26.6	5.4e-09
WP_072070361.1|1708293_1709439_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.0	1.3e-38
WP_115349627.1|1709439_1710420_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.8	4.3e-38
WP_072070358.1|1710419_1712402_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
>prophage 5
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	1823914	1877661	4310124	holin,integrase,tail,terminase,head	Morganella_phage(24.14%)	80	1822699:1822716	1844698:1844715
1822699:1822716	attL	ATTGATGAAGTTGGTGTG	NA	NA	NA	NA
WP_072068002.1|1823914_1826512_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.6	9.8e-90
WP_164526228.1|1826668_1827193_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	49.1	1.9e-37
WP_072068003.1|1827431_1828406_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_164526229.1|1828466_1829297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526230.1|1829392_1830439_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	36.8	2.8e-59
WP_164526231.1|1830342_1830651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526232.1|1831063_1831666_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.6	2.1e-59
WP_164526233.1|1831652_1831979_-	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	42.0	1.0e-12
WP_164484702.1|1831971_1832145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526234.1|1832234_1833287_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R801	Vibrio_phage	48.5	1.2e-97
WP_109409539.1|1833359_1833641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526235.1|1833633_1833864_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	65.1	1.2e-20
WP_123822255.1|1833863_1834151_-	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	43.2	7.4e-15
WP_164526236.1|1834150_1834453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526237.1|1834496_1834673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526238.1|1834703_1835117_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	76.8	1.7e-52
WP_164526239.1|1835106_1835805_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.0	4.5e-74
WP_164526240.1|1835801_1836686_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.5	5.0e-94
WP_164526241.1|1836682_1836934_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	1.2e-37
WP_164526242.1|1837061_1837244_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	83.3	4.8e-20
WP_164526243.1|1837321_1837636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526244.1|1837639_1837843_-	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	52.2	1.3e-05
WP_164526245.1|1837872_1838112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526246.1|1838171_1838414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526247.1|1838467_1838773_-	hypothetical protein	NA	A0A2I7R1U5	Vibrio_phage	37.8	1.4e-08
WP_164526248.1|1838775_1839096_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.2e-19
WP_164526249.1|1839544_1839946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526250.1|1839947_1840508_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_164526251.1|1840982_1841627_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	63.1	8.1e-78
WP_161769910.1|1841732_1841942_+	helix-turn-helix domain-containing protein	NA	K7PKH4	Enterobacteria_phage	81.8	5.7e-25
WP_036935825.1|1842105_1842447_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	92.8	2.1e-48
WP_164526252.1|1842542_1843256_+	GIY-YIG nuclease family protein	NA	A0A088F856	Sulfitobacter_phage	52.0	1.9e-11
WP_164526253.1|1843233_1844070_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	53.0	1.5e-71
WP_164526254.1|1844073_1844928_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.0	1.7e-86
1844698:1844715	attR	ATTGATGAAGTTGGTGTG	NA	NA	NA	NA
WP_164526255.1|1844947_1845274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526256.1|1845273_1845504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526257.1|1845500_1845857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526258.1|1846016_1846460_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	90.5	9.3e-33
WP_164526259.1|1846452_1846665_+	hypothetical protein	NA	L0AQP4	Klebsiella_phage	77.3	6.0e-22
WP_164525799.1|1846657_1846975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526260.1|1846977_1847409_+	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	94.4	2.1e-69
WP_164526261.1|1847405_1848068_+	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	60.9	6.2e-73
WP_063108505.1|1848179_1848470_+	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	80.0	4.3e-39
WP_164526262.1|1848466_1848832_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	63.2	3.9e-37
WP_164526263.1|1849009_1849510_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	98.8	7.6e-92
WP_164526264.1|1849833_1850169_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	31.5	8.1e-05
WP_164526265.1|1850165_1850498_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	68.3	3.7e-34
WP_164526912.1|1850499_1850916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526266.1|1850803_1851061_+	peptidase	NA	Q8SBD8	Shigella_phage	45.2	1.2e-11
WP_164526267.1|1851660_1851906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526268.1|1851974_1852220_+	DUF2560 family protein	NA	NA	NA	NA	NA
WP_164526269.1|1852277_1852880_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	76.8	5.1e-74
WP_164526270.1|1852882_1854367_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	87.7	2.3e-269
WP_164526271.1|1854368_1855751_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	81.1	1.6e-219
WP_164526272.1|1855753_1856815_+|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	76.5	7.2e-156
WP_036935878.1|1856881_1857571_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	77.2	3.1e-67
WP_036935881.1|1857576_1858527_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	86.2	7.3e-152
WP_036935883.1|1858570_1858948_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	72.8	3.7e-46
WP_052038475.1|1858949_1859291_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	82.3	1.1e-52
WP_036935884.1|1859293_1859662_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	84.4	2.6e-52
WP_159242355.1|1859658_1860030_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	8.6e-48
WP_159242354.1|1860094_1860850_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.9	6.3e-106
WP_164526273.1|1860899_1861592_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.1	9.9e-90
WP_164526274.1|1861634_1862006_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	63.7	4.9e-35
WP_109372780.1|1862011_1862191_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	81.4	1.7e-22
WP_161706892.1|1862521_1864063_+	DNA repair protein	NA	NA	NA	NA	NA
WP_164526913.1|1864200_1864539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526275.1|1864644_1865079_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	56.2	9.1e-25
WP_164526914.1|1865207_1865384_+	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	69.2	1.4e-13
WP_164526276.1|1865424_1865997_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	73.5	1.7e-42
WP_036895024.1|1866072_1866852_+	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	46.4	1.1e-47
WP_164526277.1|1866974_1867694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526278.1|1867757_1871150_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	40.7	8.4e-158
WP_164526279.1|1871278_1871779_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.1	5.4e-21
WP_164526280.1|1871872_1872349_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	72.3	5.6e-60
WP_164526281.1|1872348_1872819_+	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	3.4e-41
WP_164526282.1|1872815_1873208_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	59.5	2.5e-45
WP_164526283.1|1873194_1875663_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	51.9	1.5e-252
WP_164526284.1|1875720_1877334_+|tail	tail fiber domain-containing protein	tail	F1C5A8	Cronobacter_phage	65.4	2.0e-48
WP_164526285.1|1877430_1877661_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	96.1	2.2e-33
>prophage 6
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	2043347	2053394	4310124		Escherichia_phage(66.67%)	9	NA	NA
WP_164526338.1|2043347_2045786_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.2	1.5e-217
WP_023582154.1|2045797_2046415_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	1.7e-72
WP_164526339.1|2046416_2047274_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.7	9.9e-23
WP_164526340.1|2047448_2048060_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	40.6	2.4e-31
WP_072068138.1|2048161_2048623_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	34.1	8.5e-13
WP_164526341.1|2048622_2049309_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_115349781.1|2049535_2049619_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_164526342.1|2049621_2051325_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_072068141.1|2051336_2053394_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.7	4.3e-32
>prophage 7
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	2356964	2408883	4310124	integrase,tail,holin,terminase	Salmonella_phage(16.67%)	65	2396677:2396692	2405828:2405843
WP_102138713.1|2356964_2357558_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_089110956.1|2357579_2357975_+	S-adenosylhomocysteine hydrolase	NA	NA	NA	NA	NA
WP_004393990.1|2358080_2358689_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102138714.1|2358685_2359837_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_089110954.1|2359833_2361039_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014611607.1|2361040_2361751_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_102138715.1|2364260_2365037_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004394002.1|2365047_2365221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102138716.1|2365479_2366667_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	55.5	2.2e-121
WP_115349911.1|2367091_2367586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115349912.1|2367585_2367930_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	84.3	2.0e-43
WP_104836483.1|2367932_2368205_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	37.8	3.2e-12
WP_020945795.1|2368201_2368573_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_164526411.1|2368794_2369943_+	acyltransferase	NA	NA	NA	NA	NA
WP_164526412.1|2370026_2372393_-	hypothetical protein	NA	A0A193GYU1	Enterobacter_phage	51.7	6.8e-90
WP_004243332.1|2372566_2372818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526413.1|2372842_2373142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526414.1|2373152_2376530_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.1	4.7e-185
WP_164526415.1|2376529_2379316_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.4	2.8e-119
WP_004243338.1|2379318_2379867_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_164526416.1|2379866_2380355_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.2	6.0e-49
WP_164526417.1|2380338_2382801_-	hypothetical protein	NA	Q858G3	Salmonella_phage	69.9	0.0e+00
WP_164526418.1|2382800_2383406_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.2	1.5e-65
WP_164526419.1|2383457_2383799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555916.1|2383807_2384239_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_004243350.1|2384297_2385278_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_087726489.1|2385293_2385971_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	4.0e-43
WP_164526420.1|2385988_2386303_-	hypothetical protein	NA	Q2A090	Sodalis_phage	44.2	2.6e-13
WP_164526421.1|2386299_2387964_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.6	1.8e-198
WP_115370894.1|2387973_2388183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526422.1|2388368_2389853_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.4	1.5e-228
WP_164526423.1|2389852_2390422_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	48.1	1.5e-43
WP_164526424.1|2390465_2391116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526425.1|2391144_2391486_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.0	5.1e-31
WP_069368909.1|2391545_2391893_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_164526426.1|2391892_2392123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526427.1|2392109_2392412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526428.1|2392411_2392672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526429.1|2392682_2392856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049203709.1|2392982_2393378_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_161748129.1|2393374_2393788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|2394034_2394760_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_164526430.1|2394759_2395602_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.1	2.5e-50
WP_004243371.1|2395612_2395798_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_064505757.1|2395937_2396216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|2396293_2396902_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
2396677:2396692	attL	TAACCGCATTATCAAT	NA	NA	NA	NA
WP_004243375.1|2397150_2397312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526431.1|2397298_2399020_+	DNA breaking-rejoining protein	NA	K7P6V4	Enterobacteria_phage	49.3	2.0e-107
WP_069368900.1|2399065_2400106_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.7	4.2e-100
WP_069368899.1|2400150_2400408_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	35.2	4.7e-05
WP_164526237.1|2400438_2400615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526432.1|2400651_2400831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526433.1|2400840_2401062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526434.1|2401036_2401261_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	75.3	1.3e-27
WP_164526435.1|2401253_2401415_+	hypothetical protein	NA	A0A1P8DTH4	Proteus_phage	78.0	1.8e-10
WP_164526234.1|2401483_2402536_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R801	Vibrio_phage	48.5	1.2e-97
WP_164484702.1|2402625_2402799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526436.1|2402791_2403127_+	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	41.1	2.3e-12
WP_164526437.1|2403104_2403287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526438.1|2403315_2403945_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.6	2.0e-65
WP_164526439.1|2403947_2404145_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	64.5	1.7e-18
WP_020945830.1|2404144_2404333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526440.1|2404340_2405537_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	62.2	5.6e-141
WP_164526441.1|2405755_2407333_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2405828:2405843	attR	ATTGATAATGCGGTTA	NA	NA	NA	NA
WP_072068398.1|2407416_2408883_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	2.3e-88
>prophage 8
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	2610613	2617271	4310124	lysis,holin	Enterobacteria_phage(33.33%)	9	NA	NA
WP_072068573.1|2610613_2611156_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.3	2.2e-20
WP_072068574.1|2611855_2612035_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_072068575.1|2612411_2613329_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164526469.1|2613370_2613787_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_164526470.1|2613925_2614381_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	31.1	1.9e-09
WP_164526471.1|2614377_2614782_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	51.7	1.0e-25
WP_072068579.1|2614774_2615083_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	53.5	2.0e-26
WP_072068580.1|2615468_2616284_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	44.1	1.9e-55
WP_164526472.1|2616533_2617271_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	45.9	4.8e-58
>prophage 9
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	3084676	3271922	4310124	plate,holin,integrase,head,tail,portal,terminase,protease,lysis	Enterobacteria_phage(17.48%)	214	3223005:3223060	3270772:3270827
WP_072069332.1|3084676_3086014_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_072069333.1|3086010_3086679_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_072069334.1|3086657_3088397_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023583757.1|3088419_3088911_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_164526566.1|3089274_3091941_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	5.9e-90
WP_164526567.1|3091983_3092502_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_164526568.1|3092492_3093011_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_164526569.1|3093001_3095524_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_164526570.1|3095608_3098008_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	3.6e-14
WP_164526571.1|3098000_3098783_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164526572.1|3098831_3099089_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_164526573.1|3099139_3099664_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_164526574.1|3099648_3100200_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_072071149.1|3100184_3100730_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_072071150.1|3100714_3103069_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_072071151.1|3103128_3104262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526575.1|3104248_3107605_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_115350726.1|3107650_3109270_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_072070787.1|3111036_3112134_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_082151846.1|3112108_3112672_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072070789.1|3112674_3113103_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_164526576.1|3113193_3114570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526577.1|3114639_3115218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072070825.1|3115625_3116357_+	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	33.1	1.4e-06
WP_072070791.1|3116506_3116800_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164526578.1|3117251_3117779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072070793.1|3118315_3119470_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	26.8	2.6e-34
WP_115350733.1|3119513_3120929_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036939804.1|3121904_3122423_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_164526930.1|3122524_3124645_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_072070796.1|3124654_3125659_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_164526579.1|3125673_3130200_+	DUF4150 domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.5	5.2e-22
WP_115350738.1|3130199_3130895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526580.1|3131739_3132447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072070801.1|3133506_3133824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082151851.1|3134071_3134458_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_072070803.1|3135204_3135702_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_072070804.1|3135722_3137201_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_072070805.1|3137206_3137644_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_164526581.1|3137645_3139430_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_115350744.1|3139393_3140443_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_072070808.1|3140448_3141690_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_072070809.1|3141691_3142246_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072070810.1|3142248_3143610_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_072070811.1|3143602_3144358_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_164526582.1|3144367_3147004_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.1	7.4e-85
WP_164526583.1|3147000_3147798_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_164526584.1|3147794_3148445_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_164526585.1|3148450_3149911_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_164526586.1|3149913_3153465_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_164526587.1|3153504_3154836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526588.1|3154895_3156632_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_072070819.1|3157200_3157509_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154632030.1|3158093_3158543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526589.1|3158608_3159097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526590.1|3159247_3159721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526591.1|3159725_3159902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526592.1|3159898_3160606_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	24.5	3.9e-09
WP_164526593.1|3160817_3161654_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.0	2.9e-43
WP_164526594.1|3161667_3162093_-	antirestriction protein	NA	NA	NA	NA	NA
WP_164526595.1|3162184_3163057_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_164526596.1|3163118_3164057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526597.1|3164484_3165072_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_036968140.1|3165177_3165387_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_036968137.1|3165748_3166189_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.7	8.3e-42
WP_164526598.1|3166199_3167489_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.0	1.0e-172
WP_164526599.1|3167544_3169296_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_164526600.1|3169309_3169675_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_164526601.1|3169722_3170058_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	58.5	8.1e-21
WP_107678460.1|3170323_3171502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526602.1|3171491_3172001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107678462.1|3172000_3173968_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_164526603.1|3174013_3175195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526604.1|3175230_3176898_-	ATP-dependent helicase	NA	A0A1V0SAV1	Catovirus	26.2	5.6e-14
WP_164526605.1|3176894_3178799_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_115350786.1|3179051_3180260_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	1.1e-133
WP_099659261.1|3180666_3181893_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	1.5e-35
WP_099659260.1|3182274_3183831_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_164526606.1|3184371_3185796_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	66.7	3.2e-151
WP_164526607.1|3185819_3189803_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	52.7	2.3e-279
WP_164526932.1|3189817_3190402_-|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	48.0	1.5e-43
WP_164526931.1|3190371_3191100_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.1	2.3e-89
WP_164526608.1|3191121_3191826_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.9	1.7e-68
WP_152964573.1|3191872_3192166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526609.1|3192186_3192516_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	52.3	2.8e-26
WP_164526610.1|3192516_3195534_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	30.8	4.8e-96
WP_162556621.1|3195502_3195814_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	41.3	4.7e-15
WP_164526611.1|3195843_3196233_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	37.2	2.2e-14
WP_164526612.1|3196244_3196766_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	4.9e-65
WP_164526933.1|3196777_3197173_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	60.3	2.6e-42
WP_164526613.1|3197172_3197736_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	2.1e-50
WP_164526614.1|3197745_3198018_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	44.9	2.4e-15
WP_164526615.1|3198029_3198371_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	49.1	7.7e-19
WP_164526616.1|3198459_3200448_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	65.0	5.9e-252
WP_164526617.1|3200413_3201904_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	65.6	8.7e-192
WP_072062679.1|3201900_3202116_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_164526618.1|3202112_3204218_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	71.5	4.4e-290
WP_072069170.1|3204217_3204718_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	56.4	2.1e-41
WP_164526619.1|3204978_3205119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082151788.1|3205138_3205360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141650201.1|3205370_3205748_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	61.2	3.0e-32
WP_115351037.1|3206639_3207014_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	44.7	4.8e-14
WP_075673907.1|3207084_3207663_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	66.7	1.5e-70
WP_036934635.1|3207862_3208282_-	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.4	5.7e-24
WP_115350922.1|3208274_3208592_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	60.0	1.3e-31
WP_115350921.1|3208829_3209078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115350920.1|3209149_3209359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064720843.1|3209464_3209662_-	hypothetical protein	NA	A0A1W6JNU4	Morganella_phage	45.6	7.1e-09
WP_064720844.1|3209871_3211038_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.6	8.6e-86
WP_075673909.1|3211278_3211662_-	antitermination protein	NA	A0A088CD47	Shigella_phage	72.2	4.2e-50
WP_164526620.1|3211661_3212636_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	54.8	1.7e-103
WP_164526621.1|3212632_3214198_-	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	68.7	3.3e-218
WP_072065067.1|3214480_3214729_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	4.0e-17
WP_072065068.1|3214721_3214946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072065069.1|3215041_3215749_+	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	60.9	1.1e-75
WP_072065070.1|3215783_3216125_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	63.7	7.4e-38
WP_072065072.1|3216498_3217077_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_072065073.1|3217073_3217529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072065074.1|3217739_3217946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072065075.1|3217948_3218158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526622.1|3218138_3218315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526623.1|3218304_3218706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526624.1|3218705_3219005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526625.1|3219001_3219424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526626.1|3219498_3219852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052038446.1|3219838_3220045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526627.1|3220041_3220524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526934.1|3220767_3221235_+	hypothetical protein	NA	A0A286S260	Klebsiella_phage	48.5	1.7e-29
WP_164526628.1|3221234_3221816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036934676.1|3221828_3222437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526629.1|3222436_3222754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072070108.1|3222750_3222939_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
3223005:3223060	attL	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_164526630.1|3223249_3223480_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	4.8e-33
WP_164526631.1|3223480_3223900_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_164525800.1|3223902_3225429_-	hypothetical protein	NA	K4I0L0	Acinetobacter_phage	31.9	3.1e-19
WP_049206561.1|3225436_3226069_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	49.0	4.3e-47
WP_164526632.1|3226068_3227259_-	hypothetical protein	NA	E2GM17	Acinetobacter_phage	40.7	1.5e-77
WP_049206563.1|3227255_3227609_-	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	52.1	9.4e-28
WP_164526633.1|3227610_3228303_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	40.2	1.3e-28
WP_164526634.1|3228283_3229174_-	hypothetical protein	NA	E2GM20	Acinetobacter_phage	41.7	3.1e-59
WP_129037583.1|3229160_3229436_-	hypothetical protein	NA	A0A220NQH5	Acinetobacter_phage	45.7	1.7e-16
WP_164526635.1|3229436_3230144_-	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	53.9	2.4e-46
WP_161769612.1|3230219_3230654_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	46.2	3.5e-32
WP_164526636.1|3230663_3231212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526637.1|3231622_3232435_-	hypothetical protein	NA	P79672	Haemophilus_phage	30.3	7.2e-15
WP_164526638.1|3232499_3234842_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	46.1	1.7e-173
WP_129037597.1|3235095_3235506_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	40.7	1.9e-19
WP_129037599.1|3235505_3235952_-	hypothetical protein	NA	A0A1V0DZ74	Acinetobacter_phage	51.0	9.7e-38
WP_164526639.1|3235964_3237422_-	DUF3383 domain-containing protein	NA	E2GLU1	Acinetobacter_phage	38.4	1.2e-84
WP_164526640.1|3237433_3237919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526935.1|3237906_3238284_-	hypothetical protein	NA	K4I3A0	Acinetobacter_phage	42.6	2.0e-23
WP_161769605.1|3238273_3238732_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	57.6	2.7e-35
WP_161769604.1|3238724_3239129_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_161769624.1|3239131_3239335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526641.1|3239459_3240485_-	DUF2184 domain-containing protein	NA	A0A077KC85	Edwardsiella_phage	37.5	3.1e-63
WP_161769602.1|3240484_3240973_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	47.8	2.9e-35
WP_164526642.1|3240975_3242136_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	36.4	1.5e-58
WP_164526936.1|3242185_3242899_-|head	phage head morphogenesis protein	head	A0A2R3UAK2	Myoviridae_environmental_samples	41.8	2.6e-40
WP_164526643.1|3242957_3244376_-	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	37.8	1.2e-76
WP_164526644.1|3244372_3245716_-|terminase	PBSX family phage terminase large subunit	terminase	A0A191ZDJ9	Acinetobacter_phage	65.1	1.0e-167
WP_164526645.1|3245708_3246233_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.7	9.3e-56
WP_164526646.1|3246266_3246425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526647.1|3246424_3246937_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	62.9	1.6e-57
WP_164526648.1|3247416_3247581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526938.1|3247577_3247805_-	peptidase	NA	Q8SBD8	Shigella_phage	47.9	1.3e-11
WP_164526937.1|3247722_3248139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526265.1|3248140_3248473_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	68.3	3.7e-34
WP_164526264.1|3248469_3248805_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	31.5	8.1e-05
WP_164526263.1|3249128_3249629_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	98.8	7.6e-92
WP_164526262.1|3249806_3250172_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	63.2	3.9e-37
WP_063108505.1|3250168_3250459_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	80.0	4.3e-39
WP_164526261.1|3250570_3251233_-	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	60.9	6.2e-73
WP_164526260.1|3251229_3251661_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	94.4	2.1e-69
WP_164525799.1|3251663_3251981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526259.1|3251973_3252186_-	hypothetical protein	NA	L0AQP4	Klebsiella_phage	77.3	6.0e-22
WP_164526649.1|3252178_3252622_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	90.5	9.3e-33
WP_164526650.1|3252623_3252833_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	100.0	1.4e-31
WP_164526651.1|3252825_3253083_-	hypothetical protein	NA	A0A1P8DTF4	Proteus_phage	94.0	2.0e-43
WP_164526652.1|3253072_3253246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526653.1|3253242_3253470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526654.1|3253466_3253661_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_164526655.1|3253849_3254524_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	96.9	1.2e-121
WP_164526656.1|3255422_3256106_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	94.3	2.0e-114
WP_063073726.1|3256127_3256460_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_072063072.1|3256602_3256821_-	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	66.7	6.4e-19
WP_164526657.1|3256927_3257647_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	53.4	9.1e-62
WP_164526939.1|3258367_3258673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526658.1|3258687_3258840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526659.1|3258836_3259019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526660.1|3259134_3259350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526661.1|3259624_3259900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164525801.1|3259929_3260193_+	hypothetical protein	NA	A0A2H4JA69	uncultured_Caudovirales_phage	44.6	2.2e-05
WP_164526662.1|3260194_3260494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526663.1|3260574_3261000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526664.1|3261021_3261963_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	2.3e-20
WP_164526665.1|3262228_3262495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526940.1|3262509_3262962_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	73.8	1.6e-64
WP_164526666.1|3262961_3263183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526667.1|3263179_3264106_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.2	2.0e-109
WP_164526239.1|3264102_3264801_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.0	4.5e-74
WP_164526238.1|3264790_3265204_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	76.8	1.7e-52
WP_164526668.1|3265234_3265573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526669.1|3265608_3265902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526670.1|3265926_3266106_+	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	57.1	5.8e-10
WP_164526433.1|3266115_3266337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526434.1|3266311_3266536_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	75.3	1.3e-27
WP_164526435.1|3266528_3266690_+	hypothetical protein	NA	A0A1P8DTH4	Proteus_phage	78.0	1.8e-10
WP_164526234.1|3266758_3267811_+	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7R801	Vibrio_phage	48.5	1.2e-97
WP_164484702.1|3267900_3268074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164526233.1|3268066_3268393_+	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	42.0	1.0e-12
WP_164526232.1|3268379_3268982_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.6	2.1e-59
WP_164526671.1|3269394_3269727_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164526672.1|3269603_3270767_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	75.7	5.6e-178
WP_072070109.1|3271049_3271922_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.1	1.8e-32
3270772:3270827	attR	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 10
NZ_CP047344	Proteus vulgaris strain ZN3 chromosome, complete genome	4310124	4209579	4260453	4310124	integrase,transposase,tRNA	Virus_Rctr41k(20.0%)	41	4239199:4239213	4262326:4262340
WP_072068962.1|4209579_4210608_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_072068963.1|4210683_4211358_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_072068964.1|4211466_4212090_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.0	4.2e-63
WP_164526881.1|4212462_4214421_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.5	7.4e-90
WP_072068966.1|4214579_4214891_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_164526882.1|4214887_4216543_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_072068968.1|4216950_4218534_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_072071098.1|4224776_4225463_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072071097.1|4225545_4226940_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_072071096.1|4227011_4227944_-	ribokinase	NA	NA	NA	NA	NA
WP_115351347.1|4228224_4229724_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	36.1	1.2e-20
WP_164526883.1|4229731_4231189_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_072071093.1|4231189_4232182_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.8	2.0e-51
WP_069367404.1|4232341_4232803_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_072071092.1|4232903_4233344_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_072071091.1|4233721_4235620_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_164526884.1|4235616_4236243_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_115351345.1|4236856_4237234_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_072071088.1|4237265_4238090_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|4238135_4238375_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_072071087.1|4238436_4238907_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_072071086.1|4238919_4239453_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
4239199:4239213	attL	AGCCAATTTATTCAA	NA	NA	NA	NA
WP_072071085.1|4239467_4241009_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_036933511.1|4241067_4241931_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_023583323.1|4241965_4243348_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_006534340.1|4243369_4243786_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_072071084.1|4243938_4245312_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	1.8e-29
WP_164526885.1|4245471_4247298_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.9	1.6e-131
WP_001029679.1|4247456_4248278_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|4248264_4250373_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4250369_4252037_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|4252039_4253566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|4253566_4255183_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|4255413_4255791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4256200_4256572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|4256632_4257130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|4257205_4257994_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|4258051_4258576_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|4258670_4259144_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|4259475_4260012_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|4260126_4260453_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
4262326:4262340	attR	AGCCAATTTATTCAA	NA	NA	NA	NA
>prophage 1
NZ_CP047346	Proteus vulgaris strain ZN3 plasmid pZN3-cfr-121kb, complete sequence	121294	15524	55572	121294	transposase,integrase	Escherichia_phage(28.57%)	45	28889:28902	33080:33093
WP_164526960.1|15524_15686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_125894549.1|15793_16114_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_125894551.1|16655_17819_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_125894553.1|18147_19158_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.3e-183
WP_164526961.1|19350_20274_-|transposase	IS5-like element ISSpu20 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	84.9	8.7e-150
WP_014611607.1|21482_22193_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
WP_089110954.1|22194_23400_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_102138714.1|23396_24548_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|24544_25153_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125894560.1|25617_26568_+|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	81.6	1.6e-151
WP_125894574.1|26858_27380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526962.1|27577_27754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125894564.1|27737_28487_-	signal peptidase I	NA	NA	NA	NA	NA
28889:28902	attL	AATATCAATTATAT	NA	NA	NA	NA
WP_164526963.1|28979_29987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125894568.1|30007_30667_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_164526964.1|30835_31651_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.3	3.8e-24
WP_048607643.1|32194_32992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547955.1|33356_33500_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
33080:33093	attR	ATATAATTGATATT	NA	NA	NA	NA
WP_096864991.1|33585_33966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023159957.1|33996_34329_-	endoribonuclease MazF	NA	A0A1S5SEX8	Streptococcus_phage	32.4	5.6e-06
WP_096864992.1|34328_34574_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109910889.1|34843_35467_+	AAA family ATPase	NA	D4HTX7	Vibrio_phage	35.4	1.6e-22
WP_096864993.1|35567_35795_+	DNA partition complex ParG	NA	NA	NA	NA	NA
WP_109910890.1|35892_36261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910891.1|36610_37003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048821775.1|37012_37435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023159966.1|37427_37772_-	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	39.3	3.6e-08
WP_072070749.1|37774_38821_-	ParB/RepB/Spo0J family partition protein	NA	D5LGX9	Escherichia_phage	31.8	1.0e-29
WP_109910892.1|39172_40183_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	63.9	9.9e-123
WP_024008861.1|40823_41675_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.1	1.5e-50
WP_024008860.1|41685_43173_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	77.3	5.2e-213
WP_094963231.1|43528_44734_-	MFS transporter	NA	NA	NA	NA	NA
WP_164526965.1|44792_44984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526966.1|44969_45647_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|45624_46248_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|46329_47535_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000429836.1|48811_49246_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|49317_49668_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|49681_49957_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|49992_50415_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|50466_52161_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|52178_52541_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|52537_52774_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|52809_53478_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|54867_55572_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP047346	Proteus vulgaris strain ZN3 plasmid pZN3-cfr-121kb, complete sequence	121294	59490	110217	121294	transposase,integrase	Escherichia_phage(39.13%)	51	72371:72430	106380:106581
WP_126616202.1|59490_61110_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.2	3.4e-56
WP_159287723.1|61150_61438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|61473_62178_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|62461_63322_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164526967.1|63372_64917_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|65039_66563_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|66552_67335_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|67510_68011_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|68138_68978_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|68971_69319_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000939727.1|69466_70288_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_071593219.1|70419_71211_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845054.1|71356_72370_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
72371:72430	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
WP_000454193.1|72572_72923_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|73048_73609_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_164526968.1|73611_76563_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_046788546.1|76571_76973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|77057_77762_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|78686_79571_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|79793_81008_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|81035_81341_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|81452_82946_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|82976_83228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|83121_83424_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|83510_84326_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|84415_85505_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|85702_86188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|87998_88751_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|89172_90198_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|90426_91203_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067858.1|91316_92021_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_064732565.1|92030_92435_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084744.1|92754_93147_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067855.1|93342_94047_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|94236_95052_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|95202_95907_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_156734540.1|95946_96624_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_124724886.1|96712_96982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015639707.1|96915_97215_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_156734542.1|97246_98296_+	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_164526969.1|99020_99554_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.3	2.2e-12
WP_001067858.1|99600_100305_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|100498_100885_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_004193041.1|101204_101597_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_015344972.1|101763_102963_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001206356.1|103524_104316_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|104321_104567_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|104723_105221_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845054.1|105365_106379_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|106684_107242_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
106380:106581	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
WP_001138073.1|107244_110217_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
>prophage 1
NZ_CP047345	Proteus vulgaris strain ZN3 plasmid pZN3-tetX-171kb, complete sequence	171206	28313	67350	171206	transposase	Escherichia_phage(36.36%)	36	NA	NA
WP_000792636.1|28313_28847_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210551.1|29020_29149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210549.1|29818_30160_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|30196_30901_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|31083_31899_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000019441.1|32052_33033_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_001067855.1|33217_33922_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_164526951.1|34154_35015_+	aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_000587837.1|35027_35570_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|36051_36243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526952.1|36266_36494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|36544_37681_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|37647_37797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|37795_39166_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|39307_39433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|39986_40847_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_140114247.1|43084_46066_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.3	1.7e-32
WP_001120888.1|46483_47977_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_079879887.1|48007_48232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086371372.1|48322_48835_+	dihydrofolate reductase	NA	U5J9P6	Bacillus_phage	42.9	9.4e-29
WP_072161421.1|49326_50295_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_084929516.1|50635_51508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164526953.1|51968_53468_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_082987283.1|53498_53744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502095.1|54038_54416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064754130.1|54412_55576_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_164526954.1|55593_56454_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001120888.1|57098_58592_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094315248.1|59189_60812_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	9.9e-32
WP_164526955.1|61397_62126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094315246.1|62070_62400_+	GrpB family protein	NA	NA	NA	NA	NA
WP_164526953.1|62655_64155_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_164526956.1|64185_64929_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|65151_66366_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|66393_66699_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120891.1|66810_67350_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
