The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	398869	495979	4242565	integrase,tail,terminase,tRNA,lysis,plate,protease,portal	Enterobacteria_phage(24.49%)	97	415979:416002	459723:459746
WP_075673935.1|398869_399499_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_075673936.1|399469_400156_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-31
WP_156733951.1|400152_402594_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_099660128.1|402682_404845_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_075673939.1|405021_406047_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_156733950.1|406114_407374_-	MFS transporter	NA	NA	NA	NA	NA
WP_156733948.1|407497_408565_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_075673942.1|408561_409083_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_075673943.1|409217_409940_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_036934689.1|409952_410447_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_075673944.1|410822_412214_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	4.7e-38
WP_075673945.1|412303_412747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075673946.1|412981_413923_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_075673947.1|414575_414788_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_075673948.1|414791_415664_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
415979:416002	attL	TGCGGGTCAAGTAACGGGTCAAGT	NA	NA	NA	NA
WP_156733946.1|416007_416196_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164530182.1|416249_416732_-	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.6	2.1e-70
WP_156733945.1|416706_417069_-	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	54.7	1.2e-25
WP_156733943.1|417481_418162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733941.1|418230_418728_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	62.3	3.0e-48
WP_156733939.1|418786_419614_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	56.2	8.5e-80
WP_006533955.1|419679_420054_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	4.6e-41
WP_072070916.1|420273_420477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135022259.1|420586_421234_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	62.7	1.1e-63
WP_135022261.1|421339_421534_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	63.9	2.9e-15
WP_135022262.1|421572_422031_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	1.3e-26
WP_098943307.1|422119_422329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099659597.1|422318_422498_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	4.7e-12
WP_036901003.1|422510_423572_+	replication protein	NA	H2DE83	Erwinia_phage	54.4	5.1e-29
WP_156733937.1|423571_424210_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	65.2	2.0e-81
WP_036904905.1|424206_424599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023582529.1|424598_424769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904907.1|424831_425215_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_156733236.1|425233_426040_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	8.8e-90
WP_156733936.1|426036_427062_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.6	6.4e-85
WP_135022270.1|427090_427474_+	antitermination protein	NA	A0A088CD47	Shigella_phage	69.0	1.8e-48
WP_156733934.1|427714_428881_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.3	7.3e-85
WP_156733932.1|428993_429152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072065159.1|429356_429605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904926.1|429945_430215_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	47.7	5.7e-17
WP_109850081.1|430214_430685_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	58.6	1.7e-48
WP_164530183.1|430666_430825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904932.1|430827_431310_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	83.5	1.4e-42
WP_036904935.1|431549_431753_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_156733931.1|432441_432861_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	71.2	1.2e-42
WP_156733929.1|432897_433392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733927.1|433799_434336_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	64.6	1.2e-63
WP_156733925.1|434451_434946_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.0	1.5e-47
WP_156733923.1|434942_437045_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	69.0	7.7e-295
WP_004247869.1|437041_437257_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_156733921.1|437253_438744_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	66.9	1.9e-191
WP_156733919.1|438709_440701_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	64.5	1.8e-248
WP_156733917.1|440789_441131_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	50.0	1.5e-19
WP_156733915.1|441142_441415_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	43.8	1.6e-14
WP_156733913.1|441424_441988_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_164530211.1|441987_442383_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	60.3	2.6e-42
WP_156733910.1|442394_442916_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.0	7.0e-64
WP_156733909.1|442927_443317_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	36.5	8.5e-14
WP_156733907.1|443337_443658_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	42.5	1.5e-16
WP_156733905.1|443626_446644_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	30.9	1.1e-103
WP_156733903.1|446643_446973_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	54.6	4.3e-27
WP_156733902.1|447013_447910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733900.1|447987_448563_+	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	48.5	3.4e-19
WP_156733898.1|448616_449321_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.5	6.4e-68
WP_156733897.1|449342_450071_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	1.2e-88
WP_156734468.1|450040_450625_+|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	48.0	6.9e-44
WP_156733895.1|450639_454392_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	53.0	5.6e-280
WP_156733893.1|456532_458089_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_099659261.1|458470_459697_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	1.5e-35
WP_075674158.1|460393_460933_+	hypothetical protein	NA	NA	NA	NA	NA
459723:459746	attR	TGCGGGTCAAGTAACGGGTCAAGT	NA	NA	NA	NA
WP_075674159.1|461078_461387_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_099659263.1|461749_462259_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_099659264.1|462458_462878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733891.1|463369_464785_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075674163.1|465059_465587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075674116.1|466106_466400_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075674117.1|466543_467275_-	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	33.8	6.5e-07
WP_156733889.1|467690_468311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733887.1|468321_469704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674113.1|469783_470218_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_099659268.1|470220_470784_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_156733885.1|470758_471856_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_109419415.1|471819_473583_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_109419414.1|473615_475238_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_156733883.1|475283_478607_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_156733882.1|478606_480004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674106.1|480004_480259_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_156733880.1|480297_482436_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	30.1	1.1e-30
WP_156733878.1|482447_483185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733877.1|483238_484510_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	21.5	4.2e-09
WP_156733875.1|484660_485377_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	38.7	1.8e-09
WP_156733873.1|485455_486223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733869.1|488747_491459_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	8.9e-94
WP_023583757.1|491744_492236_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_075674253.1|492258_493998_-	OmpA family protein	NA	NA	NA	NA	NA
WP_156733868.1|493976_494645_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_156733866.1|494641_495979_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	935191	941591	4242565	lysis,holin	Enterobacteria_phage(37.5%)	9	NA	NA
WP_088495150.1|935191_935929_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	45.9	1.4e-57
WP_156733706.1|936170_936986_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.5	3.4e-57
WP_088495157.1|937348_937657_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	54.5	5.3e-27
WP_156733704.1|937649_938054_+	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	47.3	2.6e-26
WP_156733702.1|938050_938500_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	29.7	4.3e-09
WP_088495160.1|938597_939110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733700.1|939118_940606_+	DUF3383 family protein	NA	Q6IWV2	Burkholderia_phage	30.8	1.5e-58
WP_075674211.1|940616_941069_+	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_156733698.1|941132_941591_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	1.3e-24
>prophage 3
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1158036	1188695	4242565	integrase,tail,terminase	Salmonella_phage(26.92%)	38	1153245:1153260	1168447:1168462
1153245:1153260	attL	TTAATTTATGGTTATG	NA	NA	NA	NA
WP_075671849.1|1158036_1159503_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	2.3e-88
WP_098942517.1|1159604_1161182_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_156733580.1|1161400_1162597_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.9	4.8e-140
WP_004250848.1|1162604_1162793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733578.1|1162792_1162990_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	5.8e-19
WP_112843754.1|1162992_1163634_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.1	2.3e-72
WP_156733576.1|1163630_1163810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733574.1|1163861_1164392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733572.1|1164461_1164995_-	hypothetical protein	NA	J9Q748	Salmonella_phage	46.3	8.8e-38
WP_004250862.1|1165082_1165340_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_156733570.1|1165384_1166425_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	50.1	7.9e-99
WP_156733568.1|1166470_1168192_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	51.6	2.4e-108
WP_004243375.1|1168178_1168340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072068383.1|1168588_1169197_-	DNA-binding protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
1168447:1168462	attR	CATAACCATAAATTAA	NA	NA	NA	NA
WP_156733566.1|1169274_1169553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243371.1|1169692_1169878_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_036976826.1|1169888_1170731_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
WP_004243368.1|1170730_1171456_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_156733565.1|1171702_1172116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049203709.1|1172112_1172508_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_156733563.1|1172627_1173059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733562.1|1173118_1173460_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	58.1	1.6e-29
WP_156733560.1|1173488_1174139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733558.1|1174182_1174752_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	47.5	3.7e-42
WP_156733556.1|1174751_1176236_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	1.6e-230
WP_115370894.1|1176421_1176631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733554.1|1176640_1178305_+|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.4	2.4e-198
WP_004243354.1|1178301_1178616_+	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_115370896.1|1178633_1179311_+	peptidase	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
WP_004243350.1|1179326_1180307_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_060555916.1|1180365_1180797_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_115370897.1|1180805_1181147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243343.1|1181210_1181522_+	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	1.8e-14
WP_004243342.1|1181521_1182127_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	5.1e-66
WP_156733552.1|1182126_1184589_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.0	0.0e+00
WP_156733550.1|1184572_1185061_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	2.1e-49
WP_004243338.1|1185060_1185609_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_156733548.1|1185611_1188695_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.8	1.6e-163
>prophage 4
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1192831	1201495	4242565	holin	Escherichia_phage(33.33%)	9	NA	NA
WP_156733541.1|1192831_1195333_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	57.4	5.8e-71
WP_156733539.1|1195406_1196888_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_020945795.1|1197179_1197551_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_004243326.1|1197547_1197820_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_115349912.1|1197822_1198167_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	84.3	2.0e-43
WP_156733537.1|1198166_1198661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733535.1|1198939_1199533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733533.1|1199679_1200459_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.2	1.4e-31
WP_156733531.1|1200442_1201495_+	nucleotidyltransferase	NA	I1TRN7	Cronobacter_phage	28.9	1.2e-30
>prophage 5
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1768196	1781760	4242565	tRNA	Tupanvirus(55.56%)	13	NA	NA
WP_156733370.1|1768196_1770179_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
WP_075673352.1|1770178_1771159_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.7	1.1e-38
WP_099659662.1|1771159_1772305_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	3.5e-39
WP_075673354.1|1772438_1773188_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L090	Tupanvirus	28.1	7.1e-09
WP_099659661.1|1773189_1774200_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_023582381.1|1774579_1774876_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_075673356.1|1774880_1777268_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	3.5e-09
WP_023582383.1|1777282_1778266_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_120655563.1|1778441_1778489_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_006537111.1|1778597_1778954_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004263702.1|1778996_1779194_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_036937410.1|1779288_1779828_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_075673357.1|1779831_1781760_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
>prophage 6
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1848869	1862769	4242565	tail,terminase,head,capsid,protease,portal	Enterobacterial_phage(16.67%)	18	NA	NA
WP_156733354.1|1848869_1849268_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.0	2.7e-31
WP_156733353.1|1849324_1849906_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.8e-52
WP_156733352.1|1849905_1850502_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.3	3.2e-52
WP_156733351.1|1850502_1853778_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	8.4e-54
WP_004242485.1|1853904_1854096_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_041701216.1|1854124_1854403_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_088495854.1|1854399_1854816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628356.1|1854880_1855546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087802809.1|1855555_1855897_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_087802806.1|1855902_1856376_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.5	1.3e-11
WP_087802803.1|1856365_1856695_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_004242478.1|1856694_1856994_-	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	63.3	2.8e-33
WP_156733350.1|1857032_1858199_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	9.6e-170
WP_004242476.1|1858202_1858871_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_004242475.1|1858888_1860157_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_156733349.1|1860156_1861890_-|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	46.2	5.8e-147
WP_006537822.1|1861843_1862311_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_156733348.1|1862430_1862769_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	7.1e-41
>prophage 7
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1873506	1883035	4242565	integrase	Morganella_phage(50.0%)	13	1871478:1871490	1884613:1884625
1871478:1871490	attL	TTTTTATCTGAAT	NA	NA	NA	NA
WP_004244726.1|1873506_1873719_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_049219743.1|1874057_1874456_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_156733336.1|1874483_1875509_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	8.3e-85
WP_156733335.1|1875505_1876312_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.5	6.8e-90
WP_156734436.1|1876333_1876849_-	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	5.9e-23
WP_017628377.1|1877406_1877586_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_098943242.1|1877847_1878324_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_049217157.1|1878361_1878556_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	61.0	6.5e-15
WP_156733334.1|1878659_1879307_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	64.6	8.4e-75
WP_156733333.1|1879702_1880227_+	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	61.0	1.1e-53
WP_017628380.1|1880312_1880564_+	excisionase	NA	NA	NA	NA	NA
WP_156733332.1|1880538_1881672_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.0	1.4e-154
WP_109850542.1|1881781_1883035_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
1884613:1884625	attR	TTTTTATCTGAAT	NA	NA	NA	NA
>prophage 8
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1928135	1969632	4242565	tail,terminase,holin	Proteus_phage(26.83%)	60	NA	NA
WP_156733322.1|1928135_1928366_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	97.4	7.4e-34
WP_156733321.1|1928405_1929818_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	62.5	8.7e-141
WP_156733320.1|1929822_1933494_-	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	62.2	0.0e+00
WP_156733319.1|1933545_1934133_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.4	3.2e-57
WP_156733318.1|1934129_1934840_-	peptidase P60	NA	F1C573	Cronobacter_phage	64.8	9.9e-85
WP_109391241.1|1934836_1935580_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.3e-87
WP_115370826.1|1935576_1935918_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	49.1	2.6e-27
WP_156733317.1|1936060_1936303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733316.1|1936306_1936522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733315.1|1936533_1939467_-|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	29.8	5.5e-97
WP_156733314.1|1939527_1940397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109391246.1|1940541_1940859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530193.1|1940880_1941360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733312.1|1941572_1942298_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	1.0e-65
WP_156733311.1|1943018_1943189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733310.1|1943279_1943996_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156734434.1|1944125_1945667_-	DNA repair protein	NA	NA	NA	NA	NA
WP_109372780.1|1945997_1946177_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	81.4	1.7e-22
WP_156733309.1|1946182_1946554_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	62.7	1.9e-34
WP_156733308.1|1946645_1946936_-	hypothetical protein	NA	F8UBV2	Escherichia_phage	47.0	7.7e-12
WP_156733307.1|1946950_1947256_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	56.4	1.7e-22
WP_156733306.1|1947307_1947964_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.2	6.6e-59
WP_156733305.1|1948009_1948411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733304.1|1948407_1948860_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	52.7	9.2e-36
WP_156733303.1|1948861_1949215_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	44.7	4.5e-22
WP_156733302.1|1949217_1949697_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.2e-32
WP_156733301.1|1949736_1950021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733300.1|1950023_1950977_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.9	1.4e-126
WP_156733299.1|1950990_1951764_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.7	1.7e-66
WP_156733298.1|1951866_1952106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733297.1|1952174_1953296_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	3.3e-103
WP_156733296.1|1953292_1954663_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	1.8e-122
WP_156733295.1|1954662_1956150_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.6	4.5e-265
WP_156733294.1|1956152_1956761_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.5	3.6e-75
WP_109829196.1|1956848_1957067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733293.1|1957139_1957316_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.5	8.8e-19
WP_156733292.1|1957308_1957467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530194.1|1957497_1957656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733291.1|1957652_1958195_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	59.1	8.4e-52
WP_156733290.1|1958673_1959084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733289.1|1959080_1959338_-	peptidase	NA	Q8SBD8	Shigella_phage	45.2	2.6e-11
WP_156733288.1|1959225_1959603_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	31.7	6.3e-06
WP_156733287.1|1959599_1959992_-	M15 family peptidase	NA	A0A1P8DTE2	Proteus_phage	97.9	1.9e-50
WP_036906009.1|1959988_1960285_-|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_104731779.1|1960699_1961203_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	94.0	2.2e-86
WP_071233632.1|1961199_1961391_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.3e-28
WP_156733286.1|1961543_1962137_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	87.7	4.1e-84
WP_156733185.1|1962229_1962679_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	97.3	2.4e-76
WP_156733184.1|1962800_1963025_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_156733183.1|1963188_1963638_-	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	36.0	6.4e-13
WP_156733182.1|1963648_1963825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733181.1|1963826_1964060_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_152964332.1|1964532_1964700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733180.1|1964719_1965574_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	59.6	2.8e-86
WP_156733179.1|1965577_1966393_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	57.9	2.4e-79
WP_156733178.1|1966392_1967061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109391284.1|1967197_1967539_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	2.7e-48
WP_049257589.1|1967682_1967892_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	94.2	1.8e-31
WP_156734432.1|1967974_1968658_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	95.2	2.0e-127
WP_156733285.1|1968807_1969632_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	2.1e-38
>prophage 9
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	1973092	1979315	4242565	integrase	Escherichia_phage(44.44%)	14	1969826:1969839	1982929:1982942
1969826:1969839	attL	ATAAATATCAAAAT	NA	NA	NA	NA
WP_156733279.1|1973092_1973344_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	91.6	7.8e-37
WP_156733278.1|1973340_1974225_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.9	2.2e-94
WP_156733277.1|1974221_1974920_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.3	2.0e-74
WP_156733276.1|1974909_1975323_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	73.7	9.2e-51
WP_164530196.1|1975388_1975550_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	49.0	6.4e-08
WP_156733275.1|1975585_1975789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733274.1|1975781_1976006_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	61.6	1.4e-16
WP_036935799.1|1975995_1976256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733273.1|1976416_1976602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733272.1|1976594_1976963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733271.1|1976949_1977552_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.1	1.2e-59
WP_103004601.1|1977559_1977766_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_099659572.1|1977970_1978159_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	56.9	5.9e-13
WP_156733270.1|1978139_1979315_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	58.3	1.5e-133
1982929:1982942	attR	ATTTTGATATTTAT	NA	NA	NA	NA
>prophage 10
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	2053353	2087570	4242565	integrase,tail,terminase,head,holin,capsid,lysis,protease,portal	Morganella_phage(29.73%)	52	2045268:2045284	2092806:2092822
2045268:2045284	attL	CAATTTGCACAAAATAA	NA	NA	NA	NA
WP_156733251.1|2053353_2053752_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	49.2	1.1e-32
WP_156733250.1|2053772_2054600_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	37.1	4.0e-05
WP_156733249.1|2054658_2055240_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	2.0e-51
WP_156733248.1|2055239_2055836_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	50.3	7.8e-51
WP_156733247.1|2055836_2059121_-|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	31.1	8.4e-38
WP_072063870.1|2059163_2059442_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_069368417.1|2059438_2059852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072063869.1|2059886_2060561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069368415.1|2060570_2060912_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_069368414.1|2060916_2061390_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.7	5.7e-12
WP_069368413.1|2061379_2061709_-|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	33.9	1.6e-05
WP_069368412.1|2061717_2062044_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	95.4	2.7e-53
WP_156733246.1|2062329_2063544_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.3	1.6e-220
WP_156733245.1|2063555_2064407_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	98.6	2.1e-150
WP_109402514.1|2064411_2065737_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	80.6	1.0e-207
WP_156733244.1|2065737_2067480_-|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.8e-143
WP_064720837.1|2067433_2067901_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.4	2.5e-44
WP_156733243.1|2068270_2068678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733242.1|2068725_2069064_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	3.7e-42
WP_156733241.1|2069067_2069478_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	70.6	9.8e-45
WP_156733240.1|2069467_2069779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734430.1|2070594_2071083_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	90.2	6.8e-53
WP_036976899.1|2071084_2071417_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|2071403_2071697_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|2071693_2072083_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_058336245.1|2072212_2072455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099660111.1|2072458_2072674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733239.1|2072993_2073242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041705231.1|2073313_2073526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733238.1|2073851_2074532_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	49.1	5.2e-51
WP_156733237.1|2074559_2075585_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	7.5e-86
WP_156733236.1|2075581_2076388_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	8.8e-90
WP_036904907.1|2076406_2076790_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_023582529.1|2076852_2077023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904905.1|2077022_2077415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733235.1|2077411_2078050_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	66.7	9.8e-84
WP_156733234.1|2078046_2079168_-	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
WP_099660103.1|2079177_2079357_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	6.2e-12
WP_156733233.1|2079643_2080102_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	3.5e-27
WP_036900996.1|2080153_2080387_-	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	40.9	2.2e-09
WP_156733232.1|2080462_2081182_+	transcriptional regulator	NA	E7C9R0	Salmonella_phage	33.8	5.0e-28
WP_156733231.1|2081306_2081510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733230.1|2081735_2082632_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	59.7	2.6e-98
WP_156733229.1|2082713_2083247_+	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	59.6	1.4e-54
WP_156733228.1|2083239_2083737_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	66.1	5.0e-43
WP_156733227.1|2083745_2084201_+	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	40.5	1.3e-26
WP_156733226.1|2084202_2084841_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	41.9	3.3e-39
WP_156733225.1|2084850_2085351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733224.1|2085334_2085808_+	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.1	9.2e-71
WP_072065179.1|2085857_2086103_+	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	70.7	6.7e-25
WP_072065180.1|2086146_2086434_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	31.8	8.7e-08
WP_109402803.1|2086487_2087570_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	79.7	2.3e-170
2092806:2092822	attR	CAATTTGCACAAAATAA	NA	NA	NA	NA
>prophage 11
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	2116595	2168880	4242565	integrase,tail,terminase,head,holin,plate,lysis	Acinetobacter_phage(18.75%)	81	2116338:2116353	2164212:2164227
2116338:2116353	attL	GAGACTTCAGGAGACA	NA	NA	NA	NA
WP_156733216.1|2116595_2116826_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	6.3e-33
WP_156733215.1|2116826_2117447_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_156734428.1|2117446_2118307_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	44.2	7.4e-26
WP_156733214.1|2118968_2119601_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	49.0	5.6e-47
WP_156733213.1|2119600_2120791_-	hypothetical protein	NA	E2GM17	Acinetobacter_phage	40.4	6.3e-76
WP_049206563.1|2120787_2121141_-	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	52.1	9.4e-28
WP_156733212.1|2121142_2121835_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	40.2	4.4e-29
WP_156733211.1|2121815_2122706_-	hypothetical protein	NA	A0A220NQG9	Acinetobacter_phage	42.4	4.7e-60
WP_156733210.1|2122692_2122968_-	hypothetical protein	NA	A0A1X9SFF3	Acinetobacter_phage	46.7	2.9e-16
WP_156733209.1|2122968_2123676_-	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	54.4	4.8e-47
WP_156733208.1|2123733_2124243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049201304.1|2124359_2124761_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_156733207.1|2124751_2125534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733206.1|2125804_2126800_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_156733205.1|2126865_2129256_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	47.6	5.5e-180
WP_156733204.1|2129509_2129920_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	40.7	4.1e-19
WP_129037599.1|2129919_2130366_-	hypothetical protein	NA	A0A1V0DZ74	Acinetobacter_phage	51.0	9.7e-38
WP_156733203.1|2130378_2131836_-	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	33.9	1.7e-67
WP_156733202.1|2131847_2132333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734426.1|2132320_2132698_-	hypothetical protein	NA	K4I3A0	Acinetobacter_phage	41.8	5.7e-23
WP_156733201.1|2132687_2133146_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	53.0	9.0e-31
WP_156733200.1|2133138_2133543_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_156734424.1|2133545_2133749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733199.1|2133873_2134899_-	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	37.5	6.9e-63
WP_156733198.1|2134898_2135387_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	47.2	2.4e-34
WP_129037614.1|2135389_2136550_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	36.2	7.5e-58
WP_156734423.1|2136599_2137313_-|head	phage head morphogenesis protein	head	A0A2R3UAK2	Myoviridae_environmental_samples	41.3	7.4e-40
WP_156733197.1|2137371_2138790_-	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	37.8	3.0e-77
WP_156733196.1|2138786_2140307_-|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	49.9	1.1e-130
WP_072063061.1|2140902_2141592_-	hypothetical protein	NA	Q5G8R0	Enterobacteria_phage	71.6	1.5e-90
WP_156733195.1|2141704_2141872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733194.1|2142106_2142268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733193.1|2142264_2142714_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.9	2.5e-09
WP_156733192.1|2142710_2143115_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.3	5.9e-26
WP_036906009.1|2143111_2143408_-|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_156733191.1|2143591_2143879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733190.1|2144096_2144576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063108508.1|2145076_2145904_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	43.4	2.9e-56
WP_156733189.1|2145900_2146092_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	84.1	2.6e-24
WP_156733188.1|2146244_2146610_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	62.4	6.7e-37
WP_156733187.1|2146606_2146897_-	DUF1364 family protein	NA	K7P6U2	Enterobacteria_phage	77.9	2.2e-38
WP_164530201.1|2147039_2147165_-	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	89.5	3.0e-13
WP_156733185.1|2147151_2147601_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	97.3	2.4e-76
WP_156733184.1|2147722_2147947_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_156733183.1|2148110_2148560_-	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	36.0	6.4e-13
WP_156733182.1|2148570_2148747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733181.1|2148748_2148982_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_152964332.1|2149454_2149622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733180.1|2149641_2150496_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	59.6	2.8e-86
WP_156733179.1|2150499_2151315_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	57.9	2.4e-79
WP_156733178.1|2151314_2151983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109391284.1|2152119_2152461_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	2.7e-48
WP_156733177.1|2152594_2152798_-	transcriptional regulator	NA	K7P6H5	Enterobacteria_phage	62.9	1.5e-14
WP_156733176.1|2152916_2153627_+	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	62.9	1.5e-77
WP_156733175.1|2154101_2154374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733174.1|2154394_2154898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733173.1|2155098_2155338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733172.1|2155367_2155556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733171.1|2155557_2155701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733170.1|2155775_2156684_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	47.9	2.0e-21
WP_164530202.1|2156739_2156895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733169.1|2156902_2157166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733168.1|2157162_2157384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733167.1|2157377_2158307_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	65.8	1.2e-109
WP_156733166.1|2158303_2159002_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.8	7.0e-75
WP_156733165.1|2158991_2159489_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	80.0	1.4e-53
WP_156733164.1|2159548_2159842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733163.1|2159865_2160045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733162.1|2160044_2160578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733161.1|2160577_2160730_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	97.3	5.1e-15
WP_156733160.1|2160837_2161083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733159.1|2161453_2161789_+	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	48.1	1.5e-14
WP_156733158.1|2161778_2162324_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	60.5	8.7e-57
WP_063693452.1|2162736_2162943_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	8.7e-10
WP_156734421.1|2162946_2164131_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	51.6	3.4e-114
WP_023581360.1|2164566_2164896_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
2164212:2164227	attR	GAGACTTCAGGAGACA	NA	NA	NA	NA
WP_075673147.1|2164939_2165221_-	acylphosphatase	NA	NA	NA	NA	NA
WP_036912304.1|2165421_2165739_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_075673146.1|2165817_2166231_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_075673145.1|2166368_2166827_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_075673144.1|2166828_2168880_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.9	3.0e-17
>prophage 12
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	2473242	2484083	4242565		Mycobacterium_phage(22.22%)	12	NA	NA
WP_075671562.1|2473242_2474454_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	2.3e-102
WP_036912266.1|2474654_2474918_+	YbeD family protein	NA	NA	NA	NA	NA
WP_075671560.1|2475078_2475723_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_075671558.1|2475824_2476790_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_023581134.1|2476803_2477178_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_023581133.1|2477315_2477525_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_156733096.1|2477722_2478196_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	34.2	2.2e-16
WP_075671554.1|2478479_2478704_+	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_075671552.1|2478715_2479135_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.6	8.0e-10
WP_156733095.1|2479140_2481267_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	2.0e-202
WP_156733094.1|2481291_2482260_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	2.2e-135
WP_075671546.1|2482883_2484083_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
>prophage 13
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	3500858	3574878	4242565	tRNA,transposase,protease	Bacillus_phage(33.33%)	58	NA	NA
WP_156734395.1|3500858_3502223_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_156734490.1|3502371_3502629_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075673274.1|3503036_3503498_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_156734393.1|3503667_3504462_-	TonB family protein	NA	NA	NA	NA	NA
WP_156734391.1|3504489_3507534_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_156734389.1|3507575_3508937_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_156734388.1|3509148_3509910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734386.1|3510342_3511230_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156734384.1|3511403_3512372_-	acyltransferase	NA	NA	NA	NA	NA
WP_099659545.1|3512571_3513108_+	flagellar protein	NA	NA	NA	NA	NA
WP_075673725.1|3513365_3514229_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_156734382.1|3514264_3515029_+	transferase	NA	NA	NA	NA	NA
WP_099659546.1|3515025_3515856_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_143484136.1|3516033_3519081_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_099659548.1|3519092_3520031_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_075673730.1|3520027_3520684_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_075673731.1|3520890_3521811_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_156734380.1|3521826_3523218_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_156734379.1|3523214_3525077_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	23.6	7.0e-13
WP_156734377.1|3525186_3526836_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_156734375.1|3526953_3527382_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_156734374.1|3527696_3528725_-	endoglucanase	NA	NA	NA	NA	NA
WP_075673738.1|3529940_3530852_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	27.6	1.3e-09
WP_075673739.1|3530891_3531362_-	cellulose biosynthesis protein	NA	NA	NA	NA	NA
WP_156734372.1|3531377_3535079_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_156734369.1|3535092_3537444_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_075673742.1|3537446_3539567_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_075673743.1|3539738_3540137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734367.1|3541500_3542052_+	DUF1768 domain-containing protein	NA	A0A288TYC1	Enterococcus_phage	51.9	1.0e-36
WP_075674279.1|3542208_3543120_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_075674278.1|3543218_3543803_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_075674281.1|3543822_3544386_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_083629138.1|3544747_3545143_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.5	7.3e-21
WP_099659555.1|3545640_3546090_+	metal-binding protein	NA	NA	NA	NA	NA
WP_156734365.1|3546207_3547743_-	MFS transporter	NA	NA	NA	NA	NA
WP_075674273.1|3548947_3549580_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075674272.1|3549636_3551043_-	YfcC family protein	NA	NA	NA	NA	NA
WP_075674271.1|3551052_3552186_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_001353740.1|3553489_3553729_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_070342364.1|3555279_3556125_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000777554.1|3556121_3556595_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_001206316.1|3556611_3557403_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|3557566_3557914_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3557907_3558747_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|3559151_3560693_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|3560956_3561613_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_001067855.1|3561737_3562442_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|3562932_3563793_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|3563843_3565388_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|3565510_3567034_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|3567023_3567806_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|3568340_3568841_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3568968_3569808_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_052238321.1|3569801_3570137_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|3570029_3570395_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|3570398_3571274_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236386.1|3571384_3572524_+	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_000050481.1|3573336_3574878_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	3950679	4022962	4242565	integrase,tail,terminase,holin,head,tRNA,capsid,lysis,protease,portal	Proteus_phage(34.62%)	85	3954225:3954256	3994300:3994331
WP_036934568.1|3950679_3952089_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.4	1.7e-192
WP_075673060.1|3952242_3953226_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_156734255.1|3953293_3954328_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3954225:3954256	attL	TCTAGCATCGGCGCAACAGAGAAGCGGTTCAA	NA	NA	NA	NA
WP_109402803.1|3954424_3955507_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	79.7	2.3e-170
WP_072065180.1|3955560_3955848_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	31.8	8.7e-08
WP_072065179.1|3955891_3956137_-	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	70.7	6.7e-25
WP_156734253.1|3956194_3956590_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	52.8	3.7e-25
WP_156734251.1|3956592_3957180_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.7	3.2e-33
WP_156734250.1|3957172_3957874_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	58.3	1.6e-71
WP_156734248.1|3957887_3958385_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	66.1	5.3e-45
WP_156734246.1|3958443_3959271_-	DUF2303 family protein	NA	U5P439	Shigella_phage	54.7	3.2e-79
WP_006533955.1|3959336_3959711_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	4.6e-41
WP_072070916.1|3960046_3960250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734244.1|3960488_3961502_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	37.5	3.5e-59
WP_156734242.1|3961591_3962248_-	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	74.9	4.7e-89
WP_156734240.1|3962344_3962572_+	helix-turn-helix domain-containing protein	NA	A0A1C9IHV8	Salmonella_phage	50.0	2.3e-11
WP_156734238.1|3962610_3963069_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	2.1e-27
WP_099660103.1|3963355_3963535_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	6.2e-12
WP_156733234.1|3963544_3964666_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
WP_156733235.1|3964662_3965301_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	66.7	9.8e-84
WP_036904905.1|3965297_3965690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023582529.1|3965689_3965860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904907.1|3965922_3966306_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_156733236.1|3966324_3967131_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	8.8e-90
WP_156733237.1|3967127_3968153_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	7.5e-86
WP_156733238.1|3968180_3968861_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	49.1	5.2e-51
WP_041705231.1|3969186_3969399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733239.1|3969470_3969719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099660111.1|3970038_3970254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336245.1|3970257_3970500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916901.1|3970629_3971019_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_004918415.1|3971015_3971309_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036976899.1|3971295_3971628_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_156734430.1|3971629_3972118_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	90.2	6.8e-53
WP_156734236.1|3972934_3973246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156734234.1|3973235_3973613_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	59.7	3.9e-32
WP_156734232.1|3973676_3974024_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	92.9	5.9e-59
WP_156734230.1|3974023_3974425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099660116.1|3974574_3975045_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	83.3	2.8e-72
WP_156734229.1|3975048_3976782_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	97.9	0.0e+00
WP_098943281.1|3976791_3976971_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.4	9.9e-10
WP_023582514.1|3976970_3978200_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.4	1.7e-177
WP_156734227.1|3978171_3978822_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.5	1.6e-94
WP_156734225.1|3978835_3980044_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	69.0	3.4e-154
WP_156734223.1|3980139_3980448_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	40.2	2.4e-11
WP_023582510.1|3980444_3980768_+|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	94.4	5.0e-52
WP_156734222.1|3980764_3981205_+	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	97.9	3.5e-72
WP_156734220.1|3981201_3981537_+	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	98.2	9.1e-57
WP_036913331.1|3981601_3982069_+	hypothetical protein	NA	A0A1P8DTJ5	Proteus_phage	100.0	1.3e-80
WP_088495895.1|3982071_3982452_+|tail	phage tail protein	tail	A0A1P8DTJ2	Proteus_phage	100.0	7.9e-65
WP_023582505.1|3982475_3982757_+	DUF4035 domain-containing protein	NA	A0A1P8DTH5	Proteus_phage	92.6	3.4e-41
WP_156734218.1|3982776_3986043_+|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	83.5	0.0e+00
WP_115350931.1|3986045_3986378_+|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	100.0	1.9e-62
WP_156734216.1|3986374_3987124_+|tail	phage minor tail protein L	tail	A0A1P8DTI3	Proteus_phage	97.6	3.2e-142
WP_156734486.1|3987129_3987837_+	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	97.9	7.6e-138
WP_023582500.1|3987927_3988428_+	hypothetical protein	NA	A0A1P8DTJ8	Proteus_phage	100.0	1.9e-87
WP_115351040.1|3988499_3989078_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	99.5	1.3e-103
WP_156734214.1|3989097_3992865_+	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	95.2	0.0e+00
WP_156734212.1|3992869_3994273_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	64.1	1.3e-144
WP_075673058.1|3994572_3995160_+	CbrC family protein	NA	NA	NA	NA	NA
3994300:3994331	attR	TCTAGCATCGGCGCAACAGAGAAGCGGTTCAA	NA	NA	NA	NA
WP_156734210.1|3995320_3996610_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	33.1	1.3e-29
WP_075673056.1|3997154_3998270_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.9	9.9e-31
WP_023583058.1|3998253_3999114_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	6.7e-11
WP_075673055.1|3999110_3999890_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_075673054.1|4000001_4001045_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_075673053.1|4001181_4001493_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.0	5.6e-08
WP_075673052.1|4001518_4002592_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_099660502.1|4002591_4003110_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_156734208.1|4003109_4005629_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_075673049.1|4005665_4006346_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_075673048.1|4006442_4007003_-	fimbrial protein	NA	NA	NA	NA	NA
WP_075674389.1|4007880_4008795_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_075674388.1|4009058_4010333_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.6e-19
WP_156734207.1|4010459_4011323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075673542.1|4011694_4012282_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075673541.1|4012308_4013169_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_006536331.1|4013168_4013687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249182.1|4014363_4014642_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_006536329.1|4014662_4014947_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_006536328.1|4014961_4015240_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_075673540.1|4015312_4016980_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_036934514.1|4017006_4017270_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_075673539.1|4017277_4018426_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_156734205.1|4018482_4021911_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_075673537.1|4022011_4022962_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 15
NZ_CP047340	Proteus cibarius strain ZF1 chromosome, complete genome	4242565	4187473	4213973	4242565	transposase,integrase	Geobacillus_virus(50.0%)	22	4181826:4181840	4198750:4198764
4181826:4181840	attL	AAACACTCGCCAAAC	NA	NA	NA	NA
WP_156733366.1|4187473_4187929_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	36.7	2.5e-17
WP_075672706.1|4188179_4188443_+	DUF1435 family protein	NA	NA	NA	NA	NA
WP_075672705.1|4188865_4189882_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_075672704.1|4190011_4190422_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_075672703.1|4190390_4190837_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036973667.1|4191507_4191600_+	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_000127615.1|4192038_4192227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211147.1|4192372_4194391_+	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_001218618.1|4194520_4195762_-|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.8	1.3e-76
WP_001995600.1|4195763_4196033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|4196035_4197010_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000348524.1|4197474_4197918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156734129.1|4200091_4203070_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
4198750:4198764	attR	GTTTGGCGAGTGTTT	NA	NA	NA	NA
WP_001120888.1|4203487_4204981_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_078081115.1|4205490_4206366_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001255015.1|4207430_4207736_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|4207847_4209341_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_082987283.1|4209371_4209617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502095.1|4209911_4210289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064754130.1|4210285_4211449_+	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_077782102.1|4211466_4212327_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_156734112.1|4212989_4213973_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
