The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	184764	192920	2014880		Diachasmimorpha_longicaudata_entomopoxvirus(16.67%)	7	NA	NA
WP_032133158.1|184764_186135_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	3.5e-54
WP_019389768.1|186315_187788_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.7	3.2e-21
WP_003789136.1|187944_188274_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	48.0	1.8e-20
WP_003787243.1|188689_189655_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.6	1.4e-46
WP_003789141.1|189717_190599_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	28.2	2.1e-07
WP_038329615.1|190819_191827_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003789144.1|192035_192920_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	26.5	2.5e-21
>prophage 2
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	283220	341580	2014880	protease,tRNA,transposase	Bacillus_phage(15.38%)	60	NA	NA
WP_003789330.1|283220_284000_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_003789332.1|284127_284598_+	universal stress protein	NA	NA	NA	NA	NA
WP_003789334.1|284946_285507_+	elongation factor P	NA	NA	NA	NA	NA
WP_003789336.1|285565_286741_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_038310466.1|286749_287052_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_038310468.1|287221_288166_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_164538041.1|288465_290391_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.7	3.9e-152
WP_003789345.1|290760_291870_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.3	9.3e-114
WP_003785358.1|292020_292227_-	bacterioferritin	NA	NA	NA	NA	NA
WP_164538363.1|292398_294609_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	31.5	1.9e-73
WP_003789349.1|294843_295971_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	8.4e-46
WP_003785363.1|295975_296278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003789351.1|296293_296608_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003785368.1|296639_296903_+	membrane protein	NA	NA	NA	NA	NA
WP_003789353.1|296922_297387_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003789355.1|297434_297671_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_164538042.1|297735_298221_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_003789361.1|299535_302748_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003789364.1|302911_303385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003789367.1|303542_304019_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003789369.1|304099_306241_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	52.7	8.4e-188
WP_003785378.1|306365_306881_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_003789372.1|306892_307201_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003789374.1|307310_307523_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	60.0	5.1e-13
WP_003789376.1|307623_308013_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003789379.1|308072_309248_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038310477.1|309473_310226_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_051291710.1|310366_311950_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.7	8.2e-39
WP_164538043.1|312229_313723_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_026036370.1|313783_314083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003789394.1|314159_314972_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003785398.1|315180_316140_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_038310479.1|316214_316838_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_164538044.1|317283_317676_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_164538045.1|317691_318675_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038312148.1|318677_319148_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003785405.1|319152_320256_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_164538046.1|320325_320817_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_042949159.1|320829_321276_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.2	3.8e-26
WP_019390311.1|321902_322364_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_164538047.1|322551_324204_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	5.0e-79
WP_003789410.1|324319_325012_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_164538048.1|325154_326597_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_164538049.1|326611_327178_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.8	2.1e-21
WP_003789415.1|327183_328071_+	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_164538050.1|328151_328580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003789418.1|328664_329237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785433.1|331519_331810_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003785435.1|331868_333224_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003789424.1|333385_334111_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.2e-23
WP_003785439.1|334285_334801_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_038310486.1|334784_335357_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_038310487.1|335353_335893_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003789428.1|336003_336186_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_003785443.1|336182_336941_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_164538051.1|337024_338323_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	33.3	1.2e-59
WP_164538052.1|338484_339126_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003789438.1|339379_339604_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003789867.1|340817_341081_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.9	5.7e-06
WP_003792284.1|341217_341580_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	557280	624335	2014880	terminase,tRNA,transposase	Paenibacillus_phage(30.0%)	58	NA	NA
WP_164538089.1|557280_558036_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.5	3.1e-12
WP_003792189.1|558371_558635_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.9	4.4e-06
WP_164538090.1|558683_559325_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003792195.1|559465_561778_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_164538089.1|562539_563295_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.5	3.1e-12
WP_003790867.1|563484_564816_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_003790863.1|564829_565660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032828169.1|565887_566298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003790858.1|566410_566800_-	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	41.8	7.9e-12
WP_155238050.1|566796_566949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003790857.1|566952_568467_-	DUF4178 domain-containing protein	NA	NA	NA	NA	NA
WP_038314728.1|568482_568722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026036294.1|568787_569156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003787860.1|569274_569718_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003790848.1|569792_570731_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003790846.1|570933_572337_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_038308333.1|578481_578733_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032133957.1|578778_579108_-	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_038311210.1|579190_579946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003790837.1|580710_581421_-	SCO family protein	NA	NA	NA	NA	NA
WP_003790835.1|581434_583105_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003784990.1|583125_583815_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_038311208.1|583811_584630_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003784993.1|584769_585330_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	5.3e-33
WP_003784995.1|585547_586393_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_019390385.1|586436_587153_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_164538368.1|587223_587781_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_154699901.1|587806_588319_+	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.7	2.0e-10
WP_154699902.1|588399_588648_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_050792394.1|588701_589667_-	signal peptidase I	NA	NA	NA	NA	NA
WP_019390382.1|589768_590650_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003790823.1|590839_591700_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038303929.1|591763_592174_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_032133950.1|592201_592804_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	36.6	1.6e-19
WP_003785013.1|592818_593433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038311197.1|593634_594942_-	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_003790814.1|594947_595601_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003790813.1|595867_597133_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_038311195.1|598440_599208_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003786250.1|599416_599599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003790809.1|599879_600446_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_032133911.1|600568_601597_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.0	5.0e-45
WP_038330060.1|601984_602839_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_038320910.1|602850_603450_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_164538091.1|603660_605784_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003790800.1|605884_606919_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003790799.1|607057_608353_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003786266.1|608532_609330_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038311188.1|609453_611097_-	lactate permease LctP family transporter	NA	NA	NA	NA	NA
WP_003790794.1|611236_612688_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_003790791.1|612684_613383_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_003786276.1|613379_614147_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003790789.1|614655_615228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003790786.1|615310_615955_-	adenylate kinase	NA	NA	NA	NA	NA
WP_164538092.1|616327_618799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538093.1|619038_621117_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A0RVE6	Bacillus_phage	36.0	7.5e-08
WP_003790780.1|621201_621762_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003790778.1|623054_624335_+|terminase	terminase	terminase	E5FFI8	Burkholderia_phage	46.8	6.3e-98
>prophage 6
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	1008956	1047794	2014880	protease,tRNA,transposase,tail	Moraxella_phage(14.29%)	44	NA	NA
WP_003790578.1|1008956_1009400_-	phage virion morphogenesis protein	NA	A0A0U5KRJ7	unidentified_phage	42.5	4.5e-19
WP_003792210.1|1010578_1011094_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_003792208.1|1011231_1011519_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	41.9	1.3e-06
WP_003792207.1|1011571_1011685_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_164538113.1|1011687_1011876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003792203.1|1011924_1012146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003792202.1|1012368_1013235_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	62.6	6.2e-49
WP_144005598.1|1013329_1013755_+	hypothetical protein	NA	A0A0R6PGL8	Moraxella_phage	50.8	4.7e-26
WP_164538158.1|1013896_1014334_+	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	50.7	3.7e-34
WP_080571764.1|1014567_1015233_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A0A0Q3B9	Pectobacterium_bacteriophage	60.9	1.1e-05
WP_038310639.1|1015312_1016926_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_164538159.1|1017163_1017868_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.8	2.4e-30
WP_003790168.1|1018121_1018286_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_038310880.1|1018494_1020408_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.6	1.4e-122
WP_003786175.1|1020587_1020758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538160.1|1020754_1021348_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003786173.1|1021461_1021635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134793899.1|1021890_1023318_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003786171.1|1023464_1024310_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_019389073.1|1024472_1025813_-	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PKQ1	Moraxella_phage	45.0	3.8e-85
WP_019389074.1|1025918_1026401_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003790159.1|1026582_1027767_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_003790157.1|1027849_1028605_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003790154.1|1028619_1029150_+	lipoprotein	NA	NA	NA	NA	NA
WP_164538161.1|1029159_1029555_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_003790151.1|1029582_1029912_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_003790149.1|1029983_1030304_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003786162.1|1030355_1030559_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_038310885.1|1030560_1031067_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003786159.1|1031063_1031828_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.5	2.7e-27
WP_032828152.1|1034978_1035272_+	membrane protein	NA	NA	NA	NA	NA
WP_032828151.1|1035211_1035502_+	helicase	NA	NA	NA	NA	NA
WP_038329025.1|1035759_1037676_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_032133640.1|1037712_1038687_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038310892.1|1038764_1039562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038310894.1|1039562_1040255_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	2.7e-18
WP_038310896.1|1040247_1041369_+	membrane protein	NA	NA	NA	NA	NA
WP_003786138.1|1041407_1042187_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_042226781.1|1042265_1042538_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.8	1.0e-13
WP_038310898.1|1042549_1043038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134793715.1|1043232_1044483_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.2	6.0e-93
WP_164538162.1|1044565_1046065_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.5	4.2e-77
WP_003786130.1|1046115_1046463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538163.1|1046465_1047794_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 7
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	1300113	1384577	2014880	plate,tail,tRNA,transposase,capsid	Burkholderia_phage(21.05%)	100	NA	NA
WP_003789756.1|1300113_1301004_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_003789755.1|1301172_1302498_-	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	27.2	5.6e-17
WP_003789754.1|1302502_1303198_-	response regulator	NA	NA	NA	NA	NA
WP_003789753.1|1303190_1304063_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_003789752.1|1304078_1304579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003789750.1|1304578_1305361_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	49.8	1.6e-56
WP_164538215.1|1305541_1306600_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_003789747.1|1306688_1306874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100215675.1|1307011_1307149_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003789744.1|1307225_1307480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038310675.1|1307521_1309576_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038310673.1|1309665_1312068_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_003785725.1|1312110_1313139_-	hemoglobin-haptoglobin-utilization protein A	NA	NA	NA	NA	NA
WP_032828141.1|1313535_1314672_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_003785715.1|1314847_1315696_+	iron permease	NA	NA	NA	NA	NA
WP_164538216.1|1315717_1316899_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_164538217.1|1317038_1318304_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_164538218.1|1318471_1320184_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_164538219.1|1320563_1321958_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_164538220.1|1321957_1322422_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_164538221.1|1322485_1323892_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_003785706.1|1323972_1324896_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_038310624.1|1324908_1325667_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_019390456.1|1325680_1327024_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003785703.1|1327239_1328430_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_032133285.1|1328501_1329038_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003785701.1|1329101_1329716_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	38.5	5.6e-20
WP_060537150.1|1329718_1331836_-	AsmA family protein	NA	NA	NA	NA	NA
WP_111694427.1|1331967_1332345_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_003789695.1|1332449_1333640_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.6	2.0e-37
WP_003789694.1|1333651_1334659_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003789692.1|1334761_1335394_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_155238407.1|1335427_1336186_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038329652.1|1336185_1336815_-	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_038329654.1|1336820_1337900_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_164538222.1|1338161_1338716_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_003789682.1|1338718_1339618_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_003789680.1|1340042_1340528_-	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	39.6	4.7e-22
WP_003789679.1|1340610_1341591_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_164538223.1|1341587_1342547_-	alpha-2,3-sialyltransferase	NA	NA	NA	NA	NA
WP_038315033.1|1342557_1342878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003789673.1|1342900_1343188_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_003789672.1|1343196_1344501_-	replication protein A	NA	R4JJS4	Burkholderia_phage	47.9	4.7e-32
WP_003789670.1|1344666_1345803_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	55.5	4.1e-117
WP_164538224.1|1345970_1346225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785659.1|1346257_1347427_-	phage late control protein	NA	A4PE54	Ralstonia_virus	45.6	3.3e-77
WP_164538225.1|1347411_1347879_-|tail	phage tail protein	tail	A0A077K9Y7	Ralstonia_phage	44.5	4.1e-23
WP_164538226.1|1347975_1350051_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	32.1	9.7e-40
WP_003789661.1|1350047_1350242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538227.1|1350195_1351188_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	51.0	8.6e-79
WP_164538228.1|1351659_1352097_-	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	52.1	2.6e-35
WP_164538073.1|1352117_1352714_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_164538229.1|1352726_1354127_-	hypothetical protein	NA	A0A0S4L0Z9	Pseudomonas_phage	38.5	8.3e-11
WP_164538230.1|1354127_1354706_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	51.8	3.9e-47
WP_164538231.1|1354698_1355838_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	38.2	4.1e-56
WP_164538232.1|1355834_1356209_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_032133917.1|1356350_1356941_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_164538233.1|1356924_1358034_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	44.9	1.1e-66
WP_003785084.1|1358033_1358252_-	membrane protein	NA	A0A067ZJB1	Vibrio_phage	40.9	1.6e-06
WP_164538234.1|1358248_1359148_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_164538235.1|1359147_1361811_-|tail	phage tail tape measure protein	tail	D5LGY4	Escherichia_phage	41.1	2.9e-113
WP_032133961.1|1361859_1362048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003792207.1|1362049_1362163_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_164538236.1|1362215_1362497_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_164538237.1|1362630_1363146_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_003785078.1|1363161_1364553_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	44.8	3.3e-100
WP_095063400.1|1364562_1365063_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	33.8	3.7e-22
WP_095063401.1|1365063_1365489_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	31.9	3.6e-10
WP_164538238.1|1365492_1365711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538239.1|1365714_1366047_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_003785071.1|1366095_1367028_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	42.6	6.3e-55
WP_164538240.1|1367043_1368135_-	2-oxoacid:acceptor oxidoreductase	NA	Q6QIB7	Burkholderia_phage	36.6	2.5e-55
WP_003785065.1|1368369_1368720_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	42.1	1.3e-16
WP_003785061.1|1369855_1370464_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	45.8	9.4e-44
WP_134793649.1|1370450_1370882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538241.1|1370878_1371376_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	41.6	2.9e-27
WP_003785057.1|1371372_1371540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538242.1|1371597_1371750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095063181.1|1371751_1372930_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	51.6	1.1e-107
WP_164538243.1|1372932_1374723_-|transposase	transposase family protein	transposase	Q6QIE0	Burkholderia_phage	48.0	1.7e-149
WP_164538244.1|1374729_1375602_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	38.7	2.3e-43
WP_019389002.1|1375636_1375927_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019389003.1|1375938_1376115_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_134793695.1|1376235_1376529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134793696.1|1376587_1376824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134793697.1|1376833_1377295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538245.1|1377402_1377915_+	TIGR02594 family protein	NA	A0A1L2C8R8	Pseudomonas_phage	61.8	5.7e-58
WP_003785039.1|1377928_1378102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785037.1|1378104_1378266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785035.1|1378268_1378529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538246.1|1378518_1378674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538247.1|1378684_1378858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785029.1|1378850_1379057_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	55.7	1.0e-10
WP_003785028.1|1379049_1379373_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	40.2	1.2e-10
WP_003785025.1|1379369_1379675_+	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	60.4	4.0e-27
WP_003785024.1|1379676_1380222_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	47.5	2.9e-36
WP_164538248.1|1380218_1381724_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	66.7	1.7e-198
WP_164538249.1|1381754_1383251_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	45.2	5.4e-109
WP_164538250.1|1383240_1384149_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.2	4.4e-61
WP_164538251.1|1384145_1384577_+	phage virion morphogenesis protein	NA	A0A0U5KRJ7	unidentified_phage	39.9	3.7e-18
>prophage 8
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	1457817	1506578	2014880	protease,transposase	Pseudomonas_phage(22.22%)	50	NA	NA
WP_003787488.1|1457817_1458657_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003791157.1|1458715_1459405_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_019389565.1|1459478_1459913_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_032133984.1|1460264_1462841_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	32.5	3.8e-118
WP_164538265.1|1462977_1463865_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_003791165.1|1463942_1464410_-	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_003787475.1|1464518_1465304_-	cytochrome c1	NA	NA	NA	NA	NA
WP_003791167.1|1465317_1466670_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_038304023.1|1466687_1467272_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003791169.1|1467508_1468030_-	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	63.6	2.6e-34
WP_164538266.1|1468032_1469418_-	MFS transporter	NA	NA	NA	NA	NA
WP_032828289.1|1469559_1470783_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_164538267.1|1471044_1473750_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_003787459.1|1473893_1474337_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_038311280.1|1474403_1475372_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_032828178.1|1475352_1476228_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	30.8	2.0e-07
WP_003791185.1|1476480_1477731_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	1.2e-96
WP_003791186.1|1479696_1480572_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003791188.1|1480790_1481768_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003787443.1|1481840_1482329_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003791190.1|1482316_1483093_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_003791194.1|1483527_1484685_+	PLP-dependent transferase	NA	S4VRH6	Pandoravirus	26.9	7.4e-13
WP_003791195.1|1484803_1485664_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_164538268.1|1485984_1487817_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003791200.1|1488055_1489033_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003787426.1|1489155_1489548_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003787424.1|1489591_1489861_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_038311273.1|1489863_1491600_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.3	1.7e-08
WP_003787419.1|1491669_1492437_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003791205.1|1492439_1492805_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003789355.1|1493808_1494045_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_164538080.1|1494072_1494594_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_032828290.1|1495927_1496245_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003791212.1|1496338_1496635_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_003791215.1|1496736_1497456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003791217.1|1497607_1497808_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164538269.1|1498429_1498606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538270.1|1498657_1498993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003791221.1|1499110_1499302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003791223.1|1499304_1499637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003791225.1|1499633_1499879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538271.1|1499881_1500946_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	26.4	1.5e-23
WP_003791234.1|1501046_1501403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003791236.1|1501407_1503174_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	32.3	3.7e-72
WP_003791238.1|1503304_1503583_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	52.9	3.3e-12
WP_003791240.1|1503937_1504270_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003785327.1|1505042_1505531_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_164538272.1|1505814_1506297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164538273.1|1506274_1506460_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_164538274.1|1506413_1506578_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	1834186	1883230	2014880	tRNA,integrase,transposase	Bacillus_phage(27.27%)	41	1831182:1831206	1843364:1843388
1831182:1831206	attL	CAATAAAAAGCAGCCTGCACTTTTT	NA	NA	NA	NA
WP_003792297.1|1834186_1834975_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003792114.1|1834904_1835393_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_003788049.1|1835682_1837110_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003792113.1|1837190_1839317_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.7	8.7e-44
WP_164538334.1|1839627_1839795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003789098.1|1839931_1840195_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.9	4.4e-06
WP_164538335.1|1840245_1840887_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	2.4e-29
WP_003788060.1|1842119_1842623_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_003792109.1|1842635_1843352_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_164538336.1|1843427_1844708_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
1843364:1843388	attR	CAATAAAAAGCAGCCTGCACTTTTT	NA	NA	NA	NA
WP_032133022.1|1844851_1845277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038319793.1|1845434_1846901_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.7	3.7e-94
WP_164538337.1|1846963_1847398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538338.1|1847372_1847585_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_164538339.1|1847690_1848098_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003792106.1|1848545_1849346_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_164538340.1|1849446_1852224_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.7	6.6e-60
WP_003788074.1|1852329_1852524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080571763.1|1853224_1853899_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003792103.1|1853987_1856366_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003792102.1|1856513_1857059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003788083.1|1857051_1857258_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003792101.1|1857398_1858187_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_003792100.1|1858311_1861041_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	31.4	4.8e-95
WP_003792099.1|1861179_1862547_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003792098.1|1862673_1863999_+	MFS transporter	NA	NA	NA	NA	NA
WP_003792284.1|1864401_1864764_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_003789098.1|1864900_1865164_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.9	4.4e-06
WP_019390349.1|1866190_1866553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038310391.1|1866822_1868778_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_003792093.1|1868997_1869189_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_164538341.1|1869175_1869784_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	42.9	3.0e-26
WP_019390346.1|1869898_1870834_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	6.5e-28
WP_003792090.1|1871001_1871958_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003792088.1|1872035_1872446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538342.1|1872705_1875489_+|tRNA	isoleucine--tRNA ligase	tRNA	L7Y3E1	Megavirus	25.4	2.1e-74
WP_032828320.1|1875569_1877420_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	2.4e-29
WP_003792084.1|1877583_1879785_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_143449209.1|1880139_1882143_+	recombinase	NA	NA	NA	NA	NA
WP_080571754.1|1882368_1882629_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003788129.1|1883047_1883230_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP045141	Kingella kingae strain F41215CHC chromosome, complete genome	2014880	1951865	1999279	2014880	tRNA,transposase	Agrobacterium_phage(14.29%)	45	NA	NA
WP_038302661.1|1951865_1952330_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_038302659.1|1952441_1953119_-	ComF family protein	NA	NA	NA	NA	NA
WP_038302657.1|1953117_1953861_+	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_003791957.1|1953928_1954243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003788553.1|1954288_1954918_-	endonuclease III	NA	NA	NA	NA	NA
WP_003788550.1|1954914_1956135_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_003788548.1|1956167_1956716_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A223VZK2	Agrobacterium_phage	31.7	2.8e-10
WP_050855123.1|1956753_1957254_-	DUF1304 family protein	NA	NA	NA	NA	NA
WP_003791953.1|1957258_1957870_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.5	4.0e-42
WP_032132963.1|1957919_1958402_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_003788541.1|1958721_1958943_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003788540.1|1959026_1959440_+	membrane protein	NA	NA	NA	NA	NA
WP_038310358.1|1959451_1959922_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003791944.1|1959966_1960611_-	membrane protein	NA	NA	NA	NA	NA
WP_003791941.1|1960585_1960993_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_003791940.1|1961211_1963071_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_164538384.1|1963166_1963874_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_003791934.1|1963870_1965058_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	38.2	6.3e-60
WP_003791928.1|1965251_1965755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538080.1|1966159_1966681_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_003789355.1|1966708_1966945_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_164538385.1|1967212_1968220_-	thiamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003791918.1|1969703_1972451_-	lactoferrin/transferrin family TonB-dependent receptor	NA	NA	NA	NA	NA
WP_164538348.1|1972546_1974301_-	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_003789097.1|1975085_1975436_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003789098.1|1975689_1975953_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	32.9	4.4e-06
WP_003791909.1|1976158_1977790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538349.1|1977933_1979760_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_038310350.1|1979931_1981194_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_164538350.1|1981399_1983454_+	adhesin	NA	NA	NA	NA	NA
WP_038304754.1|1983593_1984292_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_038307311.1|1984342_1985680_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_032828196.1|1986034_1986658_-	YdcF family protein	NA	NA	NA	NA	NA
WP_144005571.1|1986659_1987010_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_003791891.1|1987165_1988539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003791890.1|1988935_1990450_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_019390239.1|1990442_1990550_+	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_003791888.1|1990641_1991367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002642891.1|1991420_1991576_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003788491.1|1991593_1991830_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_164538386.1|1992047_1992740_-	phosphoesterase	NA	A0A2H5BGP7	Vibrio_virus	36.7	4.2e-24
WP_003791883.1|1992726_1993098_-|transposase	IS1 transposase	transposase	A0A218MNG1	uncultured_virus	48.6	8.1e-14
WP_164538388.1|1993207_1993648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164538387.1|1994522_1995215_+	site-specific DNA-methyltransferase	NA	A0A1B0XVP8	Campylobacter_phage	64.2	1.6e-31
WP_164538389.1|1998595_1999279_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
