The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	56788	62609	4828450		Enterobacteria_phage(100.0%)	9	NA	NA
WP_164539759.1|56788_59122_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
WP_164539760.1|59136_59457_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_164539761.1|59453_59681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539762.1|59677_60229_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.2	1.1e-30
WP_164539763.1|60225_60492_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	4.1e-28
WP_164539751.1|60833_61013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539764.1|61054_61786_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	57.3	9.5e-67
WP_164539765.1|61782_62046_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	9.1e-20
WP_164539766.1|62042_62609_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.6	4.3e-59
>prophage 2
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	567611	594811	4828450	transposase	Salmonella_phage(60.0%)	21	NA	NA
WP_001395480.1|567611_568643_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_024551180.1|570043_570886_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024551181.1|570872_572996_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164539838.1|573817_574786_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	1.1e-184
WP_033144814.1|577120_578047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097217.1|578409_578709_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001189111.1|580860_582369_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_004364961.1|583656_584064_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004364974.1|584159_585056_+	cation transporter	NA	NA	NA	NA	NA
WP_000427623.1|585813_586818_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_024552202.1|586896_587331_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_024552203.1|587402_587753_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_024552204.1|587765_588041_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_024552205.1|588068_588491_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_024552206.1|588530_590216_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.9e-38
WP_021138753.1|590233_590599_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_021138754.1|590595_590832_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_024552207.1|590828_591818_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_016236504.1|591947_592505_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
WP_016236505.1|592507_593728_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	56.4	1.3e-116
WP_000427623.1|593806_594811_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	934021	993889	4828450	integrase,tail,capsid,holin,head	Cronobacter_phage(24.53%)	82	981592:981627	994006:994041
WP_164539895.1|934021_935185_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	93.2	1.1e-213
WP_164539896.1|935521_935764_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	56.2	5.6e-16
WP_164539897.1|936036_936393_-	hypothetical protein	NA	G8C7S4	Escherichia_phage	90.6	1.3e-53
WP_164539898.1|936392_936704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164541184.1|936703_936916_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	51.1	6.7e-05
WP_150870673.1|936952_937447_-	hypothetical protein	NA	A0A0H5ARI7	Pseudomonas_phage	46.1	3.5e-28
WP_150870675.1|937443_937995_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.7	4.1e-54
WP_150870677.1|937991_938150_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	52.9	6.2e-08
WP_150870679.1|938146_938476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539899.1|938532_938709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150870681.1|938723_939146_-	single-stranded DNA-binding protein	NA	A0A2H4JHK3	uncultured_Caudovirales_phage	71.6	7.5e-48
WP_164539900.1|939146_939782_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	51.7	2.4e-50
WP_072036738.1|939789_939960_-	hypothetical protein	NA	A5VWA7	Enterobacteria_phage	66.1	2.4e-13
WP_139565471.1|940033_940231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156238543.1|940262_940472_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	84.1	1.2e-27
WP_164539901.1|940468_940627_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	71.2	2.9e-13
WP_164539902.1|940623_941004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539903.1|941137_941776_-	AP2 domain-containing protein	NA	L0AQZ0	Klebsiella_phage	45.1	9.2e-50
WP_164539904.1|941943_942117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539905.1|942113_942278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539906.1|942469_942718_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	47.4	1.6e-05
WP_164539907.1|943092_943725_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.5	9.8e-36
WP_069219614.1|943823_944039_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	56.7	4.7e-14
WP_164539908.1|944155_944440_+	hypothetical protein	NA	K7PK23	Enterobacteria_phage	81.9	2.7e-33
WP_150870699.1|944620_945523_+	DNA replication protein	NA	A0A1I9KG10	Aeromonas_phage	44.5	1.3e-28
WP_164539909.1|945522_946857_+	DNA helicase	NA	A0A2I7S0U1	Vibrio_phage	37.5	1.5e-78
WP_164539910.1|946860_947181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539911.1|947177_947432_+	hypothetical protein	NA	A2I2Z5	Vibrio_virus	39.6	6.3e-10
WP_164539912.1|947428_947836_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	49.0	2.4e-11
WP_164539913.1|947840_948101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539914.1|950397_950850_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.7	2.4e-36
WP_164539915.1|950842_951448_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	55.7	4.2e-44
WP_164539916.1|951444_951555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539917.1|951554_952244_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.2	1.7e-57
WP_061353777.1|952573_952972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094337420.1|952968_953250_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	39.7	3.1e-10
WP_164539918.1|953246_953789_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	71.2	9.2e-75
WP_164539919.1|953785_954058_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.9	1.3e-08
WP_164539920.1|954366_954771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539921.1|954870_955509_+	hypothetical protein	NA	I6S676	Salmonella_phage	90.1	1.5e-113
WP_164539922.1|955541_956021_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.7	1.3e-56
WP_164539923.1|956007_957480_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.1	2.7e-254
WP_164539924.1|957491_958940_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	50.8	1.1e-119
WP_164541185.1|958971_959874_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.0	4.1e-112
WP_164539925.1|959900_960173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539926.1|960409_961795_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.1	5.7e-153
WP_023311436.1|961798_962230_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	71.3	4.3e-51
WP_023311437.1|962241_963327_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	68.4	2.3e-141
WP_023311438.1|963338_963704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539927.1|963780_964164_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.6	5.7e-47
WP_164539928.1|964266_964812_+	HNH endonuclease	NA	A0A1U9WR09	Escherichia_phage	42.0	4.8e-23
WP_164539929.1|964868_965039_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	53.7	9.1e-13
WP_164539930.1|965035_965542_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	45.8	2.4e-32
WP_164539931.1|965538_965895_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	61.5	6.7e-34
WP_164539932.1|965897_966338_+	HK97 gp10 family phage protein	NA	A0A1V0E5P5	Salmonella_phage	50.4	6.0e-32
WP_164539933.1|966334_966718_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	4.4e-39
WP_164539934.1|966781_967525_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	84.4	1.9e-75
WP_164539935.1|967585_968257_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	51.4	9.4e-53
WP_164539936.1|968333_968636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539937.1|968691_971604_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	37.1	4.3e-94
WP_059364068.1|971613_972084_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	56.8	5.9e-54
WP_059364066.1|972080_972569_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.0	1.2e-52
WP_097455176.1|972578_972959_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.8	1.8e-53
WP_164539938.1|972955_976039_+	kinase	NA	A0A286S259	Klebsiella_phage	53.6	1.1e-310
WP_164539939.1|976096_978715_+|tail	tail fiber domain-containing protein	tail	A0A2H4YDM8	Escherichia_virus	30.0	2.4e-35
WP_164539940.1|978980_980810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539941.1|980901_981141_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	73.4	2.8e-28
WP_164539942.1|981140_981458_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.5	3.4e-21
981592:981627	attL	GAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
WP_164539943.1|982248_982401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539944.1|982530_983445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539945.1|984323_984881_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	40.3	9.6e-27
WP_040215124.1|986264_986702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134083049.1|986848_987037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050849762.1|987008_988049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072040108.1|988055_988712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040215129.1|988812_989181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040215132.1|990004_990340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539946.1|990365_991424_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
WP_164539947.1|991505_991715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164539948.1|991744_992146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164541186.1|992183_992420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164539949.1|992674_993889_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
994006:994041	attR	GAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 4
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	1872453	1916042	4828450	integrase,tail,portal,protease,terminase,tRNA,capsid,head	Enterobacteria_phage(35.14%)	52	1863589:1863603	1892872:1892886
1863589:1863603	attL	CACCAGCAGGCAACC	NA	NA	NA	NA
WP_032617591.1|1872453_1873563_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032617592.1|1873604_1874078_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032617593.1|1874070_1874742_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032617594.1|1874859_1876110_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	4.7e-21
WP_164540127.1|1876226_1877357_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.8	4.4e-119
WP_164540128.1|1877337_1877583_-	excisionase	NA	NA	NA	NA	NA
WP_164540129.1|1877635_1880587_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	57.2	2.9e-170
WP_164541191.1|1880724_1881054_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_164540130.1|1881110_1881293_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_164539752.1|1881289_1881484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540131.1|1881703_1882084_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	68.1	3.8e-19
WP_114315313.1|1882190_1882433_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	5.6e-16
WP_164540132.1|1882413_1882968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540133.1|1883022_1883829_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	47.0	5.8e-57
WP_130588675.1|1883831_1884572_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.0	5.2e-97
WP_164540134.1|1884590_1885010_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_164540135.1|1885457_1886462_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_164540136.1|1886463_1887483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540137.1|1887486_1888602_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	27.2	7.3e-18
WP_059308241.1|1889555_1889756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540138.1|1889758_1890115_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	67.2	1.8e-42
WP_164540139.1|1890114_1891152_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.9	1.1e-105
WP_164540140.1|1891163_1891985_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	47.2	7.0e-58
WP_063160072.1|1892244_1892673_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	91.6	9.8e-64
WP_164540141.1|1892705_1892825_+	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	77.8	1.2e-06
WP_103826528.1|1893012_1893243_+	hypothetical protein	NA	G0ZNC7	Cronobacter_phage	69.9	9.4e-21
1892872:1892886	attR	GGTTGCCTGCTGGTG	NA	NA	NA	NA
WP_103826555.1|1893250_1893745_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	78.0	1.4e-69
WP_164540142.1|1893741_1894092_+	hypothetical protein	NA	C9EH95	Sodalis_phage	45.9	6.0e-11
WP_164540143.1|1894268_1894448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540144.1|1894560_1895310_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4J9L7	uncultured_Caudovirales_phage	47.5	1.5e-59
WP_164541192.1|1895372_1895723_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	78.9	6.0e-51
WP_164540145.1|1895719_1895935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529882.1|1896130_1896604_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	90.4	9.2e-79
WP_085451494.1|1896603_1898361_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	92.0	0.0e+00
WP_164540146.1|1898360_1899665_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.2	8.9e-225
WP_164540147.1|1899673_1900528_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.8	2.8e-118
WP_164540148.1|1900540_1901761_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	95.3	2.4e-211
WP_164540149.1|1901814_1902000_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	76.1	2.2e-12
WP_164529877.1|1902009_1902336_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	51.9	2.1e-26
WP_164540150.1|1902332_1902674_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	43.8	2.0e-06
WP_164540151.1|1902670_1903120_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	85.9	2.9e-66
WP_063160062.1|1903116_1903446_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	52.7	1.0e-23
WP_164540152.1|1903506_1904211_+|tail	phage tail protein	tail	Q9MCS7	Enterobacteria_phage	83.8	7.0e-107
WP_164540153.1|1904245_1904632_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.0	7.5e-63
WP_164540154.1|1904640_1904919_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	74.7	9.3e-31
WP_164540155.1|1904974_1905577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540156.1|1905636_1909092_+	tape measure protein	NA	A0A2H4JHR1	uncultured_Caudovirales_phage	89.8	9.8e-271
WP_164530101.1|1909096_1909564_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.9	1.5e-49
WP_164540157.1|1909560_1910049_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	70.5	1.6e-57
WP_164540158.1|1910208_1910613_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	74.4	1.5e-50
WP_164540159.1|1910609_1913696_+	kinase	NA	A0A286S259	Klebsiella_phage	50.9	2.6e-291
WP_164540160.1|1913753_1916042_+|tail	tail fiber domain-containing protein	tail	A0A1P8BK41	Escherichia_virus	37.1	1.1e-23
>prophage 5
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	2095720	2203613	4828450	tail,protease,terminase,tRNA,lysis,coat	Escherichia_phage(41.18%)	106	NA	NA
WP_032617839.1|2095720_2096995_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.6	1.0e-84
WP_164540215.1|2097058_2097919_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_032617842.1|2098003_2098609_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_032617843.1|2098717_2100226_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_032617844.1|2100840_2101476_-	endonuclease III	NA	NA	NA	NA	NA
WP_032617845.1|2101472_2102159_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_032617846.1|2102161_2102782_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_032617847.1|2102792_2103845_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_164540216.1|2106627_2107206_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_032617852.1|2107205_2107787_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_032617853.1|2107863_2108304_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_032617854.1|2108390_2108606_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_032617855.1|2108809_2108980_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_032617856.1|2109213_2110254_+	oxidoreductase	NA	NA	NA	NA	NA
WP_032617857.1|2110286_2111288_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_164540217.1|2111401_2112631_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	50.2	7.4e-112
WP_164540218.1|2112632_2112851_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	57.7	4.6e-17
WP_164540219.1|2112915_2113155_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	82.1	6.1e-31
WP_164540220.1|2113192_2114233_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	72.7	1.2e-147
WP_164540221.1|2114247_2118006_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	57.0	0.0e+00
WP_164540222.1|2118428_2118617_-	hypothetical protein	NA	A0A1L2CVD0	Pectobacterium_phage	37.9	7.0e-06
WP_164541194.1|2118846_2119206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540223.1|2119303_2119564_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164540224.1|2119566_2120121_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	39.5	3.2e-22
WP_164541195.1|2120305_2121292_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.6	8.4e-50
WP_164540225.1|2121275_2121965_+	phage replication protein	NA	G8C7U6	Escherichia_phage	58.1	6.9e-75
WP_164540226.1|2121975_2122239_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	66.2	7.2e-25
WP_164540227.1|2122231_2122594_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	47.4	2.1e-06
WP_164540228.1|2122593_2122806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540229.1|2122936_2123965_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	96.8	7.6e-187
WP_164540230.1|2124510_2124798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540231.1|2125648_2125843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540232.1|2125900_2126497_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	60.7	9.5e-65
WP_164540233.1|2126501_2126702_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	56.1	5.1e-15
WP_164540234.1|2126704_2126995_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	90.5	4.5e-44
WP_164540235.1|2126991_2127354_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	9.5e-52
WP_058648282.1|2127350_2127491_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	2.1e-07
WP_164540236.1|2127487_2128321_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.3	4.7e-118
WP_164540237.1|2129032_2129224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051916132.1|2129973_2130204_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	59.2	1.3e-17
WP_072010784.1|2130211_2130709_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	75.8	4.6e-73
WP_164540238.1|2130698_2131151_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	59.0	1.8e-36
WP_164540239.1|2131560_2131758_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.6	1.8e-25
WP_164540240.1|2132258_2132567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540241.1|2132944_2133133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540242.1|2133139_2134138_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.5	7.7e-43
WP_032611827.1|2134115_2135420_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.5	2.7e-149
WP_164540243.1|2135424_2136831_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.4	1.4e-239
WP_164540244.1|2136832_2137936_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.5	1.8e-189
WP_164540245.1|2138061_2138814_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.8	2.2e-127
WP_164540246.1|2138830_2139967_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	92.6	4.9e-195
WP_164539753.1|2140007_2140325_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	89.7	2.6e-13
WP_164540247.1|2140327_2140810_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	83.8	3.0e-77
WP_164540248.1|2140811_2141165_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.6	2.4e-52
WP_164540249.1|2141167_2141767_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	3.8e-98
WP_164540250.1|2141756_2142206_+	hypothetical protein	NA	G8C7Q2	Escherichia_phage	91.9	3.2e-73
WP_164540251.1|2142252_2143185_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	93.5	3.9e-158
WP_164540252.1|2143249_2143588_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	83.9	3.7e-50
WP_032618003.1|2143605_2143893_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_164540253.1|2143892_2147036_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	57.9	4.0e-271
WP_164540254.1|2147110_2147494_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	43.4	4.1e-21
WP_164540255.1|2147986_2148262_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_164540256.1|2148577_2148928_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	92.2	4.0e-55
WP_164540257.1|2148936_2149710_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	86.7	9.0e-132
WP_164540258.1|2149722_2150454_+	peptidase P60	NA	G8C7R2	Escherichia_phage	91.3	9.0e-142
WP_156654713.1|2150441_2151035_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	88.0	2.9e-90
WP_164540259.1|2151090_2156025_+	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	43.3	4.7e-16
WP_164540260.1|2156089_2157760_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	28.2	7.9e-24
WP_164540261.1|2157759_2158062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540262.1|2158073_2159072_+|tail	tail fiber domain-containing protein	tail	O64338	Escherichia_phage	48.3	1.1e-41
WP_164540263.1|2159736_2161014_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_164540264.1|2161077_2163075_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_164540265.1|2163697_2164870_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_164540266.1|2164918_2166511_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_032617860.1|2166689_2167718_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_032617861.1|2167797_2169363_-	YdgA family protein	NA	NA	NA	NA	NA
WP_032617862.1|2169464_2170637_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_032617863.1|2170837_2172484_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_032617864.1|2172648_2174040_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_032617865.1|2174040_2174970_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_032617866.1|2175043_2176342_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	1.6e-16
WP_032617867.1|2176421_2177192_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.1	1.9e-09
WP_072250803.1|2177191_2178181_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_164540267.1|2178237_2179254_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032617870.1|2179398_2180115_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_077226677.1|2180243_2180579_+	GlpM family protein	NA	NA	NA	NA	NA
WP_059308044.1|2180575_2181298_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_059308043.1|2181336_2182719_-	amino acid permease	NA	NA	NA	NA	NA
WP_032617874.1|2182905_2183859_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032617875.1|2184395_2185925_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_164540268.1|2185935_2187324_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_032617877.1|2187438_2188554_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_164540269.1|2188589_2189540_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_032617879.1|2189675_2190428_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_032617880.1|2190610_2191126_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.7	5.9e-23
WP_164540270.1|2191136_2192663_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_103793209.1|2192699_2194145_-	amidohydrolase	NA	NA	NA	NA	NA
WP_130588933.1|2194144_2195455_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_059308039.1|2195630_2196539_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164540271.1|2196885_2197449_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_164540272.1|2197452_2198409_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_032617887.1|2198405_2199443_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_059308037.1|2199859_2200222_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_032617889.1|2200208_2200538_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_164540273.1|2200624_2202787_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	32.5	2.8e-13
WP_032617890.1|2202788_2203613_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	2277509	2291331	4828450		Escherichia_phage(11.11%)	14	NA	NA
WP_164540304.1|2277509_2278979_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	1.6e-121
WP_032617956.1|2279129_2279435_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_164541198.1|2279505_2280252_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_059307997.1|2280291_2280621_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_032617958.1|2280769_2281096_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.4e-22
WP_032617959.1|2281206_2282421_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	2.8e-47
WP_117386567.1|2282432_2283446_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.9	5.1e-18
WP_059307995.1|2283499_2284879_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.2	2.2e-27
WP_164540306.1|2285160_2286624_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	8.6e-43
WP_032618022.1|2286668_2286872_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	61.2	2.6e-14
WP_032618023.1|2287136_2287568_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	36.6	5.3e-17
WP_032618024.1|2287608_2288295_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032618025.1|2288386_2289133_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_059307993.1|2289285_2291331_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.8	7.6e-21
>prophage 7
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	2916353	3009546	4828450	integrase,tail,portal,transposase,plate,protease,terminase,tRNA,capsid,holin,head	Shigella_phage(26.67%)	105	2937022:2937038	2999489:2999505
WP_032611530.1|2916353_2917235_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032611532.1|2917428_2919477_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.0	1.8e-83
WP_032611533.1|2919496_2920183_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_059349896.1|2920280_2920778_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_059307645.1|2920909_2922193_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_032611541.1|2922161_2924795_+	PqiB family protein	NA	NA	NA	NA	NA
WP_082697324.1|2924770_2926315_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_032611546.1|2926418_2926658_+	YebV family protein	NA	NA	NA	NA	NA
WP_032611549.1|2926761_2926953_+	YebW family protein	NA	NA	NA	NA	NA
WP_164540600.1|2926953_2927598_-	protein-serine/threonine phosphatase	NA	M9P0E4	Enterobacteria_phage	49.8	1.3e-59
WP_155166975.1|2927776_2928724_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_032611900.1|2929123_2929462_-	YebY family protein	NA	NA	NA	NA	NA
WP_032611902.1|2929476_2930349_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_059307641.1|2930350_2930725_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_032611906.1|2930860_2931091_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	66.2	5.3e-16
WP_164540602.1|2931198_2931855_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_032611910.1|2931879_2932542_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	38.5	1.1e-05
WP_164540604.1|2932523_2934605_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_164540606.1|2934695_2935346_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_164541210.1|2935433_2935787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077227048.1|2935936_2937115_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
2937022:2937038	attL	CCGTCTGGGCGTGGCGC	NA	NA	NA	NA
WP_059307637.1|2937238_2937880_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_164540608.1|2937919_2939731_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_059307635.1|2939962_2941438_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	5.4e-77
WP_071886436.1|2941759_2942665_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032611932.1|2942788_2944231_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_059349894.1|2944303_2945275_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_032611935.1|2945391_2946714_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.5	2.0e-14
WP_032611938.1|2946729_2947674_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_032611939.1|2947752_2948508_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	1.7e-18
WP_032611941.1|2948504_2949290_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_032611943.1|2949379_2950390_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.6	6.2e-08
WP_032611945.1|2950398_2951010_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_032611947.1|2951092_2951614_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	1.3e-09
WP_032611949.1|2951648_2952389_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032611952.1|2952529_2952973_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_032611955.1|2952974_2954747_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_059307632.1|2954987_2955554_+	hydrolase	NA	NA	NA	NA	NA
WP_164541211.1|2955983_2956223_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	91.1	2.2e-33
WP_164540609.1|2956615_2956978_+	GtrA family protein	NA	U5P0S6	Shigella_phage	78.3	4.6e-46
WP_164540611.1|2956974_2957898_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	89.1	3.7e-156
WP_164540612.1|2957894_2959352_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	24.2	4.4e-23
WP_164540613.1|2960245_2960701_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	49.4	8.4e-13
WP_164540614.1|2961320_2961902_-	YmfQ family protein	NA	O22003	Shigella_phage	78.8	2.4e-89
WP_164540615.1|2961892_2962951_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	79.5	9.9e-166
WP_164540616.1|2962943_2963363_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	79.9	3.2e-59
WP_164540617.1|2963365_2963908_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	70.6	3.7e-68
WP_164540619.1|2963907_2964978_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	81.9	1.1e-169
WP_164540621.1|2964980_2965265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540623.1|2965264_2966761_-	LamG domain-containing protein	NA	A0A0E3M194	Enterobacteria_phage	28.3	6.4e-25
WP_164540625.1|2966769_2968191_-	DNA circularization protein	NA	M1FPN5	Enterobacteria_phage	68.6	1.6e-171
WP_164540627.1|2968247_2968772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540629.1|2968841_2970632_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	70.0	1.7e-218
WP_164540630.1|2970773_2971043_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	76.4	1.0e-34
WP_164540632.1|2971042_2971399_-|tail	phage tail protein	tail	U5P076	Shigella_phage	86.4	1.4e-55
WP_164540634.1|2971398_2972895_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	75.1	2.6e-212
WP_164540636.1|2972891_2973074_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	73.3	2.4e-11
WP_164540637.1|2973082_2973643_-	hypothetical protein	NA	S5FM61	Shigella_phage	79.6	1.7e-84
WP_164540639.1|2973639_2974146_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	84.5	9.8e-79
WP_164540641.1|2974120_2974534_-|head	phage head closure protein	head	U5P0R0	Shigella_phage	67.9	1.2e-47
WP_139563416.1|2974530_2974854_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	63.6	8.0e-34
WP_151585463.1|2974926_2976144_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	74.3	7.2e-168
WP_164540642.1|2976153_2976753_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.5	7.3e-89
WP_164540644.1|2976745_2977972_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	91.4	1.3e-222
WP_164540646.1|2977961_2978123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151585472.1|2978119_2979853_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	95.1	0.0e+00
WP_151585475.1|2979849_2980344_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.1	4.9e-83
WP_164540648.1|2980474_2980825_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	82.8	5.2e-55
WP_164540650.1|2981073_2981331_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	54.8	1.1e-14
WP_164540652.1|2981445_2981586_-	hypothetical protein	NA	A0A291AX22	Salmonella_phage	48.9	4.4e-05
WP_164540654.1|2981560_2981911_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.2	3.3e-09
WP_164540655.1|2981907_2982522_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	79.3	2.7e-91
WP_103822564.1|2982521_2982803_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	44.8	4.5e-17
WP_164540657.1|2982789_2983176_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	95.3	3.3e-58
WP_164540659.1|2983386_2984184_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.2	1.0e-66
WP_164540661.1|2984388_2985192_-	antitermination protein	NA	F1C595	Cronobacter_phage	78.5	9.1e-111
WP_164540662.1|2985191_2986049_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	83.2	8.7e-136
WP_164540664.1|2986048_2987014_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	85.0	3.0e-161
WP_164540666.1|2987010_2988621_-	DEAD/DEAH box helicase	NA	F1C598	Cronobacter_phage	87.1	6.6e-278
WP_164540668.1|2989046_2989343_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	79.0	7.1e-29
WP_139563119.1|2989326_2989557_-	helix-turn-helix domain-containing protein	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.1	2.7e-12
WP_139563120.1|2989676_2990366_+	helix-turn-helix domain-containing protein	NA	F1C5C2	Cronobacter_phage	66.2	7.3e-85
WP_164540669.1|2990548_2990869_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	55.9	9.7e-24
WP_139563122.1|2990858_2991056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139563123.1|2991235_2991460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540671.1|2991460_2991841_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	68.6	1.0e-40
WP_164540673.1|2991818_2992040_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	66.2	9.0e-21
WP_164540674.1|2992032_2992245_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	46.7	1.2e-09
WP_164540676.1|2992505_2992868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540678.1|2992860_2993106_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	88.2	1.7e-36
WP_164540680.1|2993161_2994475_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	84.6	8.7e-220
WP_164541212.1|2994453_2995227_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.2e-59
WP_032611959.1|2995278_2995674_+	membrane protein	NA	NA	NA	NA	NA
WP_077227042.1|2995714_2996455_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.7	4.1e-25
WP_032611961.1|2996451_2997423_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_164540682.1|2997615_2998359_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_164541213.1|2998444_2999005_-	VOC family protein	NA	NA	NA	NA	NA
WP_032611966.1|2999180_3000914_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
2999489:2999505	attR	CCGTCTGGGCGTGGCGC	NA	NA	NA	NA
WP_032611967.1|3001002_3002142_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_032611968.1|3002146_3003730_-	MFS transporter	NA	NA	NA	NA	NA
WP_032612114.1|3003990_3004383_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_164540684.1|3004382_3006461_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_032612116.1|3006453_3007602_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_032611970.1|3007820_3008465_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000654812.1|3008577_3009546_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
>prophage 8
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	3560947	3650316	4828450	transposase,tail,portal,protease,terminase,tRNA,lysis	Enterobacteria_phage(25.0%)	91	NA	NA
WP_164540807.1|3560947_3561685_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_032613193.1|3561817_3563140_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	1.9e-44
WP_032613195.1|3563196_3563580_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	68.9	7.5e-31
WP_155167138.1|3563893_3564583_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	48.6	6.0e-55
WP_059307385.1|3564687_3565788_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_059307384.1|3565994_3566414_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	1.6e-13
WP_032613203.1|3566486_3567185_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_164540809.1|3567220_3569884_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_032613208.1|3569994_3571350_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032613222.1|3571393_3571717_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_164540811.1|3571713_3573021_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	2.0e-43
WP_032613212.1|3573173_3573629_-	DUF4385 domain-containing protein	NA	A0A0C5AAP9	Cyanophage	48.7	2.3e-34
WP_032613229.1|3579210_3581784_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.7	3.5e-124
WP_032613231.1|3581913_3582645_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_032613233.1|3582641_3583622_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_032613235.1|3583752_3584490_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_032613238.1|3584761_3585103_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032613240.1|3585369_3586530_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_032613242.1|3586526_3587399_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_144882591.1|3587459_3588581_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_032613246.1|3588591_3589662_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	2.0e-89
WP_077227868.1|3589876_3590251_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_077227867.1|3590341_3590935_+	YfiR family protein	NA	NA	NA	NA	NA
WP_032613252.1|3590927_3592148_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_077227866.1|3592161_3592644_+	OmpA family protein	NA	NA	NA	NA	NA
WP_164540812.1|3592648_3594016_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_077227873.1|3594078_3594399_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3594598_3594946_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_032613261.1|3594987_3595755_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_059307374.1|3595785_3596319_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_022649067.1|3596337_3596586_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_032613265.1|3596901_3598263_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_163604565.1|3598354_3599221_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032613269.1|3599239_3600526_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_032613272.1|3600579_3601173_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077227861.1|3601294_3602173_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_032613276.1|3602258_3603920_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_032613277.1|3604071_3604413_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_059307371.1|3604509_3604797_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071886427.1|3604786_3605263_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_014071418.1|3605380_3605863_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	2.0e-28
WP_088569505.1|3607704_3608911_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	2.6e-101
WP_164540814.1|3609222_3611241_-	flagellin FliC	NA	NA	NA	NA	NA
WP_164540816.1|3611775_3611940_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	75.9	1.2e-14
WP_164540818.1|3612025_3612436_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_164540819.1|3612936_3613926_-|tail	tail fiber domain-containing protein	tail	O64338	Escherichia_phage	50.0	1.0e-42
WP_164540820.1|3613935_3614238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540822.1|3614237_3616091_-	LamG domain-containing protein	NA	A0A1V0E5M2	Salmonella_phage	54.0	1.3e-32
WP_164540824.1|3616147_3617110_-	hypothetical protein	NA	A0A2P1CKS0	Pantoea_phage	35.5	1.2e-40
WP_164540826.1|3617106_3620478_-|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	76.8	0.0e+00
WP_164540828.1|3620529_3621120_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	78.6	1.0e-82
WP_164540830.1|3621160_3621571_-	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	51.9	3.5e-34
WP_164540832.1|3621603_3622314_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	86.4	2.6e-130
WP_164540834.1|3622315_3623071_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	87.3	1.2e-128
WP_164540835.1|3623067_3623415_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	68.7	3.6e-40
WP_164540837.1|3623414_3625919_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	61.7	4.3e-268
WP_164540839.1|3625899_3626208_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	54.1	1.0e-22
WP_164540841.1|3626228_3626639_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	43.8	1.7e-20
WP_164540843.1|3626680_3627418_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	71.8	4.1e-94
WP_164540845.1|3627425_3627824_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	62.8	5.2e-43
WP_164540846.1|3627820_3628375_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	60.9	1.1e-41
WP_164540848.1|3628385_3628661_-	ATP-binding protein	NA	Q8VNN4	Enterobacteria_phage	44.0	2.1e-14
WP_164541219.1|3628653_3628980_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_164540850.1|3629060_3631136_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	81.8	0.0e+00
WP_164540852.1|3631017_3632523_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	73.1	2.2e-214
WP_059308232.1|3632519_3632741_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	67.6	8.5e-19
WP_164540854.1|3632737_3634840_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	77.1	0.0e+00
WP_164540856.1|3634839_3635328_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	82.7	2.3e-69
WP_164540858.1|3635972_3636281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540860.1|3636514_3636736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540862.1|3636781_3637252_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	70.9	1.2e-49
WP_164540864.1|3637241_3637739_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.4	4.2e-74
WP_164540866.1|3637746_3637977_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	56.6	8.2e-17
WP_164540868.1|3639021_3639300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164540869.1|3639580_3640330_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_164540871.1|3640352_3640706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540873.1|3640709_3641324_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.9	2.4e-31
WP_164541220.1|3641340_3641685_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	6.3e-53
WP_164540874.1|3641765_3642620_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	81.4	1.7e-131
WP_164540876.1|3642619_3643585_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	84.7	2.0e-160
WP_164540877.1|3643581_3645201_-	DEAD/DEAH box helicase	NA	F1C598	Cronobacter_phage	86.1	3.6e-276
WP_164540878.1|3645627_3645924_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	77.8	2.1e-28
WP_139563119.1|3645907_3646138_-	helix-turn-helix domain-containing protein	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.1	2.7e-12
WP_139563120.1|3646257_3646947_+	helix-turn-helix domain-containing protein	NA	F1C5C2	Cronobacter_phage	66.2	7.3e-85
WP_164541221.1|3647129_3647450_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	49.0	2.1e-18
WP_164540880.1|3647439_3647637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540882.1|3647814_3648186_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	49.5	9.9e-20
WP_164540883.1|3648167_3648401_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	70.1	5.4e-24
WP_164540885.1|3648393_3648606_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	45.0	3.4e-09
WP_164539754.1|3648795_3648990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164540887.1|3649143_3650316_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	89.7	2.3e-203
>prophage 9
NZ_CP043397	Leclercia adecarboxylata strain L21 chromosome, complete genome	4828450	3725797	3733242	4828450		Mycobacterium_phage(33.33%)	7	NA	NA
WP_071886424.1|3725797_3726058_+	glutaredoxin-like protein NrdH	NA	A0A222ZNS6	Mycobacterium_phage	42.9	1.1e-06
WP_077226180.1|3726054_3726465_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.7	2.7e-18
WP_164540931.1|3726437_3728582_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.0	5.4e-195
WP_151586246.1|3728591_3729551_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.9	1.4e-134
WP_164540933.1|3729631_3730252_+	LysE family translocator	NA	NA	NA	NA	NA
WP_032613504.1|3730440_3730653_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_164540935.1|3731094_3733242_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.6	3.0e-28
