The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	22976	72269	4649235	protease,transposase	Leptospira_phage(20.0%)	39	NA	NA
WP_004906266.1|22976_23552_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_110592762.1|23718_26232_+	penicillin acylase	NA	NA	NA	NA	NA
WP_096863658.1|26269_26932_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_110592761.1|27006_28416_+	MFS transporter	NA	NA	NA	NA	NA
WP_110592760.1|28464_29961_-	MFS transporter	NA	NA	NA	NA	NA
WP_110592759.1|30056_30596_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_137018850.1|30662_31460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353740.1|32136_32376_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_070342364.1|33926_34772_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000777554.1|34768_35242_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_001206316.1|35258_36050_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|36213_36561_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|36554_37394_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|37798_39340_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_165119627.1|39550_40408_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|40418_41057_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|41061_41427_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|41430_42243_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_000050481.1|43452_44994_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_165119627.1|45204_46062_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|46072_46711_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|46715_47081_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|47084_47897_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_000050481.1|49106_50648_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|52046_52820_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|52800_53082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|53301_53487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|53535_54720_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|55118_56594_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|56649_57534_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000753551.1|58177_59737_-|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000781558.1|59829_60186_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000555098.1|60188_60473_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|61748_62453_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018326.1|62706_63522_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|63711_64416_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538080.1|64440_66015_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_137018855.1|69464_70270_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	36.7	4.5e-33
WP_001029679.1|71447_72269_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	1305320	1315461	4649235	integrase	Morganella_phage(42.86%)	14	1306557:1306573	1319020:1319036
WP_096863250.1|1305320_1306178_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.8	9.3e-29
1306557:1306573	attL	GGGGGCATAATTGGGGG	NA	NA	NA	NA
WP_110592235.1|1306607_1307819_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	6.5e-129
WP_110592234.1|1308033_1308759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592233.1|1308879_1309098_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	3.3e-07
WP_110592232.1|1309097_1309490_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	51.4	5.0e-30
WP_110592230.1|1309801_1310596_+	phage antirepressor Ant	NA	A0A0R6PJV6	Moraxella_phage	55.6	2.4e-23
WP_110592229.1|1310696_1310888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137018915.1|1310886_1311234_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_110592227.1|1311226_1311421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592226.1|1311413_1311620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592225.1|1311612_1311810_+	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	66.0	5.4e-09
WP_110592224.1|1311797_1312106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592223.1|1312105_1312648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592222.1|1312743_1315461_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	69.0	0.0e+00
1319020:1319036	attR	GGGGGCATAATTGGGGG	NA	NA	NA	NA
>prophage 3
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	1648955	1698777	4649235	head,holin,tRNA,lysis,tail,terminase	Pectobacterium_phage(17.95%)	60	NA	NA
WP_004261480.1|1648955_1649405_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	55.9	1.8e-31
WP_110592098.1|1650235_1652131_+	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
WP_004261473.1|1652470_1652602_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_004261469.1|1653002_1653518_+	membrane protein	NA	A0A1W6JNX6	Morganella_phage	83.0	1.9e-82
WP_137018936.1|1655198_1656350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110592095.1|1656543_1657725_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	69.0	2.4e-152
WP_068445436.1|1657679_1657889_-	excisionase	NA	I6PBM8	Cronobacter_phage	60.9	6.8e-18
WP_110592094.1|1657933_1658140_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	45.8	2.2e-05
WP_110592093.1|1658582_1658762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042844832.1|1658806_1659307_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	66.3	2.7e-52
WP_110592092.1|1659306_1661271_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.1	4.3e-122
WP_110592091.1|1661283_1661616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119783.1|1662251_1662671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110592089.1|1663036_1664194_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	27.8	2.9e-33
WP_110592088.1|1664203_1664896_-	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	54.9	1.1e-67
WP_110592087.1|1665000_1665210_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	64.2	7.5e-17
WP_110592086.1|1665281_1665737_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	51.4	6.0e-27
WP_110592085.1|1665754_1665979_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	51.4	1.1e-13
WP_165119670.1|1666933_1667671_+	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	40.9	5.1e-36
WP_110592081.1|1667901_1668132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165119672.1|1668245_1668416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592080.1|1668452_1668794_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.3	5.5e-33
WP_110592079.1|1668815_1669703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592078.1|1669809_1670403_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	57.7	8.8e-63
WP_110592077.1|1670414_1670729_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	1.2e-34
WP_110592076.1|1670716_1671250_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	55.1	2.6e-37
WP_110592075.1|1671443_1672628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592074.1|1672754_1672955_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	70.2	1.7e-18
WP_110592073.1|1672935_1673427_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	61.6	7.6e-52
WP_110592072.1|1673471_1674023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119674.1|1674109_1674283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592071.1|1674291_1674753_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	44.0	3.8e-13
WP_048607741.1|1675606_1675738_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_048607740.1|1676139_1676382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592070.1|1676786_1677059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592069.1|1677140_1678169_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	40.6	5.0e-37
WP_110592068.1|1678165_1678801_-	response regulator	NA	NA	NA	NA	NA
WP_110592067.1|1679039_1680437_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	3.0e-85
WP_110592066.1|1680441_1681944_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	44.2	6.9e-104
WP_110592065.1|1681981_1682710_+|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	39.4	3.5e-37
WP_110592064.1|1682706_1683963_+	DUF2213 domain-containing protein	NA	A0A2H5BG39	Pseudoalteromonas_phage	45.6	1.6e-37
WP_110592063.1|1683962_1684460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042844781.1|1684459_1685527_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	36.6	4.4e-52
WP_105881054.1|1685581_1685923_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	34.5	1.0e-07
WP_110592606.1|1685925_1686357_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	33.8	2.0e-11
WP_110592062.1|1686356_1686815_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	31.0	7.7e-06
WP_110592061.1|1686814_1687183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592060.1|1687172_1687688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592059.1|1687697_1689185_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.0	2.0e-79
WP_068445366.1|1689194_1689647_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.9	1.8e-23
WP_109911397.1|1689697_1690156_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.7	3.7e-24
WP_110592605.1|1690622_1692749_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.8	3.0e-20
WP_110592058.1|1692745_1693273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863415.1|1693276_1693570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110592057.1|1693562_1694378_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	28.5	6.3e-19
WP_110592056.1|1694381_1695074_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	40.8	1.4e-30
WP_110592055.1|1695070_1695415_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	36.6	2.4e-12
WP_110592054.1|1695407_1696595_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	38.9	2.2e-76
WP_110592053.1|1696591_1697251_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	41.3	2.1e-41
WP_110592052.1|1697256_1698777_+|tail	phage tail protein	tail	A0A0F6R6B6	Escherichia_coli_O157_typing_phage	40.6	5.1e-30
>prophage 4
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	2884034	2900599	4649235	integrase	Morganella_phage(75.0%)	24	2877720:2877747	2900686:2900713
2877720:2877747	attL	TTAGGTACAAGCTCAGGTACAAGCAAAA	NA	NA	NA	NA
WP_137019055.1|2884034_2887376_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	27.8	8.9e-35
WP_102139348.1|2887389_2887728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004255410.1|2887727_2887901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019058.1|2888084_2888618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019060.1|2888695_2888914_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_137019364.1|2888926_2889319_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	66.7	3.7e-17
WP_137019062.1|2889787_2892505_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	69.6	0.0e+00
WP_137019064.1|2892501_2892846_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	75.4	1.1e-46
WP_137019066.1|2892860_2893457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019068.1|2893453_2893675_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	39.2	1.1e-07
WP_137019070.1|2893674_2893863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004265069.1|2893862_2894036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019073.1|2894032_2894617_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	58.0	3.1e-28
WP_036960437.1|2894613_2894820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019076.1|2894816_2894996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019079.1|2894992_2895190_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	55.4	1.5e-11
WP_004255438.1|2895186_2895447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019081.1|2895449_2895623_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_165119730.1|2895615_2896824_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	30.9	8.8e-25
WP_137019086.1|2896825_2897521_-	Rha family transcriptional regulator	NA	A0A0S2SYC0	Pseudomonas_phage	37.1	3.3e-08
WP_137019088.1|2897535_2897943_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.6	4.0e-38
WP_004264148.1|2897942_2898188_-	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	71.4	2.2e-23
WP_137019090.1|2898295_2899246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019366.1|2899339_2900599_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	56.5	3.5e-141
2900686:2900713	attR	TTAGGTACAAGCTCAGGTACAAGCAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	3124147	3136190	4649235	integrase	Morganella_phage(66.67%)	22	3128201:3128215	3140241:3140255
WP_137019107.1|3124147_3124585_-	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	68.2	1.4e-17
WP_137019109.1|3124589_3125084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119736.1|3125242_3125380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019111.1|3125403_3128151_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.7	8.4e-233
WP_137019113.1|3128147_3128492_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	76.3	1.4e-47
3128201:3128215	attL	TTTGCCAAACCTCGC	NA	NA	NA	NA
WP_137019115.1|3128506_3129103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019118.1|3129102_3129288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119738.1|3129287_3129461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004255428.1|3129457_3130039_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	60.7	5.7e-30
WP_105880952.1|3130035_3130245_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	49.3	1.4e-10
WP_004255431.1|3130241_3130421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004255433.1|3130417_3130579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119740.1|3130575_3130770_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	57.1	2.0e-11
WP_004265088.1|3130772_3130946_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_165119742.1|3130938_3131163_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	49.2	4.0e-08
WP_071585908.1|3131263_3131479_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	54.2	1.8e-10
WP_137019124.1|3132185_3132794_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	70.3	4.3e-73
WP_094960712.1|3132806_3133202_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.1	7.8e-31
WP_036951665.1|3133201_3133420_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
WP_137019126.1|3133710_3134439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019128.1|3134451_3134766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019130.1|3134978_3136190_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.8	4.8e-132
3140241:3140255	attR	TTTGCCAAACCTCGC	NA	NA	NA	NA
>prophage 6
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	3210880	3259927	4649235	integrase,capsid,terminase,lysis	Salmonella_phage(22.92%)	77	3235963:3235978	3268144:3268159
WP_137019136.1|3210880_3212812_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.1	9.7e-42
WP_137019138.1|3212975_3213206_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.9	4.0e-19
WP_137019140.1|3213202_3216604_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A291AXF7	Shigella_phage	50.9	8.0e-07
WP_137019142.1|3216663_3219138_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	48.3	5.1e-229
WP_136135588.1|3219124_3219517_-	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	56.5	3.0e-43
WP_137019144.1|3219516_3219984_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	52.3	1.1e-39
WP_137019146.1|3219980_3220466_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	68.9	2.6e-60
WP_137019148.1|3220475_3223688_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	28.4	3.7e-30
WP_137019150.1|3223755_3224100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119744.1|3224159_3224399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165119746.1|3224397_3224787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136135574.1|3224892_3225675_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	43.2	9.9e-46
WP_136135573.1|3225739_3226276_-	Bro-N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	54.3	1.6e-26
WP_137019154.1|3226361_3226538_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	67.3	1.4e-13
WP_137019156.1|3226668_3227112_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	52.2	2.3e-23
WP_137019158.1|3227133_3227793_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	30.8	3.3e-26
WP_137019160.1|3227837_3228101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019162.1|3228104_3228794_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	55.2	2.3e-62
WP_137019165.1|3228843_3229584_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	47.6	2.3e-52
WP_137019168.1|3229645_3230014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019170.1|3230010_3230448_-	HK97 gp10 family phage protein	NA	A0A1V0E5P5	Salmonella_phage	56.8	3.2e-33
WP_137019174.1|3230449_3230818_-	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	63.1	2.6e-36
WP_137019176.1|3230814_3231216_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	77.4	3.9e-54
WP_137019178.1|3231272_3231530_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	51.7	5.6e-14
WP_137019180.1|3231541_3232660_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	56.4	1.1e-119
WP_137019183.1|3232675_3233113_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	72.6	7.0e-49
WP_137019187.1|3233112_3234387_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	8.9e-153
WP_137019189.1|3234389_3235319_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.0	1.9e-88
WP_137019191.1|3235254_3236625_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	66.6	6.6e-170
3235963:3235978	attL	TACAAATGCGTTGTAG	NA	NA	NA	NA
WP_137019194.1|3236628_3238104_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	84.7	5.9e-241
WP_137019196.1|3238090_3238519_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	66.4	6.0e-37
WP_137019198.1|3238573_3238834_-	DUF2560 family protein	NA	NA	NA	NA	NA
WP_137019200.1|3239001_3239418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019202.1|3239450_3239807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019370.1|3239787_3240570_-	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	43.2	1.2e-51
WP_165119748.1|3241033_3241195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019204.1|3241191_3241641_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	53.7	6.5e-34
WP_137019206.1|3241637_3242030_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	82.2	2.2e-54
WP_137019208.1|3241992_3242295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548375.1|3242291_3242705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042848065.1|3243051_3243444_-	hypothetical protein	NA	F1C5D0	Cronobacter_phage	35.0	8.5e-14
WP_137019210.1|3243635_3243827_-	protein ninH	NA	A0A088CC23	Shigella_phage	58.5	4.0e-09
WP_137019212.1|3243816_3244182_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	71.2	2.1e-43
WP_137019214.1|3244178_3244469_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	78.1	1.0e-35
WP_137019216.1|3244544_3244919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019218.1|3245040_3245235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019220.1|3245231_3245705_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	53.8	4.2e-39
WP_137019222.1|3245713_3245965_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	40.8	3.7e-10
WP_137019224.1|3245957_3246215_-	hypothetical protein	NA	A0A1P8DTF4	Proteus_phage	91.7	2.2e-42
WP_137019227.1|3246204_3246378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019229.1|3246374_3246602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019231.1|3246598_3246799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019233.1|3247097_3247328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137019235.1|3247353_3248082_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	75.6	2.5e-99
WP_165119750.1|3248081_3248789_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	77.8	3.5e-34
WP_137019237.1|3248785_3249475_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	89.1	8.0e-108
WP_137019239.1|3249496_3249841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131679866.1|3249949_3250135_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	52.5	1.2e-10
WP_131679865.1|3250215_3250863_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	65.4	2.1e-78
WP_165119752.1|3251245_3251560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019241.1|3252077_3252332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019243.1|3252720_3253065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019246.1|3253094_3253328_+	hypothetical protein	NA	A0A2H4JA69	uncultured_Caudovirales_phage	43.2	1.9e-05
WP_137019248.1|3253329_3253590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165119754.1|3253654_3253810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048606419.1|3253806_3254073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019250.1|3254069_3254285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019252.1|3254299_3255034_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	68.7	2.5e-67
WP_137019254.1|3254993_3255629_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	55.8	6.8e-53
WP_137019256.1|3255628_3256321_+	HNH endonuclease	NA	Q8SCL6	Pseudomonas_phage	61.2	4.3e-08
WP_165119756.1|3256298_3256703_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	35.9	3.4e-05
WP_165119758.1|3256765_3256927_+	hypothetical protein	NA	C8XUQ9	Shigella_phage	68.1	3.9e-13
WP_137019260.1|3256977_3257301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019262.1|3257300_3257561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019264.1|3257718_3257898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019266.1|3257890_3258268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137019268.1|3258880_3259927_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	36.3	5.8e-57
3268144:3268159	attR	CTACAACGCATTTGTA	NA	NA	NA	NA
>prophage 7
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	3540849	3551430	4649235		Mycobacterium_phage(25.0%)	11	NA	NA
WP_094961795.1|3540849_3542061_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.3	2.3e-105
WP_004257083.1|3542211_3542475_+	YbeD family protein	NA	NA	NA	NA	NA
WP_036957959.1|3542690_3543320_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004257088.1|3543443_3544409_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004257099.1|3544552_3544762_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
WP_004257101.1|3544978_3545437_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	46.7	7.1e-20
WP_036957963.1|3545725_3545953_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	3.6e-17
WP_004257105.1|3545961_3546375_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	33.9	1.4e-11
WP_110591306.1|3546386_3548519_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	3.4e-205
WP_094961793.1|3548531_3549503_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.9	2.1e-133
WP_110591305.1|3550230_3551430_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	2.6e-29
>prophage 8
NZ_CP042861	Providencia sp. 1709051003 chromosome, complete genome	4649235	4554876	4563513	4649235	transposase	Synechococcus_phage(33.33%)	9	NA	NA
WP_110592805.1|4554876_4555983_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	63.9	5.0e-128
WP_110592804.1|4555993_4556956_+	GDP-L-fucose synthase	NA	A0A0E3HIR9	Synechococcus_phage	51.5	1.6e-82
WP_110592803.1|4556970_4557447_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_110592802.1|4557453_4558860_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	1.4e-50
WP_110592801.1|4558859_4559606_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	2.8e-05
WP_110592800.1|4559605_4561042_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_008914069.1|4561267_4561564_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_071547801.1|4561605_4561905_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.3	3.7e-17
WP_137018908.1|4561989_4563513_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.9	1.3e-78
