The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	526795	535229	4623927		Escherichia_phage(50.0%)	8	NA	NA
WP_164528338.1|526795_529213_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	36.2	1.4e-138
WP_164528339.1|529209_529848_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.8	1.9e-63
WP_123382763.1|529844_530744_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_164528340.1|530778_531345_+	DmsD	NA	A0A077SLS7	Escherichia_phage	37.5	5.0e-15
WP_004915049.1|531550_531973_+	DoxX family protein	NA	NA	NA	NA	NA
WP_164528341.1|532059_532854_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.0	9.4e-44
WP_117163018.1|532880_534107_-	RtcB family protein	NA	A0A1V0EEW8	Caulobacter_phage	62.3	8.6e-137
WP_164528342.1|534110_535229_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	26.9	6.4e-14
>prophage 2
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	689690	776115	4623927	protease,tRNA,tail,holin,integrase,portal,terminase	Enterobacteria_phage(24.0%)	92	688009:688030	737564:737585
688009:688030	attL	GTCACATACTTGTGTATGCTCC	NA	NA	NA	NA
WP_109911846.1|689690_690926_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	8.8e-89
WP_004914750.1|691115_692783_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	1.6e-40
WP_164528375.1|692815_694114_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	51.5	3.8e-127
WP_164528376.1|694143_694473_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_094961256.1|694511_695081_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	56.8	6.7e-52
WP_164528377.1|695090_695561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528378.1|695563_696196_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.0	4.7e-30
WP_164528379.1|696197_696653_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.0	5.1e-26
WP_141240686.1|696662_696866_-	hypothetical protein	NA	A0A1U9ZAG7	Proteus_phage	48.1	1.2e-06
WP_164528380.1|696948_697851_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	50.8	8.7e-78
WP_123382619.1|697999_698188_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	9.1e-14
WP_164528381.1|698295_698562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528382.1|698539_698758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528383.1|698787_698997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528384.1|699346_700009_-	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	63.1	1.4e-19
WP_164528385.1|700050_700272_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	5.3e-21
WP_164528386.1|700322_700781_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	2.5e-49
WP_164528387.1|700864_701041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548505.1|701030_701210_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164528388.1|701218_702268_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	62.5	9.5e-60
WP_164529316.1|702267_702513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528389.1|702512_703157_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	63.6	3.0e-80
WP_164528390.1|703153_703639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863812.1|703635_704022_+	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	54.4	1.2e-31
WP_164528391.1|704018_704198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528392.1|704194_704581_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	52.6	8.1e-25
WP_164528393.1|704577_705117_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	53.2	3.3e-48
WP_164528394.1|705148_705586_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	54.3	2.7e-32
WP_164528395.1|705739_705937_+	TrmB family transcriptional regulator	NA	A5LH80	Enterobacteria_phage	50.0	3.9e-07
WP_164528396.1|706080_707139_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	76.5	2.3e-146
WP_109913315.1|707262_707463_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	73.7	1.4e-17
WP_164528397.1|707443_708016_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	63.4	4.9e-50
WP_164528398.1|708074_708572_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	45.5	3.3e-26
WP_164528399.1|708745_709525_+	protein kinase	NA	I6PD73	Cronobacter_phage	33.6	1.2e-30
WP_164528400.1|709521_710247_+	phosphatase 2C family protein	NA	NA	NA	NA	NA
WP_110591874.1|711113_711617_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	54.9	1.1e-40
WP_164528401.1|711613_713725_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	65.3	5.2e-283
WP_094963137.1|713721_713937_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	57.1	1.6e-14
WP_110591871.1|713933_715439_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	66.0	1.8e-189
WP_164529317.1|715476_717447_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	62.6	6.9e-237
WP_094963140.1|717531_717879_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	40.7	2.9e-13
WP_164528402.1|717882_718179_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_094963142.1|718162_718720_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	46.8	3.1e-33
WP_164528403.1|718719_719118_+|tail	phage tail protein	tail	K7PJT1	Enterobacteria_phage	44.7	3.9e-30
WP_164528404.1|719129_719642_+|tail	phage tail protein	tail	O64327	Escherichia_phage	63.1	1.3e-57
WP_164529318.1|720006_720408_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	76.8	9.3e-16
WP_164528405.1|720502_720880_+|tail	phage minor tail protein G	tail	NA	NA	NA	NA
WP_164528406.1|720903_721218_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	45.5	1.7e-12
WP_164528407.1|721192_724261_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.5	1.3e-120
WP_164528408.1|724307_724637_+|tail	phage tail protein	tail	A0A1B5FPI1	Escherichia_phage	43.7	4.1e-09
WP_164528409.1|724705_725263_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	39.1	3.2e-22
WP_164528410.1|725327_726026_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	54.3	3.3e-69
WP_164528411.1|726034_726763_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	59.1	2.9e-84
WP_164528412.1|726666_727329_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	47.2	9.6e-50
WP_164528413.1|727331_730934_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	53.1	9.9e-266
WP_164528414.1|730930_732022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528415.1|733728_734007_-	DinI family protein	NA	NA	NA	NA	NA
WP_164528416.1|734753_736667_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	39.1	2.1e-12
WP_004914745.1|736992_737310_+	trp operon repressor	NA	NA	NA	NA	NA
WP_004914743.1|737751_738288_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
737564:737585	attR	GTCACATACTTGTGTATGCTCC	NA	NA	NA	NA
WP_102138956.1|738340_738988_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_004914738.1|739031_739946_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_004914737.1|740131_740608_+	protein CreA	NA	NA	NA	NA	NA
WP_004905684.1|740718_741435_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_071524551.1|742429_742582_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_109911987.1|742666_745126_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_109911848.1|745129_746059_+	homoserine kinase	NA	NA	NA	NA	NA
WP_109911849.1|746062_747358_+	threonine synthase	NA	NA	NA	NA	NA
WP_004914728.1|747484_748132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004914725.1|748188_748404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123382507.1|748619_749087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528417.1|749201_750587_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	8.8e-13
WP_109911851.1|750579_751263_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	3.8e-33
WP_164528418.1|751417_752812_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_109911853.1|752808_753162_+	cation transporter	NA	NA	NA	NA	NA
WP_110731402.1|753179_754448_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_110731401.1|754451_757589_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_164528419.1|757630_758053_+	metal-binding protein	NA	NA	NA	NA	NA
WP_004914707.1|758104_759094_-	oxidoreductase aryl-alcohol dehydrogenase like protein	NA	NA	NA	NA	NA
WP_109911856.1|759285_760062_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_004914703.1|760446_761400_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	3.6e-13
WP_164528420.1|761591_762173_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_004905651.1|762252_762819_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_109911857.1|763154_765071_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.3	4.5e-148
WP_109911858.1|765181_766318_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	33.3	7.0e-24
WP_004914697.1|766386_767787_-	amidohydrolase	NA	NA	NA	NA	NA
WP_164528421.1|767907_768756_-	EamA family transporter	NA	NA	NA	NA	NA
WP_004914692.1|769147_770317_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.9	2.0e-90
WP_004914690.1|770512_771433_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004914688.1|771487_771748_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_109911859.1|772337_773276_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004914683.1|773304_776115_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.1e-82
>prophage 3
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	1786362	1847775	4623927	integrase,capsid,plate,tRNA	Cronobacter_phage(33.33%)	47	1836834:1836857	1847939:1847962
WP_004912558.1|1786362_1787784_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004912555.1|1790001_1790295_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	39.2	8.9e-08
WP_110732282.1|1790541_1792266_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_004264861.1|1792668_1793337_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109911499.1|1793333_1794347_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	2.5e-33
WP_164528630.1|1794350_1795811_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164528631.1|1795815_1796940_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_004912542.1|1797153_1797996_+	d-methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109911502.1|1798223_1798961_+	cyclase family protein	NA	NA	NA	NA	NA
WP_004912534.1|1799013_1800249_-	transporter	NA	NA	NA	NA	NA
WP_109911503.1|1800878_1802828_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_164528632.1|1802839_1804000_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_004912528.1|1804100_1804631_+	MltR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164528633.1|1804727_1805147_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_164528634.1|1805161_1806493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528635.1|1806787_1807285_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164528636.1|1807559_1807967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528637.1|1808634_1809972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004912512.1|1809994_1810423_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_164528638.1|1810424_1810964_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_109911508.1|1810979_1812071_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_110732017.1|1813820_1815431_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_164528639.1|1815450_1818786_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_164528640.1|1818816_1819941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528641.1|1819944_1820202_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_164528642.1|1820246_1821224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528643.1|1821244_1823818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528644.1|1823830_1824517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528645.1|1824642_1827039_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.9	6.6e-16
WP_164528646.1|1827035_1829699_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.1	3.4e-98
WP_004912469.1|1829866_1830358_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_164528647.1|1830360_1832097_-	OmpA family protein	NA	NA	NA	NA	NA
WP_164528648.1|1832099_1832756_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004912456.1|1832752_1834090_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_109911521.1|1834112_1835657_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_110732011.1|1835676_1836174_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
1836834:1836857	attL	CATGGTGTCCCCTGCAGGAATCGA	NA	NA	NA	NA
WP_004912445.1|1837395_1837617_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	1.6e-09
WP_164529332.1|1837613_1838450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528649.1|1838472_1839492_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	46.8	8.0e-80
WP_164528650.1|1839488_1840022_+|capsid	capsid protein	capsid	Q94MZ5	Haemophilus_virus	51.2	2.0e-29
WP_164528651.1|1840091_1840604_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	64.0	1.8e-43
WP_004912432.1|1840606_1840834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528652.1|1840833_1843554_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.1	7.4e-64
WP_164528653.1|1843839_1844052_+	hypothetical protein	NA	F1BUM8	Cronobacter_phage	54.4	1.6e-11
WP_004906882.1|1844589_1845159_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	50.9	2.3e-36
WP_164528654.1|1845265_1846633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528655.1|1846590_1847775_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.1	7.3e-141
1847939:1847962	attR	CATGGTGTCCCCTGCAGGAATCGA	NA	NA	NA	NA
>prophage 4
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	1991100	2004139	4623927		Klebsiella_phage(20.0%)	25	NA	NA
WP_164528683.1|1991100_1992276_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.7	1.8e-30
WP_123382603.1|1992277_1992493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528684.1|1992790_1993159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528685.1|1993187_1993343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528686.1|1994016_1994472_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.6	1.7e-26
WP_141240686.1|1994480_1994684_-	hypothetical protein	NA	A0A1U9ZAG7	Proteus_phage	48.1	1.2e-06
WP_164528687.1|1994697_1995474_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	39.5	1.8e-39
WP_164528688.1|1995558_1996473_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	52.5	6.3e-84
WP_164529334.1|1996622_1996811_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	1.2e-13
WP_164528381.1|1996918_1997185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528382.1|1997162_1997381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528689.1|1997410_1997620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123382609.1|1997775_1998447_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	56.2	1.1e-61
WP_102140689.1|1998519_1998714_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	64.9	3.8e-15
WP_164528690.1|1998751_1999210_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	6.2e-48
WP_164528691.1|1999492_1999672_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164528692.1|1999681_2000743_+	replication protein	NA	A0A248SL49	Klebsiella_phage	49.3	2.9e-32
WP_164529335.1|2000742_2000988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528693.1|2000987_2001521_+	phage N-6-adenine-methyltransferase	NA	Q4A1M4	Enterobacteria_phage	64.7	3.2e-64
WP_164528694.1|2001517_2001865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528695.1|2001861_2002248_+	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	60.4	4.4e-31
WP_164528696.1|2002244_2002430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528697.1|2002422_2002809_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	50.0	1.8e-24
WP_164528698.1|2002805_2003345_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	67.9	1.1e-43
WP_164528699.1|2003359_2004139_+	antitermination protein	NA	F1C595	Cronobacter_phage	48.4	1.2e-67
>prophage 5
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	2008361	2037208	4623927	tail,terminase	Cronobacter_phage(28.57%)	33	NA	NA
WP_164528705.1|2008361_2008718_+	DUF882 domain-containing protein	NA	A0A2D0VKR9	Proteus_phage	63.2	1.1e-36
WP_164528706.1|2008702_2009092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528707.1|2009816_2009999_+	hypothetical protein	NA	O64364	Escherichia_phage	67.2	3.7e-12
WP_164528708.1|2010198_2010387_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	85.2	1.2e-21
WP_164528709.1|2010845_2011433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528710.1|2011494_2012481_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	35.9	1.0e-31
WP_164528711.1|2012458_2013766_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.8e-151
WP_164528712.1|2013765_2015136_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	50.5	1.0e-122
WP_164528713.1|2015132_2016254_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.6	2.0e-103
WP_164528714.1|2016364_2017129_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	57.6	3.2e-65
WP_164528715.1|2017141_2018095_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.2	2.5e-128
WP_164529336.1|2018097_2018385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528716.1|2018426_2018906_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	48.3	1.0e-32
WP_164528717.1|2018908_2019262_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	42.1	1.4e-18
WP_164528718.1|2019263_2019845_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	57.0	6.2e-53
WP_164528719.1|2019841_2020243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528720.1|2020289_2020949_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	43.2	2.5e-42
WP_164529337.1|2020948_2021212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528721.1|2021204_2021519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154623732.1|2021569_2021806_+	hypothetical protein	NA	K7PMK8	Enterobacteria_phage	41.7	4.5e-10
WP_042847844.1|2022066_2022246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042848061.1|2022258_2022738_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_164528722.1|2022763_2023363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528723.1|2023619_2023970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528724.1|2024269_2024728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528725.1|2024788_2028295_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	39.2	1.4e-147
WP_164528726.1|2028339_2028681_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	46.4	1.1e-25
WP_164528727.1|2028677_2029421_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	53.8	4.1e-81
WP_164528728.1|2029417_2030128_+	peptidase P60	NA	F1C573	Cronobacter_phage	64.3	6.8e-86
WP_164528729.1|2030124_2030721_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.5	3.2e-60
WP_164528730.1|2030780_2034410_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	55.7	3.5e-295
WP_164528731.1|2034406_2035498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528732.1|2035723_2037208_+	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	30.1	4.4e-34
>prophage 6
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	2246584	2278518	4623927	tail,terminase,integrase	Salmonella_phage(25.0%)	38	2246351:2246410	2284098:2284192
2246351:2246410	attL	AATTGAGTGGGAATAATATAGCAATTGTTGATAACAGTTTTTAGTTATCGATAAATTCAA	NA	NA	NA	NA
WP_164528764.1|2246584_2247790_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.5	1.4e-136
WP_164528765.1|2247795_2247981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528766.1|2247973_2248627_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	64.7	2.4e-77
WP_164528767.1|2248633_2248813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528768.1|2248965_2249169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528769.1|2249357_2249912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528770.1|2249989_2250523_-	hypothetical protein	NA	A0A0S2MWC7	Cellulophaga_phage	30.5	1.8e-06
WP_043892873.1|2250803_2251133_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	40.2	2.0e-24
WP_164528771.1|2251201_2251504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528772.1|2251543_2252644_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	52.9	1.5e-103
WP_164528773.1|2252699_2254424_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	51.2	9.1e-100
WP_164528223.1|2254395_2254647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061063964.1|2254890_2255490_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	35.0	2.1e-27
WP_144141233.1|2255620_2255854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529342.1|2256445_2257222_+	hypothetical protein	NA	T1SA92	Salmonella_phage	45.0	2.1e-19
WP_164528774.1|2257190_2257664_+	replication protein	NA	NA	NA	NA	NA
WP_164528775.1|2257880_2258306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117162268.1|2258302_2258665_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	67.6	6.4e-40
WP_164528776.1|2258745_2259291_+	hypothetical protein	NA	A0A1B1W2E3	Salmonella_phage	41.8	6.3e-39
WP_164528777.1|2259293_2259566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528778.1|2259585_2259846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528779.1|2260279_2260909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528780.1|2260962_2261529_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	48.8	1.3e-39
WP_164528781.1|2261525_2263007_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	78.9	3.6e-238
WP_164528782.1|2263193_2263409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528783.1|2263424_2265077_+|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	67.4	4.2e-203
WP_164528784.1|2265073_2265397_+	hypothetical protein	NA	Q2A090	Sodalis_phage	54.9	1.9e-19
WP_164528785.1|2265393_2266062_+	peptidase	NA	G9L6C4	Escherichia_phage	57.1	2.7e-44
WP_109912478.1|2266078_2267068_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	62.3	6.8e-116
WP_164529343.1|2267132_2267564_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	51.4	2.0e-27
WP_164528786.1|2267572_2267914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528787.1|2267966_2268278_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	44.9	1.4e-14
WP_164528788.1|2268277_2268883_+	hypothetical protein	NA	A0A193GYT2	Enterobacter_phage	60.2	3.0e-66
WP_164528789.1|2268882_2271339_+	hypothetical protein	NA	Q858G3	Salmonella_phage	68.3	0.0e+00
WP_164528790.1|2271322_2271817_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	57.6	3.9e-48
WP_164528791.1|2271816_2272392_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.3	3.3e-46
WP_164528792.1|2272402_2275147_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	40.6	9.0e-102
WP_164528793.1|2275149_2278518_+	hypothetical protein	NA	A0A2I7R904	Vibrio_phage	35.9	1.6e-177
2284098:2284192	attR	AATTGAGTGGGAATAATATAGCAATTGTTGATAACAGTTTTTAGTTATCGATAAATTCAAAGGCATCAGTTAGTTACTGGTGCCTTTTTGTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	2519166	2556943	4623927	capsid,tail,head,plate,portal,integrase,terminase	Salmonella_phage(43.33%)	40	2549594:2549607	2555880:2555893
WP_109912188.1|2519166_2519580_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	63.5	1.2e-39
WP_164528849.1|2519707_2521219_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_164529347.1|2522976_2523771_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_164528851.1|2524092_2525199_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	63.1	4.9e-131
WP_164528852.1|2525297_2526524_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	65.9	1.2e-149
WP_164528853.1|2526536_2527049_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	66.5	1.6e-60
WP_164528854.1|2527109_2527412_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	44.6	1.0e-11
WP_071585870.1|2527444_2527561_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_164528855.1|2527557_2530428_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	36.4	6.1e-125
WP_164528856.1|2530432_2530864_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.9	2.5e-46
WP_164528857.1|2530970_2531741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528858.1|2531901_2532252_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	48.0	3.8e-13
WP_164528859.1|2533876_2534488_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	66.3	1.6e-75
WP_164528860.1|2534480_2535392_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	66.7	2.0e-106
WP_141173610.1|2535394_2535736_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	60.4	6.7e-31
WP_164528861.1|2535732_2536362_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	51.4	1.1e-52
WP_164528862.1|2536358_2536997_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.7	3.0e-40
WP_004254663.1|2536989_2537442_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	33.6	7.3e-17
WP_004254667.1|2537441_2537612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528863.1|2537608_2538130_-	lysozyme	NA	H2DE61	Erwinia_phage	48.4	7.4e-13
WP_164528864.1|2538132_2538669_-	lysozyme	NA	H6WRZ4	Salmonella_phage	62.7	1.4e-62
WP_153673430.1|2538670_2538958_-	potassium channel protein	NA	A0A1V0E5R8	Salmonella_phage	40.7	3.5e-09
WP_164529348.1|2539179_2539668_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	51.9	8.4e-35
WP_164528865.1|2539770_2540466_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	48.7	3.0e-46
WP_141173620.1|2540486_2541536_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.9	8.0e-99
WP_164528866.1|2541582_2542404_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	36.7	2.3e-37
WP_164528867.1|2542566_2544291_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	61.0	1.3e-199
WP_164528868.1|2544293_2545349_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	59.0	1.6e-107
WP_164528869.1|2545835_2546663_+	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	35.3	3.8e-19
WP_164528870.1|2546761_2548027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528871.1|2548860_2551521_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	49.3	3.3e-250
2549594:2549607	attL	CCTTTAAATAATGG	NA	NA	NA	NA
WP_164528872.1|2551598_2551820_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	49.3	8.5e-11
WP_004254744.1|2551812_2552034_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_164528873.1|2552397_2552883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528874.1|2552879_2553206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528875.1|2553195_2553393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076913935.1|2553389_2553656_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	53.8	4.9e-21
WP_164528876.1|2553757_2554057_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	3.9e-35
WP_164528877.1|2554120_2555107_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	57.2	1.2e-107
WP_109912186.1|2555368_2556943_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	31.1	1.2e-37
2555880:2555893	attR	CCTTTAAATAATGG	NA	NA	NA	NA
>prophage 8
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	2804750	2812243	4623927		Tupanvirus(33.33%)	7	NA	NA
WP_109911252.1|2804750_2806736_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.9	5.7e-21
WP_164528917.1|2806735_2807728_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.4	6.7e-39
WP_109911251.1|2807727_2808873_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	26.8	1.7e-33
WP_164528918.1|2808992_2809769_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	28.9	6.5e-05
WP_164528919.1|2809771_2810773_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.6	4.0e-15
WP_109911248.1|2810894_2811890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004263721.1|2811946_2812243_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
>prophage 9
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	3101826	3197921	4623927	lysis,tRNA,tail,holin,head,plate,integrase,terminase	Acinetobacter_phage(27.78%)	101	3135680:3135694	3198553:3198567
WP_164528975.1|3101826_3103227_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.5	5.1e-77
WP_110732273.1|3103798_3104905_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.5	2.2e-99
WP_164528976.1|3105334_3106525_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_164528978.1|3115354_3116002_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004256173.1|3116041_3116590_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	37.0	5.4e-06
WP_164528979.1|3116970_3118713_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_164528980.1|3119134_3123577_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004909591.1|3123576_3124302_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_109911049.1|3124282_3125608_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004909582.1|3125604_3126393_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_164528981.1|3126748_3127576_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_164528982.1|3127663_3128410_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004256203.1|3128415_3128595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004909576.1|3128732_3128948_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004909572.1|3129350_3130349_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004909568.1|3130345_3132091_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	7.4e-57
WP_004256221.1|3134978_3135266_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	1.1e-10
WP_004909559.1|3135322_3136996_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
3135680:3135694	attL	ATCTTCAGCTAACTG	NA	NA	NA	NA
WP_004909557.1|3137169_3137853_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_164528984.1|3138040_3139318_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_164528985.1|3139439_3140531_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	1.5e-84
WP_109911043.1|3140819_3142454_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_109911042.1|3142510_3143056_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_109911041.1|3143380_3144163_+	esterase	NA	NA	NA	NA	NA
WP_164528987.1|3146506_3147835_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_117162086.1|3149967_3150225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528988.1|3150214_3150427_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164528989.1|3150773_3151391_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.5	3.3e-28
WP_164529361.1|3151390_3152149_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.5	1.7e-34
WP_164528990.1|3152933_3153566_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	48.1	8.9e-45
WP_164528991.1|3153565_3154756_-	hypothetical protein	NA	A0A1X9SFA4	Acinetobacter_phage	44.7	8.2e-84
WP_164528992.1|3154752_3155106_-	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	50.4	7.2e-28
WP_164528993.1|3155109_3155796_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	43.9	1.1e-32
WP_164528994.1|3155782_3156664_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	40.1	1.2e-50
WP_164528995.1|3157787_3158690_-	hypothetical protein	NA	A0A0R6PI23	Moraxella_phage	28.4	4.0e-22
WP_164528996.1|3158652_3158847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528997.1|3159105_3159369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529416.1|3159408_3159873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528999.1|3159936_3162330_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	43.6	6.6e-157
WP_164529000.1|3162525_3162936_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	39.3	3.0e-17
WP_051473540.1|3162935_3163382_-	hypothetical protein	NA	E2GLU0	Acinetobacter_phage	42.9	7.2e-33
WP_164529001.1|3163395_3164856_-	DUF3383 domain-containing protein	NA	H9C0W5	Aeromonas_phage	34.6	1.5e-66
WP_164529002.1|3164865_3165354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529362.1|3165338_3165719_-	hypothetical protein	NA	A0A068CBI2	Acinetobacter_phage	43.3	1.0e-19
WP_164529003.1|3165708_3166275_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	31.5	2.0e-16
WP_164529363.1|3166267_3166726_-	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	43.7	1.8e-15
WP_164529004.1|3166752_3167070_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.0	1.6e-07
WP_164529005.1|3167129_3168128_-	DUF2184 domain-containing protein	NA	I2GUD7	Acinetobacter_phage	51.6	1.8e-84
WP_164529364.1|3168137_3168602_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	45.2	3.7e-16
WP_164529006.1|3168635_3169850_-	DUF2213 domain-containing protein	NA	K4I393	Acinetobacter_phage	55.9	2.0e-53
WP_164529007.1|3169862_3170654_-|head	phage head morphogenesis protein	head	A0A0D4DCM6	Acinetobacter_phage	40.5	5.9e-54
WP_164529008.1|3170625_3172158_-	DUF1073 domain-containing protein	NA	E2GLW8	Acinetobacter_phage	50.1	7.5e-114
WP_164529009.1|3172157_3173507_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	64.6	6.5e-170
WP_164529010.1|3173499_3174024_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	73.9	1.3e-62
WP_164529011.1|3174167_3174854_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	77.2	7.5e-98
WP_164529012.1|3175578_3176031_-|lysis	lysis protein	lysis	I6WLR5	Burkholderia_virus	34.6	7.3e-09
WP_164529013.1|3176027_3176444_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	53.0	3.0e-33
WP_094963034.1|3176436_3176766_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	53.2	1.8e-25
WP_164529014.1|3177139_3177922_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	52.7	3.2e-68
WP_164529015.1|3177918_3178122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529016.1|3178121_3178580_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	77.5	1.5e-65
WP_164529017.1|3178918_3179062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529018.1|3179061_3179232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529019.1|3179242_3179689_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	67.1	1.1e-54
WP_164529417.1|3179698_3179866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529021.1|3180037_3180256_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_164529022.1|3180242_3180512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529023.1|3180759_3181050_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	42.7	1.2e-12
WP_164529024.1|3181081_3181306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529025.1|3181321_3181996_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	55.6	4.8e-65
WP_164529026.1|3181992_3182934_-	replication protein 15	NA	A0A1P8DTG2	Proteus_phage	55.1	3.7e-71
WP_164529027.1|3182947_3183355_-	hypothetical protein	NA	G8C7U4	Escherichia_phage	55.7	1.2e-31
WP_164529028.1|3183381_3183708_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	74.1	8.3e-39
WP_164529029.1|3183813_3184041_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	64.0	5.4e-21
WP_164529030.1|3184120_3184558_+	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	76.3	1.9e-25
WP_164529418.1|3184603_3184924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529032.1|3184927_3185434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136134472.1|3185486_3185693_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	46.7	6.5e-05
WP_164529033.1|3186203_3186407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154601193.1|3186432_3186936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529034.1|3187430_3188021_+	DUF5420 family protein	NA	A0A2I7QRH1	Vibrio_phage	34.3	2.0e-14
WP_164529035.1|3188050_3188236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529036.1|3188237_3188480_+	hypothetical protein	NA	A0A0G2SS78	Proteus_phage	73.3	3.5e-10
WP_164529037.1|3188741_3189638_+	cell envelope biogenesis protein TolA	NA	K7P6J9	Enterobacteria_phage	75.2	2.1e-39
WP_140171620.1|3189655_3190093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529038.1|3190160_3190316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048606419.1|3190312_3190579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529039.1|3190720_3191098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529040.1|3191087_3191762_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	34.2	3.3e-21
WP_164529041.1|3191764_3192475_+	recombinase	NA	K7PKU3	Enterobacteria_phage	58.0	2.9e-76
WP_164529042.1|3192475_3192985_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	63.9	2.4e-56
WP_096864293.1|3193020_3193308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529043.1|3193602_3194136_+	hypothetical protein	NA	A0A2I7R6M5	Vibrio_phage	27.6	3.2e-11
WP_164529044.1|3194135_3194357_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	51.2	1.8e-13
WP_164529045.1|3194349_3194595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529046.1|3194753_3195308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529047.1|3195307_3195523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529048.1|3195482_3195701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529049.1|3195690_3196236_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.9	2.4e-59
WP_164529050.1|3196243_3196450_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_164529051.1|3196874_3197921_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	35.2	1.1e-55
3198553:3198567	attR	CAGTTAGCTGAAGAT	NA	NA	NA	NA
>prophage 10
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	3465683	3476366	4623927		Mycobacterium_phage(25.0%)	11	NA	NA
WP_109913210.1|3465683_3466895_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.3	1.0e-105
WP_004908910.1|3467046_3467310_+	YbeD family protein	NA	NA	NA	NA	NA
WP_109913211.1|3467620_3468265_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004908904.1|3468388_3469354_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004257099.1|3469487_3469697_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
WP_004908893.1|3469913_3470372_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	44.0	3.2e-20
WP_109913212.1|3470660_3470888_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	8.1e-17
WP_109913213.1|3470896_3471310_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	34.7	1.6e-10
WP_109913214.1|3471321_3473454_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	3.3e-208
WP_004908884.1|3473466_3474438_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.6	7.8e-133
WP_004908883.1|3475166_3476366_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	2.6e-29
>prophage 11
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	3690852	3752342	4623927	capsid,protease,tail,holin,head,integrase,portal,terminase	Cronobacter_phage(63.64%)	65	3690081:3690100	3719593:3719612
3690081:3690100	attL	TGAGACACTTTTGAGACACT	NA	NA	NA	NA
WP_164529133.1|3690852_3691884_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.2	8.0e-120
WP_164529134.1|3691900_3692491_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.9	4.3e-25
WP_164529135.1|3692635_3692860_+	regulator	NA	NA	NA	NA	NA
WP_164529136.1|3692889_3693399_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	50.3	6.9e-40
WP_164529137.1|3693401_3693557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529138.1|3693566_3693917_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	42.7	2.8e-16
WP_164529139.1|3693988_3694195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529369.1|3694407_3696606_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	53.6	1.3e-180
WP_164529140.1|3696565_3696937_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.3	3.5e-33
WP_096864691.1|3697057_3697279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141395919.1|3697264_3697582_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	56.7	4.5e-29
WP_164529141.1|3697581_3698613_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.3	1.7e-122
WP_164529142.1|3698612_3700400_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	64.2	1.1e-222
WP_164455387.1|3700561_3701344_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	42.9	1.6e-43
WP_048608874.1|3701365_3702394_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.7	7.0e-140
WP_164529143.1|3702397_3703105_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.4	6.8e-62
WP_164529144.1|3703203_3703614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529145.1|3703592_3704045_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	50.0	3.5e-35
WP_164529146.1|3704041_3704521_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_164529147.1|3704510_3705209_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.4e-70
WP_164529148.1|3705221_3706340_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	63.2	4.9e-131
WP_164529149.1|3706339_3706795_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	64.2	7.0e-52
WP_048608858.1|3706811_3707105_+|holin	holin	holin	Q6K1I2	Salmonella_virus	48.8	2.4e-13
WP_164529150.1|3707101_3707512_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	46.9	3.2e-27
WP_164529151.1|3707508_3707886_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	50.0	6.3e-22
WP_096864679.1|3707987_3708251_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.9	1.8e-20
WP_164529152.1|3708438_3710538_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	45.3	9.5e-160
WP_164529153.1|3710530_3710866_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	2.4e-33
WP_164529154.1|3710855_3712046_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	62.8	1.7e-145
WP_164529155.1|3712032_3712650_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.0	3.1e-66
WP_164529156.1|3712662_3714693_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	54.9	1.0e-89
WP_164529157.1|3714692_3715307_+|tail	tail fiber assembly protein	tail	G4KKN5	Yersinia_phage	33.7	3.2e-23
WP_164529370.1|3715351_3716065_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	37.1	1.9e-35
WP_164529158.1|3716009_3716576_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	52.8	5.9e-40
WP_164529159.1|3716578_3718255_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	49.7	1.4e-137
WP_164529160.1|3718830_3719553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109911818.1|3720374_3720971_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3719593:3719612	attR	TGAGACACTTTTGAGACACT	NA	NA	NA	NA
WP_164529161.1|3721194_3723216_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_004908393.1|3723325_3724579_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_004908389.1|3726414_3727083_+	DedA family protein	NA	NA	NA	NA	NA
WP_109911700.1|3727320_3727626_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_004908385.1|3727632_3728040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004908381.1|3728026_3728326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004908378.1|3728563_3728959_+	DoxX family protein	NA	NA	NA	NA	NA
WP_117162551.1|3729350_3730244_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109911697.1|3730367_3731075_+	pirin family protein	NA	NA	NA	NA	NA
WP_164529162.1|3731210_3733181_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_004908366.1|3733663_3734002_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_004908363.1|3734034_3734400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004258180.1|3734399_3734696_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_004258184.1|3734722_3735514_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_004908356.1|3735516_3736167_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_109911695.1|3736605_3737745_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_004908346.1|3737728_3738841_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_109911693.1|3738842_3739583_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_123382269.1|3739720_3740797_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_115167905.1|3741704_3742577_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	7.4e-50
WP_004908329.1|3744374_3744755_+	YraN family protein	NA	NA	NA	NA	NA
WP_004908326.1|3744869_3745460_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	30.8	1.9e-09
WP_109911689.1|3745469_3746045_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004908320.1|3746108_3746831_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_164529163.1|3746839_3747490_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_004908312.1|3747722_3750068_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.4	1.5e-44
WP_164529164.1|3750368_3751775_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042851523.1|3751847_3752342_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	41.8	2.6e-28
>prophage 12
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	4051412	4068462	4623927	integrase,transposase	Escherichia_phage(55.56%)	18	4051350:4051409	4064360:4065016
4051350:4051409	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4051412_4052117_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|4052007_4052967_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_063840321.1|4053258_4053813_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|4053943_4054774_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|4054911_4055544_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_164529211.1|4055628_4056081_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|4056303_4056651_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4056644_4057484_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4057611_4058112_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|4058287_4059070_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|4059059_4060583_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|4060705_4062250_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000344784.1|4062300_4063161_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|4063651_4064356_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_140173007.1|4064391_4064703_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000155092.1|4064892_4065777_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
4064360:4065016	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTTCAAACCAGTGACAGCATTACTCATTCAATCTTGGAACTCATCAACAATATGTTGATTGATCTTCTGGCAACAATGGCCCGCCTAGACAATGAGAAACGTATAGAACGTATTAAGCAGGGCCTGGCACGTTCGGGTTACAAACCAACAGGCAAGAAGGCAAATGAGGCTAAACATAAACGAATAAAAGAATTGCTAGTAGTTGGCAATATGACTAAGGAAGAAATTGCCAAAGCAGTGAATTGTGGAGTTGCAACTGTCTATCGAGTTGCTAAAGTTATCTAAAAGAGGCTTATCTCAACGCGCCCCCAATGGGGCACCGCTGCATTCAGGTTACTTCACATAAGAAATTTTATGTTAAATGATTGTTAGAAATGCCCCTTGATCGAGGCATTTTCTATAAAGAATACTAAAAACTAATTAAAGCCAACCAAGTTTCAAAACAAGGCAGTTCTCAGCAATCATATTTTTAAATTATATAACTCCCAACTGAGCTTTTGCTCCAACGATAAGGCTTTCATTTTGAGTTTCTAAGGCAAATAAACCATACATCAAAGGAGAGGCCGCTGCTCTTTCTAAAGTCTGTTCATATAGTTTA	NA	NA	NA	NA
WP_000052512.1|4065832_4067308_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_001067855.1|4067757_4068462_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 13
NZ_CP042860	Providencia sp. 1701091 chromosome, complete genome	4623927	4071966	4134142	4623927	integrase,transposase	Escherichia_phage(44.44%)	58	4067706:4067765	4129783:4130604
4067706:4067765	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_000050481.1|4071966_4073508_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4073912_4074752_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4074745_4075093_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4075315_4075768_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4076508_4077321_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_164529422.1|4077347_4077689_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4078365_4079907_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001749986.1|4081711_4082164_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4082904_4083717_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|4083720_4084086_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4084762_4086304_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4086708_4087548_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4087541_4087889_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4088111_4088564_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4089304_4090117_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|4090120_4090486_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4091162_4092704_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4093108_4093948_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4093941_4094289_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4094511_4094964_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4095704_4096517_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|4096520_4096886_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4097562_4099104_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4099508_4100348_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4100341_4100689_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4100911_4101364_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4102104_4102917_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|4102920_4103286_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4103961_4105503_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4105907_4106747_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4106740_4107088_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000939727.1|4107235_4108057_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_071593219.1|4108188_4108980_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845054.1|4109125_4110139_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|4110341_4110692_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|4110817_4111378_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|4111380_4114332_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|4114340_4114742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|4114826_4115531_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_164529212.1|4115588_4116425_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|4116455_4117340_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|4117562_4118777_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|4118804_4119110_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|4119221_4120715_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|4120745_4120997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|4120890_4121193_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_164529213.1|4121279_4122095_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|4122184_4123274_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|4123471_4123957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|4125767_4126520_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|4126941_4127967_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|4128195_4128972_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067855.1|4129085_4129790_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4129979_4130795_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
4129783:4130604	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAATTTATGAGTAAAGGATTATGTCCACGATAAGCACCTGGGTCGATTCCTGGGAGGCGGCCATGAGGGTAGGGAAGCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACA	NA	NA	NA	NA
WP_001067858.1|4130945_4131650_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_064732565.1|4131659_4132064_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_108168472.1|4132383_4132776_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_015344972.1|4132942_4134142_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
