The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	525493	533927	4596310		Escherichia_phage(50.0%)	8	NA	NA
WP_164528338.1|525493_527911_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	36.2	1.4e-138
WP_164528339.1|527907_528546_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.8	1.9e-63
WP_123382763.1|528542_529442_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_164528340.1|529476_530043_+	DmsD	NA	A0A077SLS7	Escherichia_phage	37.5	5.0e-15
WP_004915049.1|530248_530671_+	DoxX family protein	NA	NA	NA	NA	NA
WP_164528341.1|530757_531552_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.0	9.4e-44
WP_117163018.1|531578_532805_-	RtcB family protein	NA	A0A1V0EEW8	Caulobacter_phage	62.3	8.6e-137
WP_164528342.1|532808_533927_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	26.9	6.4e-14
>prophage 2
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	688392	774817	4596310	holin,integrase,portal,tail,protease,terminase,tRNA	Enterobacteria_phage(24.0%)	92	686711:686732	736266:736287
686711:686732	attL	GTCACATACTTGTGTATGCTCC	NA	NA	NA	NA
WP_109911846.1|688392_689628_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.9	8.8e-89
WP_004914750.1|689817_691485_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	1.6e-40
WP_164528375.1|691517_692816_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	51.5	3.8e-127
WP_164528376.1|692845_693175_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_094961256.1|693213_693783_-	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	56.8	6.7e-52
WP_164528377.1|693792_694263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528378.1|694265_694898_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.0	4.7e-30
WP_164528379.1|694899_695355_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.0	5.1e-26
WP_141240686.1|695364_695568_-	hypothetical protein	NA	A0A1U9ZAG7	Proteus_phage	48.1	1.2e-06
WP_164528380.1|695650_696553_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	50.8	8.7e-78
WP_123382619.1|696701_696890_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	9.1e-14
WP_164528381.1|696997_697264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528382.1|697241_697460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528383.1|697489_697699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528384.1|698048_698711_-	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	63.1	1.4e-19
WP_164528385.1|698752_698974_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	67.6	5.3e-21
WP_164528386.1|699024_699483_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	2.5e-49
WP_164528387.1|699566_699743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548505.1|699732_699912_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164528388.1|699920_700970_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	62.5	9.5e-60
WP_164529316.1|700969_701215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528389.1|701214_701859_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	63.6	3.0e-80
WP_164528390.1|701855_702341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096863812.1|702337_702724_+	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	54.4	1.2e-31
WP_164528391.1|702720_702900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528392.1|702896_703283_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	52.6	8.1e-25
WP_164528393.1|703279_703819_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	53.2	3.3e-48
WP_164528394.1|703850_704288_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	54.3	2.7e-32
WP_164528395.1|704441_704639_+	TrmB family transcriptional regulator	NA	A5LH80	Enterobacteria_phage	50.0	3.9e-07
WP_164528396.1|704782_705841_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	76.5	2.3e-146
WP_109913315.1|705964_706165_+|holin	holin	holin	A0A1W6JNY9	Morganella_phage	73.7	1.4e-17
WP_164528397.1|706145_706718_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	63.4	4.9e-50
WP_164528398.1|706776_707274_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	45.5	3.3e-26
WP_164528399.1|707447_708227_+	protein kinase	NA	I6PD73	Cronobacter_phage	33.6	1.2e-30
WP_164528400.1|708223_708949_+	phosphatase 2C family protein	NA	NA	NA	NA	NA
WP_110591874.1|709815_710319_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	54.9	1.1e-40
WP_164528401.1|710315_712427_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	65.3	5.2e-283
WP_094963137.1|712423_712639_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	57.1	1.6e-14
WP_110591871.1|712635_714141_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	66.0	1.8e-189
WP_164529317.1|714178_716149_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	62.6	6.9e-237
WP_094963140.1|716233_716581_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	40.7	2.9e-13
WP_164528402.1|716584_716881_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_094963142.1|716864_717422_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	46.8	3.1e-33
WP_164528403.1|717421_717820_+|tail	phage tail protein	tail	K7PJT1	Enterobacteria_phage	44.7	3.9e-30
WP_164528404.1|717831_718344_+|tail	phage tail protein	tail	O64327	Escherichia_phage	63.1	1.3e-57
WP_164529318.1|718708_719110_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	76.8	9.3e-16
WP_164528405.1|719204_719582_+|tail	phage minor tail protein G	tail	NA	NA	NA	NA
WP_164528406.1|719605_719920_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	45.5	1.7e-12
WP_164528407.1|719894_722963_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	35.5	1.3e-120
WP_164528408.1|723009_723339_+|tail	phage tail protein	tail	A0A1B5FPI1	Escherichia_phage	43.7	4.1e-09
WP_164528409.1|723407_723965_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	39.1	3.2e-22
WP_164528410.1|724029_724728_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	54.3	3.3e-69
WP_164528411.1|724736_725465_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	59.1	2.9e-84
WP_164528412.1|725368_726031_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	47.2	9.6e-50
WP_164528413.1|726033_729636_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	53.1	9.9e-266
WP_164528414.1|729632_730724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528415.1|732430_732709_-	DinI family protein	NA	NA	NA	NA	NA
WP_164528416.1|733455_735369_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	39.1	2.1e-12
WP_004914745.1|735694_736012_+	trp operon repressor	NA	NA	NA	NA	NA
WP_004914743.1|736453_736990_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
736266:736287	attR	GTCACATACTTGTGTATGCTCC	NA	NA	NA	NA
WP_102138956.1|737042_737690_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_004914738.1|737733_738648_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_004914737.1|738833_739310_+	protein CreA	NA	NA	NA	NA	NA
WP_004905684.1|739420_740137_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_071524551.1|741131_741284_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_109911987.1|741368_743828_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_109911848.1|743831_744761_+	homoserine kinase	NA	NA	NA	NA	NA
WP_109911849.1|744764_746060_+	threonine synthase	NA	NA	NA	NA	NA
WP_004914728.1|746186_746834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004914725.1|746890_747106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123382507.1|747321_747789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528417.1|747903_749289_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	8.8e-13
WP_109911851.1|749281_749965_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	3.8e-33
WP_164528418.1|750119_751514_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_109911853.1|751510_751864_+	cation transporter	NA	NA	NA	NA	NA
WP_110731402.1|751881_753150_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_110731401.1|753153_756291_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_164528419.1|756332_756755_+	metal-binding protein	NA	NA	NA	NA	NA
WP_004914707.1|756806_757796_-	oxidoreductase aryl-alcohol dehydrogenase like protein	NA	NA	NA	NA	NA
WP_109911856.1|757987_758764_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_004914703.1|759148_760102_+	transaldolase	NA	A0A127KNC6	Cyanophage	32.7	3.6e-13
WP_164528420.1|760293_760875_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_004905651.1|760954_761521_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_109911857.1|761856_763773_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.3	4.5e-148
WP_109911858.1|763883_765020_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	33.3	7.0e-24
WP_004914697.1|765088_766489_-	amidohydrolase	NA	NA	NA	NA	NA
WP_164528421.1|766609_767458_-	EamA family transporter	NA	NA	NA	NA	NA
WP_004914692.1|767849_769019_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.9	2.0e-90
WP_004914690.1|769214_770135_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_004914688.1|770189_770450_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_109911859.1|771039_771978_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004914683.1|772006_774817_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.1e-82
>prophage 3
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	1784094	1842892	4596310	plate,capsid,tRNA	Cronobacter_phage(36.36%)	46	NA	NA
WP_004912558.1|1784094_1785516_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004912555.1|1787733_1788027_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	39.2	8.9e-08
WP_110732282.1|1788273_1789998_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_004264861.1|1790400_1791069_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109911499.1|1791065_1792079_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	2.5e-33
WP_164528630.1|1792082_1793543_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164528631.1|1793547_1794672_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_004912542.1|1794885_1795728_+	d-methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109911502.1|1795955_1796693_+	cyclase family protein	NA	NA	NA	NA	NA
WP_004912534.1|1796745_1797981_-	transporter	NA	NA	NA	NA	NA
WP_109911503.1|1798610_1800560_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_164528632.1|1800571_1801732_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_004912528.1|1801832_1802363_+	MltR family transcriptional regulator	NA	NA	NA	NA	NA
WP_164528633.1|1802459_1802879_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_164528634.1|1802893_1804225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528635.1|1804519_1805017_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_164528636.1|1805291_1805699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528637.1|1806366_1807704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004912512.1|1807726_1808155_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_164528638.1|1808156_1808696_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_109911508.1|1808711_1809803_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_110732018.1|1809778_1811530_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_110732017.1|1811553_1813164_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_164528639.1|1813183_1816519_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_164528640.1|1816549_1817674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528641.1|1817677_1817935_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_164528642.1|1817979_1818957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528643.1|1818977_1821551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528644.1|1821563_1822250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528645.1|1822375_1824772_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.9	6.6e-16
WP_164528646.1|1824768_1827432_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.1	3.4e-98
WP_004912469.1|1827599_1828091_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_164528647.1|1828093_1829830_-	OmpA family protein	NA	NA	NA	NA	NA
WP_164528648.1|1829832_1830489_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004912456.1|1830485_1831823_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_109911521.1|1831845_1833390_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_110732011.1|1833409_1833907_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004912445.1|1835128_1835350_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	1.6e-09
WP_164529332.1|1835346_1836183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528649.1|1836205_1837225_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	46.8	8.0e-80
WP_164528650.1|1837221_1837755_+|capsid	capsid protein	capsid	Q94MZ5	Haemophilus_virus	51.2	2.0e-29
WP_164528651.1|1837824_1838337_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	64.0	1.8e-43
WP_004912432.1|1838339_1838567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528652.1|1838566_1841287_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.1	7.4e-64
WP_164528653.1|1841572_1841785_+	hypothetical protein	NA	F1BUM8	Cronobacter_phage	54.4	1.6e-11
WP_004906882.1|1842322_1842892_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	50.9	2.3e-36
>prophage 4
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	1988834	2001874	4596310		Klebsiella_phage(20.0%)	25	NA	NA
WP_164528683.1|1988834_1990010_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.7	1.8e-30
WP_123382603.1|1990011_1990227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528684.1|1990524_1990893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528685.1|1990921_1991077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528686.1|1991750_1992206_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.6	1.7e-26
WP_141240686.1|1992215_1992419_-	hypothetical protein	NA	A0A1U9ZAG7	Proteus_phage	48.1	1.2e-06
WP_164528687.1|1992432_1993209_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	39.5	1.8e-39
WP_164528688.1|1993293_1994208_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	52.5	6.3e-84
WP_164529334.1|1994357_1994546_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	1.2e-13
WP_164528381.1|1994653_1994920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528382.1|1994897_1995116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528689.1|1995145_1995355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123382609.1|1995510_1996182_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	56.2	1.1e-61
WP_102140689.1|1996254_1996449_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	64.9	3.8e-15
WP_164528690.1|1996486_1996945_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	6.2e-48
WP_164528691.1|1997227_1997407_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164528692.1|1997416_1998478_+	replication protein	NA	A0A248SL49	Klebsiella_phage	49.3	2.9e-32
WP_164529335.1|1998477_1998723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528693.1|1998722_1999256_+	phage N-6-adenine-methyltransferase	NA	Q4A1M4	Enterobacteria_phage	64.7	3.2e-64
WP_164528694.1|1999252_1999600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528695.1|1999596_1999983_+	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	60.4	4.4e-31
WP_164528696.1|1999979_2000165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528697.1|2000157_2000544_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	50.0	1.8e-24
WP_164528698.1|2000540_2001080_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	67.9	1.1e-43
WP_164528699.1|2001094_2001874_+	antitermination protein	NA	F1C595	Cronobacter_phage	48.4	1.2e-67
>prophage 5
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	2006097	2034944	4596310	terminase,tail	Cronobacter_phage(28.57%)	33	NA	NA
WP_164528705.1|2006097_2006454_+	DUF882 domain-containing protein	NA	A0A2D0VKR9	Proteus_phage	63.2	1.1e-36
WP_164528706.1|2006438_2006828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528707.1|2007552_2007735_+	hypothetical protein	NA	O64364	Escherichia_phage	67.2	3.7e-12
WP_164528708.1|2007934_2008123_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	85.2	1.2e-21
WP_164528709.1|2008581_2009169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528710.1|2009230_2010217_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	35.9	1.0e-31
WP_164528711.1|2010194_2011502_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.8e-151
WP_164528712.1|2011501_2012872_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	50.5	1.0e-122
WP_164528713.1|2012868_2013990_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.6	2.0e-103
WP_164528714.1|2014100_2014865_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	57.6	3.2e-65
WP_164528715.1|2014877_2015831_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.2	2.5e-128
WP_164529336.1|2015833_2016121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528716.1|2016162_2016642_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	48.3	1.0e-32
WP_164528717.1|2016644_2016998_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	42.1	1.4e-18
WP_164528718.1|2016999_2017581_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	57.0	6.2e-53
WP_164528719.1|2017577_2017979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528720.1|2018025_2018685_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	43.2	2.5e-42
WP_164529337.1|2018684_2018948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528721.1|2018940_2019255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154623732.1|2019305_2019542_+	hypothetical protein	NA	K7PMK8	Enterobacteria_phage	41.7	4.5e-10
WP_042847844.1|2019802_2019982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042848061.1|2019994_2020474_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_164528722.1|2020499_2021099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528723.1|2021355_2021706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528724.1|2022005_2022464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528725.1|2022524_2026031_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	39.2	1.4e-147
WP_164528726.1|2026075_2026417_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	46.4	1.1e-25
WP_164528727.1|2026413_2027157_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	53.8	4.1e-81
WP_164528728.1|2027153_2027864_+	peptidase P60	NA	F1C573	Cronobacter_phage	64.3	6.8e-86
WP_164528729.1|2027860_2028457_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.5	3.2e-60
WP_164528730.1|2028516_2032146_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	55.7	3.5e-295
WP_164528731.1|2032142_2033234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528732.1|2033459_2034944_+	hypothetical protein	NA	A0A1S6KUV1	Providencia_phage	30.1	4.4e-34
>prophage 6
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	2244326	2276260	4596310	terminase,integrase,tail	Salmonella_phage(25.0%)	38	2244093:2244152	2281840:2281934
2244093:2244152	attL	AATTGAGTGGGAATAATATAGCAATTGTTGATAACAGTTTTTAGTTATCGATAAATTCAA	NA	NA	NA	NA
WP_164528764.1|2244326_2245532_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.5	1.4e-136
WP_164528765.1|2245537_2245723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528766.1|2245715_2246369_-	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	64.7	2.4e-77
WP_164528767.1|2246375_2246555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528768.1|2246707_2246911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528769.1|2247099_2247654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528770.1|2247731_2248265_-	hypothetical protein	NA	A0A0S2MWC7	Cellulophaga_phage	30.5	1.8e-06
WP_043892873.1|2248545_2248875_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	40.2	2.0e-24
WP_164528771.1|2248943_2249246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528772.1|2249285_2250386_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	52.9	1.5e-103
WP_164528773.1|2250441_2252166_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	51.2	9.1e-100
WP_164528223.1|2252137_2252389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061063964.1|2252632_2253232_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	35.0	2.1e-27
WP_144141233.1|2253362_2253596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529342.1|2254187_2254964_+	hypothetical protein	NA	T1SA92	Salmonella_phage	45.0	2.1e-19
WP_164528774.1|2254932_2255406_+	replication protein	NA	NA	NA	NA	NA
WP_164528775.1|2255622_2256048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117162268.1|2256044_2256407_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	67.6	6.4e-40
WP_164528776.1|2256487_2257033_+	hypothetical protein	NA	A0A1B1W2E3	Salmonella_phage	41.8	6.3e-39
WP_164528777.1|2257035_2257308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528778.1|2257327_2257588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528779.1|2258021_2258651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528780.1|2258704_2259271_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	48.8	1.3e-39
WP_164528781.1|2259267_2260749_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	78.9	3.6e-238
WP_164528782.1|2260935_2261151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528783.1|2261166_2262819_+|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	67.4	4.2e-203
WP_164528784.1|2262815_2263139_+	hypothetical protein	NA	Q2A090	Sodalis_phage	54.9	1.9e-19
WP_164528785.1|2263135_2263804_+	peptidase	NA	G9L6C4	Escherichia_phage	57.1	2.7e-44
WP_109912478.1|2263820_2264810_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	62.3	6.8e-116
WP_164529343.1|2264874_2265306_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	51.4	2.0e-27
WP_164528786.1|2265314_2265656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528787.1|2265708_2266020_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	44.9	1.4e-14
WP_164528788.1|2266019_2266625_+	hypothetical protein	NA	A0A193GYT2	Enterobacter_phage	60.2	3.0e-66
WP_164528789.1|2266624_2269081_+	hypothetical protein	NA	Q858G3	Salmonella_phage	68.3	0.0e+00
WP_164528790.1|2269064_2269559_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	57.6	3.9e-48
WP_164528791.1|2269558_2270134_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.3	3.3e-46
WP_164528792.1|2270144_2272889_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	40.6	9.0e-102
WP_164528793.1|2272891_2276260_+	hypothetical protein	NA	A0A2I7R904	Vibrio_phage	35.9	1.6e-177
2281840:2281934	attR	AATTGAGTGGGAATAATATAGCAATTGTTGATAACAGTTTTTAGTTATCGATAAATTCAAAGGCATCAGTTAGTTACTGGTGCCTTTTTGTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	2516916	2554694	4596310	head,plate,integrase,portal,tail,terminase,capsid	Salmonella_phage(43.33%)	41	2547345:2547358	2553631:2553644
WP_109912188.1|2516916_2517330_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	63.5	1.2e-39
WP_164528849.1|2517457_2518969_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_164529347.1|2520726_2521521_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_164528850.1|2521549_2521798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528851.1|2521843_2522950_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	63.1	4.9e-131
WP_164528852.1|2523048_2524275_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	65.9	1.2e-149
WP_164528853.1|2524287_2524800_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	66.5	1.6e-60
WP_164528854.1|2524860_2525163_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	44.6	1.0e-11
WP_071585870.1|2525195_2525312_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_164528855.1|2525308_2528179_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	36.4	6.1e-125
WP_164528856.1|2528183_2528615_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.9	2.5e-46
WP_164528857.1|2528721_2529492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528858.1|2529652_2530003_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	48.0	3.8e-13
WP_164528859.1|2531627_2532239_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	66.3	1.6e-75
WP_164528860.1|2532231_2533143_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	66.7	2.0e-106
WP_141173610.1|2533145_2533487_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	60.4	6.7e-31
WP_164528861.1|2533483_2534113_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	51.4	1.1e-52
WP_164528862.1|2534109_2534748_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.7	3.0e-40
WP_004254663.1|2534740_2535193_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	33.6	7.3e-17
WP_004254667.1|2535192_2535363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528863.1|2535359_2535881_-	lysozyme	NA	H2DE61	Erwinia_phage	48.4	7.4e-13
WP_164528864.1|2535883_2536420_-	lysozyme	NA	H6WRZ4	Salmonella_phage	62.7	1.4e-62
WP_153673430.1|2536421_2536709_-	potassium channel protein	NA	A0A1V0E5R8	Salmonella_phage	40.7	3.5e-09
WP_164529348.1|2536930_2537419_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	51.9	8.4e-35
WP_164528865.1|2537521_2538217_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	48.7	3.0e-46
WP_141173620.1|2538237_2539287_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.9	8.0e-99
WP_164528866.1|2539333_2540155_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	36.7	2.3e-37
WP_164528867.1|2540317_2542042_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	61.0	1.3e-199
WP_164528868.1|2542044_2543100_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	59.0	1.6e-107
WP_164528869.1|2543586_2544414_+	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	35.3	3.8e-19
WP_164528870.1|2544512_2545778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528871.1|2546611_2549272_-	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	49.3	3.3e-250
2547345:2547358	attL	CCTTTAAATAATGG	NA	NA	NA	NA
WP_164528872.1|2549349_2549571_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	49.3	8.5e-11
WP_004254744.1|2549563_2549785_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_164528873.1|2550148_2550634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528874.1|2550630_2550957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528875.1|2550946_2551144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076913935.1|2551140_2551407_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	53.8	4.9e-21
WP_164528876.1|2551508_2551808_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	3.9e-35
WP_164528877.1|2551871_2552858_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	57.2	1.2e-107
WP_109912186.1|2553119_2554694_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	31.1	1.2e-37
2553631:2553644	attR	CCTTTAAATAATGG	NA	NA	NA	NA
>prophage 8
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	2802507	2810000	4596310		Tupanvirus(33.33%)	7	NA	NA
WP_109911252.1|2802507_2804493_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.9	5.7e-21
WP_164528917.1|2804492_2805485_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.4	6.7e-39
WP_109911251.1|2805484_2806630_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	26.8	1.7e-33
WP_164528918.1|2806749_2807526_-	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	28.9	6.5e-05
WP_164528919.1|2807528_2808530_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.6	4.0e-15
WP_109911248.1|2808651_2809647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004263721.1|2809703_2810000_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
>prophage 9
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	3099590	3194009	4596310	head,plate,holin,tail,lysis,terminase,tRNA	Acinetobacter_phage(27.78%)	102	NA	NA
WP_164528975.1|3099590_3100991_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.5	5.1e-77
WP_110732273.1|3101562_3102669_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.5	2.2e-99
WP_164528976.1|3103098_3104289_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_164528977.1|3104390_3112961_-	RTX toxin	NA	NA	NA	NA	NA
WP_164528978.1|3113120_3113768_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004256173.1|3113807_3114356_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	37.0	5.4e-06
WP_164528979.1|3114736_3116479_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_164528980.1|3116900_3121343_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004909591.1|3121342_3122068_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_109911049.1|3122048_3123374_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004909582.1|3123370_3124159_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_164528981.1|3124514_3125342_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_164528982.1|3125429_3126176_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004256203.1|3126181_3126361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004909576.1|3126498_3126714_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004909572.1|3127116_3128115_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004909568.1|3128111_3129857_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.0	7.4e-57
WP_164528983.1|3132461_3132716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004256221.1|3132750_3133038_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	1.1e-10
WP_004909559.1|3133094_3134768_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004909557.1|3134941_3135625_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_164528984.1|3135812_3137090_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_164528985.1|3137211_3138303_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	1.5e-84
WP_109911043.1|3138591_3140226_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_109911042.1|3140282_3140828_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_109911041.1|3141152_3141935_+	esterase	NA	NA	NA	NA	NA
WP_164528986.1|3142177_3144283_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	26.9	5.1e-36
WP_164528987.1|3144279_3145608_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_117162086.1|3147740_3147998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164528988.1|3147987_3148200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164528989.1|3148546_3149164_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.5	3.3e-28
WP_164529361.1|3149163_3149922_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.5	1.7e-34
WP_164528990.1|3150706_3151339_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	48.1	8.9e-45
WP_164528991.1|3151338_3152529_-	hypothetical protein	NA	A0A1X9SFA4	Acinetobacter_phage	44.7	8.2e-84
WP_164528992.1|3152525_3152879_-	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	50.4	7.2e-28
WP_164528993.1|3152882_3153569_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	43.9	1.1e-32
WP_164528994.1|3153555_3154437_-	hypothetical protein	NA	K4I0K5	Acinetobacter_phage	40.1	1.2e-50
WP_164528995.1|3155560_3156463_-	hypothetical protein	NA	A0A0R6PI23	Moraxella_phage	28.4	4.0e-22
WP_164528996.1|3156425_3156620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528997.1|3156878_3157142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528998.1|3157181_3157649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164528999.1|3157709_3160103_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	43.6	6.6e-157
WP_164529000.1|3160298_3160709_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	39.3	3.0e-17
WP_051473540.1|3160708_3161155_-	hypothetical protein	NA	E2GLU0	Acinetobacter_phage	42.9	7.2e-33
WP_164529001.1|3161168_3162629_-	DUF3383 domain-containing protein	NA	H9C0W5	Aeromonas_phage	34.6	1.5e-66
WP_164529002.1|3162638_3163127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529362.1|3163111_3163492_-	hypothetical protein	NA	A0A068CBI2	Acinetobacter_phage	43.3	1.0e-19
WP_164529003.1|3163481_3164048_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	31.5	2.0e-16
WP_164529363.1|3164040_3164499_-	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	43.7	1.8e-15
WP_164529004.1|3164525_3164843_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	33.0	1.6e-07
WP_164529005.1|3164902_3165901_-	DUF2184 domain-containing protein	NA	I2GUD7	Acinetobacter_phage	51.6	1.8e-84
WP_164529364.1|3165910_3166375_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	45.2	3.7e-16
WP_164529006.1|3166408_3167623_-	DUF2213 domain-containing protein	NA	K4I393	Acinetobacter_phage	55.9	2.0e-53
WP_164529007.1|3167635_3168427_-|head	phage head morphogenesis protein	head	A0A0D4DCM6	Acinetobacter_phage	40.5	5.9e-54
WP_164529008.1|3168398_3169931_-	DUF1073 domain-containing protein	NA	E2GLW8	Acinetobacter_phage	50.1	7.5e-114
WP_164529009.1|3169930_3171280_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	64.6	6.5e-170
WP_164529010.1|3171272_3171797_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	73.9	1.3e-62
WP_164529011.1|3171940_3172627_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	77.2	7.5e-98
WP_164529012.1|3173351_3173804_-|lysis	lysis protein	lysis	I6WLR5	Burkholderia_virus	34.6	7.3e-09
WP_164529013.1|3173800_3174217_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	53.0	3.0e-33
WP_094963034.1|3174209_3174539_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	53.2	1.8e-25
WP_164529014.1|3174912_3175695_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	52.7	3.2e-68
WP_164529015.1|3175691_3175895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529016.1|3175894_3176353_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	77.5	1.5e-65
WP_164529017.1|3176691_3176835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529018.1|3176834_3177005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529019.1|3177015_3177462_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	67.1	1.1e-54
WP_164529020.1|3177471_3177663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529021.1|3177810_3178029_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_164529022.1|3178015_3178285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529023.1|3178532_3178823_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	42.7	1.2e-12
WP_164529024.1|3178854_3179079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529025.1|3179094_3179769_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	55.6	4.8e-65
WP_164529026.1|3179765_3180707_-	replication protein 15	NA	A0A1P8DTG2	Proteus_phage	55.1	3.7e-71
WP_164529027.1|3180720_3181128_-	hypothetical protein	NA	G8C7U4	Escherichia_phage	55.7	1.2e-31
WP_164529028.1|3181154_3181481_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	74.1	8.3e-39
WP_164529029.1|3181586_3181814_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	64.0	5.4e-21
WP_164529030.1|3181893_3182331_+	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	76.3	1.9e-25
WP_164529031.1|3182373_3182697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529032.1|3182700_3183207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136134472.1|3183259_3183466_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	46.7	6.5e-05
WP_164529033.1|3183976_3184180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154601193.1|3184205_3184709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529034.1|3185203_3185794_+	DUF5420 family protein	NA	A0A2I7QRH1	Vibrio_phage	34.3	2.0e-14
WP_164529035.1|3185823_3186009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529036.1|3186010_3186253_+	hypothetical protein	NA	A0A0G2SS78	Proteus_phage	73.3	3.5e-10
WP_164529037.1|3186514_3187411_+	cell envelope biogenesis protein TolA	NA	K7P6J9	Enterobacteria_phage	75.2	2.1e-39
WP_140171620.1|3187428_3187866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529038.1|3187933_3188089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048606419.1|3188085_3188352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529039.1|3188493_3188871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529040.1|3188860_3189535_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	34.2	3.3e-21
WP_164529041.1|3189537_3190248_+	recombinase	NA	K7PKU3	Enterobacteria_phage	58.0	2.9e-76
WP_164529042.1|3190248_3190758_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	63.9	2.4e-56
WP_096864293.1|3190793_3191081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529043.1|3191375_3191909_+	hypothetical protein	NA	A0A2I7R6M5	Vibrio_phage	27.6	3.2e-11
WP_164529044.1|3191908_3192130_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	51.2	1.8e-13
WP_164529045.1|3192122_3192368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529046.1|3192526_3193081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529047.1|3193080_3193296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529048.1|3193255_3193474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529049.1|3193463_3194009_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.9	2.4e-59
>prophage 10
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	3237982	3305240	4596310	protease,lysis,tRNA	Planktothrix_phage(13.33%)	60	NA	NA
WP_109911024.1|3237982_3240265_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
WP_004909410.1|3240296_3240617_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	50.0	2.8e-15
WP_004909408.1|3241007_3241253_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	9.7e-16
WP_164529058.1|3241330_3242278_-	DUF1177 domain-containing protein	NA	NA	NA	NA	NA
WP_109911022.1|3242515_3243268_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109911021.1|3243264_3244098_-	hydrolase	NA	NA	NA	NA	NA
WP_004909397.1|3244108_3245455_-	cytosine permease	NA	NA	NA	NA	NA
WP_109911020.1|3245878_3247822_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	2.6e-39
WP_109911019.1|3247824_3248931_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_109911018.1|3249141_3250806_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_004909390.1|3251208_3252108_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004909389.1|3252159_3253641_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_004256404.1|3253739_3254468_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	38.6	9.0e-33
WP_004256405.1|3254486_3255230_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004909379.1|3255242_3255983_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004909376.1|3255979_3256648_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_164529059.1|3256790_3257948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529060.1|3258018_3259152_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	NA	NA	NA	NA
WP_109911013.1|3259161_3259677_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_109911012.1|3259816_3260143_-	YbjC family protein	NA	NA	NA	NA	NA
WP_004909359.1|3260303_3260567_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.2e-27
WP_004909357.1|3260814_3261243_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_164529061.1|3261443_3262052_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004909352.1|3262903_3264220_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_109911009.1|3264295_3265663_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_109911008.1|3265743_3266949_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.0e-98
WP_109911007.1|3267166_3267790_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_109911006.1|3267790_3268618_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_109911005.1|3269067_3269967_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	2.5e-08
WP_109911004.1|3269973_3271290_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004909336.1|3271293_3272364_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_004909334.1|3272377_3273445_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004909333.1|3273444_3274038_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_109911003.1|3274043_3274781_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004909328.1|3274762_3275539_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004909325.1|3275532_3276144_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_109911324.1|3276404_3276881_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_109911002.1|3276935_3277577_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	40.3	1.2e-17
WP_164529062.1|3277910_3281144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529063.1|3281213_3282410_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	32.5	2.4e-30
WP_164529064.1|3282546_3283953_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	2.5e-39
WP_004909274.1|3284195_3285779_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	6.3e-39
WP_123382133.1|3285961_3286342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123382134.1|3286541_3288380_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004909269.1|3288507_3289089_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	1.6e-29
WP_004256495.1|3289127_3289772_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	42.2	4.8e-38
WP_164529065.1|3289950_3290907_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004909264.1|3290993_3291554_-	LemA family protein	NA	NA	NA	NA	NA
WP_004256506.1|3291761_3292874_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_164529066.1|3293136_3295164_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.0	6.1e-55
WP_164529067.1|3295307_3295775_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_164529068.1|3295774_3296470_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_110731803.1|3296674_3297562_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_109910993.1|3297719_3298367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910992.1|3298353_3299022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910991.1|3299177_3300563_-|protease	serine protease	protease	NA	NA	NA	NA
WP_164529069.1|3300571_3301270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004909242.1|3301329_3301953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109910989.1|3302378_3304076_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_110731802.1|3304358_3305240_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	3463469	3474152	4596310		Mycobacterium_phage(25.0%)	11	NA	NA
WP_109913210.1|3463469_3464681_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.3	1.0e-105
WP_004908910.1|3464832_3465096_+	YbeD family protein	NA	NA	NA	NA	NA
WP_109913211.1|3465406_3466051_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004908904.1|3466174_3467140_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004257099.1|3467273_3467483_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	3.5e-22
WP_004908893.1|3467699_3468158_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	44.0	3.2e-20
WP_109913212.1|3468446_3468674_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	8.1e-17
WP_109913213.1|3468682_3469096_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	34.7	1.6e-10
WP_109913214.1|3469107_3471240_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	3.3e-208
WP_004908884.1|3471252_3472224_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.6	7.8e-133
WP_004908883.1|3472952_3474152_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	2.6e-29
>prophage 12
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	3688643	3750135	4596310	head,integrase,holin,portal,tail,protease,terminase,capsid	Cronobacter_phage(61.76%)	67	3687872:3687891	3717384:3717403
3687872:3687891	attL	TGAGACACTTTTGAGACACT	NA	NA	NA	NA
WP_164529133.1|3688643_3689675_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.2	8.0e-120
WP_164529134.1|3689691_3690282_-	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.9	4.3e-25
WP_164529135.1|3690426_3690651_+	regulator	NA	NA	NA	NA	NA
WP_164529136.1|3690680_3691190_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	50.3	6.9e-40
WP_164529137.1|3691192_3691348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529138.1|3691357_3691708_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	42.7	2.8e-16
WP_164529139.1|3691779_3691986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529369.1|3692198_3694397_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	53.6	1.3e-180
WP_164529140.1|3694356_3694728_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.3	3.5e-33
WP_096864691.1|3694848_3695070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141395919.1|3695055_3695373_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	56.7	4.5e-29
WP_164529141.1|3695372_3696404_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.3	1.7e-122
WP_164529142.1|3696403_3698191_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	64.2	1.1e-222
WP_164455387.1|3698352_3699135_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	42.9	1.6e-43
WP_048608874.1|3699156_3700185_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.7	7.0e-140
WP_164529143.1|3700188_3700896_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.4	6.8e-62
WP_164529144.1|3700994_3701405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164529145.1|3701383_3701836_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	50.0	3.5e-35
WP_164529146.1|3701832_3702312_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_164529147.1|3702301_3703000_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.4e-70
WP_164529148.1|3703012_3704131_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	63.2	4.9e-131
WP_164529149.1|3704130_3704586_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	64.2	7.0e-52
WP_048608858.1|3704602_3704896_+|holin	holin	holin	Q6K1I2	Salmonella_virus	48.8	2.4e-13
WP_164529150.1|3704892_3705303_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	46.9	3.2e-27
WP_164529151.1|3705299_3705677_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	50.0	6.3e-22
WP_096864679.1|3705778_3706042_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.9	1.8e-20
WP_164529152.1|3706229_3708329_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	45.3	9.5e-160
WP_164529153.1|3708321_3708657_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	2.4e-33
WP_164529154.1|3708646_3709837_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	62.8	1.7e-145
WP_164529155.1|3709823_3710441_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.0	3.1e-66
WP_164529156.1|3710453_3712484_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	54.9	1.0e-89
WP_164529157.1|3712483_3713098_+|tail	tail fiber assembly protein	tail	G4KKN5	Yersinia_phage	33.7	3.2e-23
WP_164529370.1|3713142_3713856_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	37.1	1.9e-35
WP_164529158.1|3713800_3714367_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	52.8	5.9e-40
WP_164529159.1|3714369_3716046_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	49.7	1.4e-137
WP_164529160.1|3716621_3717344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109911818.1|3718165_3718762_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3717384:3717403	attR	TGAGACACTTTTGAGACACT	NA	NA	NA	NA
WP_164529161.1|3718985_3721007_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_004908393.1|3721116_3722370_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_109911701.1|3722633_3723593_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	38.3	2.9e-39
WP_004908389.1|3724206_3724875_+	DedA family protein	NA	NA	NA	NA	NA
WP_109911700.1|3725112_3725418_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_004908385.1|3725424_3725832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004908381.1|3725818_3726118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004908378.1|3726355_3726751_+	DoxX family protein	NA	NA	NA	NA	NA
WP_117162551.1|3727142_3728036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109911697.1|3728159_3728867_+	pirin family protein	NA	NA	NA	NA	NA
WP_164529162.1|3729002_3730973_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_004908366.1|3731455_3731794_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_004908363.1|3731826_3732192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004258180.1|3732191_3732488_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_004258184.1|3732514_3733306_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_004908356.1|3733308_3733959_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_109911695.1|3734397_3735537_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_004908346.1|3735520_3736633_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_109911693.1|3736634_3737375_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_123382269.1|3737512_3738589_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_115167905.1|3739496_3740369_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	7.4e-50
WP_109911690.1|3740430_3742128_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_004908329.1|3742167_3742548_+	YraN family protein	NA	NA	NA	NA	NA
WP_004908326.1|3742662_3743253_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	30.8	1.9e-09
WP_109911689.1|3743262_3743838_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004908320.1|3743901_3744624_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_164529163.1|3744632_3745283_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_004908312.1|3745515_3747861_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.4	1.5e-44
WP_164529164.1|3748161_3749568_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042851523.1|3749640_3750135_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	41.8	2.6e-28
>prophage 13
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	4049212	4066262	4596310	integrase,transposase	Escherichia_phage(55.56%)	18	4049150:4049209	4062160:4062816
4049150:4049209	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4049212_4049917_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|4049807_4050767_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_063840321.1|4051058_4051613_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|4051743_4052574_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|4052711_4053344_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_164529211.1|4053428_4053881_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|4054103_4054451_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4054444_4055284_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4055411_4055912_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|4056087_4056870_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|4056859_4058383_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|4058505_4060050_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000344784.1|4060100_4060961_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|4061451_4062156_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_140173007.1|4062191_4062503_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000155092.1|4062692_4063577_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
4062160:4062816	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTTCAAACCAGTGACAGCATTACTCATTCAATCTTGGAACTCATCAACAATATGTTGATTGATCTTCTGGCAACAATGGCCCGCCTAGACAATGAGAAACGTATAGAACGTATTAAGCAGGGCCTGGCACGTTCGGGTTACAAACCAACAGGCAAGAAGGCAAATGAGGCTAAACATAAACGAATAAAAGAATTGCTAGTAGTTGGCAATATGACTAAGGAAGAAATTGCCAAAGCAGTGAATTGTGGAGTTGCAACTGTCTATCGAGTTGCTAAAGTTATCTAAAAGAGGCTTATCTCAACGCGCCCCCAATGGGGCACCGCTGCATTCAGGTTACTTCACATAAGAAATTTTATGTTAAATGATTGTTAGAAATGCCCCTTGATCGAGGCATTTTCTATAAAGAATACTAAAAACTAATTAAAGCCAACCAAGTTTCAAAACAAGGCAGTTCTCAGCAATCATATTTTTAAATTATATAACTCCCAACTGAGCTTTTGCTCCAACGATAAGGCTTTCATTTTGAGTTTCTAAGGCAAATAAACCATACATCAAAGGAGAGGCCGCTGCTCTTTCTAAAGTCTGTTCATATAGTTTA	NA	NA	NA	NA
WP_000052512.1|4063632_4065108_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_001067855.1|4065557_4066262_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 14
NZ_CP042859	Providencia sp. 1701011 chromosome, complete genome	4596310	4069766	4113602	4596310	integrase,transposase	Salmonella_phage(38.46%)	42	4082346:4082405	4109765:4109966
WP_000050481.1|4069766_4071308_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4071712_4072552_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4072545_4072893_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|4073115_4073568_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|4074308_4075121_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|4075124_4075490_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|4076166_4077708_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|4078112_4078952_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4078945_4079293_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000939727.1|4079441_4080263_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_071593219.1|4080394_4081186_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845054.1|4081331_4082345_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
4082346:4082405	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
WP_000454193.1|4082547_4082898_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|4083023_4083584_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|4083586_4086538_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|4086546_4086948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|4087032_4087737_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_164529212.1|4087794_4088631_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|4088661_4089546_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|4089768_4090983_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|4091010_4091316_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|4091427_4092921_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|4092951_4093203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|4093096_4093399_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_164529213.1|4093485_4094301_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|4094390_4095480_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|4095677_4096163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|4097973_4098726_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|4099147_4100173_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|4100401_4101178_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067855.1|4101291_4101996_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4102185_4103001_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|4103151_4103856_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_064732565.1|4103865_4104270_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_108168472.1|4104589_4104982_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_015344972.1|4105148_4106348_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001206356.1|4106909_4107701_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|4107706_4107952_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|4108108_4108606_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845054.1|4108750_4109764_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|4110069_4110627_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
4109765:4109966	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
WP_001138073.1|4110629_4113602_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
