The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	491904	520495	4945239	transposase	Stx2-converting_phage(33.33%)	30	NA	NA
WP_024176387.1|491904_493056_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_164529477.1|494342_494747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352248.1|495909_496302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221554.1|496467_497037_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001352362.1|497781_497958_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000840364.1|498258_498525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164529478.1|498593_498872_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813456.1|498966_499569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250235.1|500768_501686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352361.1|501770_502643_+	GTPase family protein	NA	NA	NA	NA	NA
WP_001016257.1|503134_503881_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|503895_505437_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_164529492.1|505630_508447_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001323397.1|508517_508676_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234729.1|508830_509649_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
WP_000855059.1|509990_510464_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|510479_510956_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|511018_511240_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001295723.1|511402_511771_+	antitoxin	NA	NA	NA	NA	NA
WP_000854761.1|511860_512238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|512449_512563_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001333339.1|512997_514533_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|514581_514929_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001341328.1|515050_515329_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
WP_001445118.1|515822_516212_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001016348.1|516665_516848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|516948_517278_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_057109539.1|517449_518508_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|518705_519179_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_000343760.1|519274_520495_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	564076	574381	4945239	transposase,integrase	Staphylococcus_phage(16.67%)	7	557698:557713	580570:580585
557698:557713	attL	TCGTTTTCCATTTTTA	NA	NA	NA	NA
WP_062914723.1|564076_565228_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.5e-42
WP_162497698.1|565276_566131_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.1e-66
WP_024189503.1|566406_567297_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
WP_001178345.1|568049_570740_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.5	5.5e-35
WP_001252306.1|571191_573045_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|573066_573648_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|573739_574381_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
580570:580585	attR	TAAAAATGGAAAACGA	NA	NA	NA	NA
>prophage 3
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	643926	651559	4945239		Enterobacteria_phage(100.0%)	7	NA	NA
WP_001551350.1|643926_645063_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
WP_001551351.1|645059_647060_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|647184_647646_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|647687_648158_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|648204_648924_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|648920_650606_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|650827_651559_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
>prophage 4
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	1257017	1270200	4945239		Escherichia_phage(50.0%)	12	NA	NA
WP_039023140.1|1257017_1259579_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|1259684_1260341_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|1260391_1261159_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847984.1|1261354_1262263_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590403.1|1262259_1263522_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1263518_1264157_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1264161_1264938_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|1265026_1266391_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1266484_1267477_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|1267539_1268679_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1268818_1269445_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1269438_1270200_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 5
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	2668569	2752077	4945239	tRNA,terminase,plate,holin,integrase,transposase,lysis,protease,head,capsid,tail,portal	Escherichia_phage(50.0%)	90	2661777:2661794	2753653:2753670
2661777:2661794	attL	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
WP_000560983.1|2668569_2669007_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|2669051_2669993_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|2670845_2671064_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|2671281_2671524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027703.1|2671853_2672783_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2672779_2673415_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|2673411_2674314_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077248221.1|2674326_2677377_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|2677570_2678404_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001295677.1|2678556_2679612_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931299.1|2679661_2681410_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019486.1|2681409_2682480_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446015.1|2682469_2683921_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|2683931_2684378_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|2684678_2684993_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179741.1|2685002_2685827_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001311268.1|2686277_2687537_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144073.1|2687533_2689003_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|2689290_2690127_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000863142.1|2690110_2691049_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_164529485.1|2691045_2692080_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000122641.1|2692364_2692985_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001270260.1|2694375_2695050_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2695155_2696529_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2696525_2697224_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2697373_2697874_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|2698060_2699041_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|2699110_2699404_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|2699540_2699813_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|2699982_2700483_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|2700546_2700771_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|2700770_2701073_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|2701072_2701297_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|2701293_2701569_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_002431311.1|2703043_2704585_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|2704599_2705346_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000012516.1|2706663_2709147_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000038166.1|2709518_2710553_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000156872.1|2710552_2712325_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085956.1|2712498_2713353_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_001248567.1|2713411_2714485_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_024176422.1|2714488_2715232_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_000988633.1|2715331_2715841_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846414.1|2715840_2716044_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000123123.1|2716047_2716329_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144097.1|2716328_2716826_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000736582.1|2716840_2717266_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_000040631.1|2717253_2717679_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_001440152.1|2717650_2717824_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917160.1|2717786_2718254_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001001770.1|2718246_2718699_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_001093698.1|2718765_2719401_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_000127167.1|2719397_2719745_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001121501.1|2719749_2720658_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_001285346.1|2720650_2721262_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001032315.1|2722556_2722973_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_024176421.1|2722944_2723547_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001333405.1|2723561_2724077_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_000839179.1|2724218_2724623_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2724619_2724967_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|2725015_2726551_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_062914736.1|2726558_2727161_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001286718.1|2727220_2728411_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|2728423_2728942_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|2728998_2729274_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|2729306_2729426_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069960.1|2729418_2731866_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000978889.1|2731880_2732360_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882940.1|2732359_2733523_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|2733604_2733823_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_085947770.1|2733895_2735264_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000416606.1|2735409_2736051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|2736258_2737161_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|2737341_2738304_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045683.1|2738623_2739613_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001326656.1|2739719_2740475_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216327.1|2740529_2741297_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|2741404_2742004_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|2742104_2742545_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|2742756_2743056_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323547.1|2743082_2743511_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|2743515_2744262_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|2744358_2745369_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|2745503_2747012_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2747034_2747880_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2748304_2748550_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2748634_2749120_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2749212_2750139_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|2750205_2751537_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|2751546_2752077_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
2753653:2753670	attR	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
>prophage 6
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	3233681	3309813	4945239	tRNA,terminase,integrase,lysis,protease,tail,portal	Escherichia_phage(36.36%)	79	3230596:3230624	3283572:3283600
3230596:3230624	attL	CGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001680166.1|3233681_3234905_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.8	7.6e-234
WP_001419254.1|3235161_3236862_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001377405.1|3237294_3237915_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001242749.1|3237914_3238277_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001401560.1|3238267_3238804_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_000081287.1|3238932_3239757_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|3239822_3240185_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000848749.1|3240930_3241605_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000649477.1|3241695_3241896_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|3241939_3242491_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001446923.1|3242487_3243324_+	Immunity region from phage	NA	A0A291AWU3	Escherichia_phage	100.0	1.0e-152
WP_001446924.1|3243328_3243553_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_001677149.1|3243549_3244368_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_001373594.1|3244364_3244859_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	100.0	3.9e-88
WP_000210170.1|3244858_3245185_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|3245181_3245571_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001709862.1|3245590_3246388_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.4e-150
WP_063090560.1|3246395_3247385_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	4.7e-194
WP_001547994.1|3247398_3248151_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_063090559.1|3248431_3248857_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	97.2	5.2e-73
WP_000917724.1|3249080_3249284_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_063090558.1|3249434_3250487_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	3.0e-207
WP_000839596.1|3250554_3250770_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|3250769_3251267_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_029700804.1|3251263_3251731_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	97.4	6.1e-75
WP_001139681.1|3251718_3251871_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_000373425.1|3252545_3253040_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934119.1|3253039_3255142_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	98.9	0.0e+00
WP_001072975.1|3255138_3255351_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985945.1|3255350_3256859_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.8	7.8e-289
WP_001136590.1|3256803_3258831_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|3258917_3259241_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283144.1|3259233_3259509_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677106.1|3259520_3260099_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|3260095_3260497_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_063090557.1|3260508_3261252_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	3.0e-132
WP_001300035.1|3261312_3261699_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|3261707_3262037_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447248.1|3265072_3265402_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152385.1|3265411_3266110_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_063090555.1|3266115_3266859_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	1.2e-146
WP_074148952.1|3266756_3267404_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.5	7.5e-108
WP_164529486.1|3267464_3270962_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_032329899.1|3271032_3271632_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	98.5	1.5e-110
WP_164529487.1|3271696_3275455_+	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	91.6	0.0e+00
WP_072286049.1|3275509_3275638_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	92.9	7.3e-15
WP_029365257.1|3276082_3277687_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001217545.1|3278044_3278305_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	8.1e-37
WP_000202564.1|3278524_3280111_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3280503_3281109_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3281235_3281397_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001543400.1|3281518_3282592_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563060.1|3282588_3283371_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088439.1|3283887_3284751_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
3283572:3283600	attR	CGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001143253.1|3284722_3286273_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3286530_3287310_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|3287436_3288759_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|3288810_3290034_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|3290113_3290833_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566153.1|3291107_3291257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105848.1|3291288_3292305_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3292332_3292977_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132956.1|3293082_3294051_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3294099_3295482_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093809.1|3295502_3296735_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.2e-82
WP_000007433.1|3296768_3296936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046749.1|3297042_3298710_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|3298920_3300858_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|3300946_3301273_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001742676.1|3301419_3301932_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942368.1|3301983_3302631_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|3302627_3303497_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3303707_3304181_+	protein CreA	NA	NA	NA	NA	NA
WP_001188664.1|3304193_3304883_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_001219614.1|3304882_3306307_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_164529488.1|3306390_3307716_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3307774_3308491_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001742685.1|3308586_3308727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223151.1|3309126_3309813_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	3513743	3586581	4945239	transposase,tRNA,protease,plate	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001295561.1|3513743_3515096_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3515125_3517558_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3517679_3518165_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|3518168_3519194_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3519298_3519754_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3519757_3520546_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|3520545_3521694_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|3521690_3522287_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|3522323_3525806_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3525818_3526778_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3526876_3529018_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|3529074_3529464_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|3529528_3530827_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3530875_3531136_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3531122_3531323_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|3531488_3532034_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|3532030_3532453_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|3532466_3533177_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|3533376_3534201_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|3534254_3535973_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|3536084_3536792_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3536788_3537193_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|3537310_3538126_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3538165_3538819_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|3538811_3539843_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|3540030_3540606_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|3546362_3547166_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|3547162_3548077_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3548317_3549118_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|3549121_3549745_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|3549792_3551151_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|3551222_3551978_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|3552011_3552734_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3552730_3553198_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|3553262_3553994_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|3554530_3555316_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|3555452_3555932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|3555941_3556856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|3556899_3557382_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|3557405_3558758_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|3558768_3562203_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|3562311_3563724_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|3563728_3564472_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|3564468_3567234_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|3567242_3568004_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|3568008_3569340_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3569342_3569867_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000348793.1|3571167_3572250_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|3572213_3574064_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|3574067_3574481_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|3574487_3575963_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|3576013_3576238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|3576272_3576773_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|3577467_3577986_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|3578195_3580337_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_039023185.1|3580412_3584645_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101841.1|3584622_3584841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008098.1|3584837_3585014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|3585444_3586581_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP033158	Escherichia coli strain CM IVRI KOL-1 chromosome, complete genome	4945239	4553683	4609725	4945239	tRNA,terminase,holin,integrase,head,capsid,tail,portal	Escherichia_phage(45.65%)	64	4548778:4548792	4555258:4555272
4548778:4548792	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074971.1|4553683_4554802_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|4554770_4555040_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|4555101_4557543_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
4555258:4555272	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|4557636_4557828_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|4557824_4558013_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|4558413_4558617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|4558581_4558800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042046576.1|4558871_4559171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|4559524_4559863_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|4560254_4560497_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|4560480_4560906_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|4560977_4562048_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|4562088_4562511_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000761441.1|4562511_4562925_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|4563018_4563201_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|4563193_4563370_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_011076332.1|4563814_4564033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|4564235_4564448_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|4564615_4564894_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|4564895_4565954_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|4565954_4566335_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|4566331_4567153_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|4567547_4567634_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|4568122_4568335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|4568405_4568741_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|4569001_4569190_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333561.1|4569186_4569348_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000372595.1|4569497_4569713_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|4569717_4570068_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|4570131_4570665_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|4570881_4571064_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|4571154_4571448_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|4571973_4572324_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|4572471_4572954_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|4572953_4574711_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000811487.1|4574707_4574869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923134.1|4574858_4576085_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000766109.1|4576690_4577908_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|4577984_4578302_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|4578310_4578649_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|4578645_4579095_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|4579091_4579436_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|4579496_4580201_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_000164661.1|4580215_4580587_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_077253127.1|4580628_4580889_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000224003.1|4580935_4584163_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|4584140_4584497_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|4584496_4585195_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|4585200_4585944_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_140428193.1|4585880_4586489_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	9.3e-100
WP_000515345.1|4586549_4590029_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|4590096_4590696_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_001189123.1|4594649_4596158_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_042047081.1|4597571_4598102_+	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_000241001.1|4598339_4599008_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|4599562_4600426_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4600409_4601546_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|4601795_4603022_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4603070_4604192_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4604267_4605728_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|4605727_4606399_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4606567_4607938_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4607941_4608583_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4608618_4609725_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP033159	Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR	146286	10177	62369	146286	transposase,protease,integrase	Escherichia_phage(30.77%)	49	4368:4383	15451:15466
4368:4383	attL	TCCACGCAGGTCCGGT	NA	NA	NA	NA
WP_000016970.1|10177_10984_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159871.1|10984_11290_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|11291_11510_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261286.1|12069_12300_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|12296_12713_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|12787_14353_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|14337_15360_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000449408.1|17609_17768_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
15451:15466	attR	ACCGGACCTGCGTGGA	NA	NA	NA	NA
WP_000949452.1|17757_18264_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|18446_19262_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|19608_21495_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|21535_22063_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|22166_23546_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|23548_24832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|24821_25952_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|25956_26652_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|26638_27124_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|27148_27634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|31147_31852_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023063803.1|31973_32888_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001137892.1|34121_34706_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|35198_35963_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001235713.1|36264_36822_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|37004_37865_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|38034_38790_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|38870_39419_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_014342205.1|39454_39832_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
WP_001067855.1|40025_40730_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|41288_42101_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201167.1|42104_42470_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|42474_43113_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|43123_44155_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|44467_46009_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|46413_47253_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|47246_47594_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|47757_48549_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_071523897.1|48554_48800_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|48956_49454_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|50519_51224_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|52845_53088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|53119_53770_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|53875_55075_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|55106_55991_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|56128_56521_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|57297_57903_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|57997_60895_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|61031_61433_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|61365_61623_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|61715_62369_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
