The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	844356	850914	4690918	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|844356_845313_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|845313_846081_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|846637_846895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|847946_849098_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|849017_849368_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|849468_850041_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|850089_850914_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 2
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	1764430	1802404	4690918	integrase,transposase	Bacillus_phage(44.44%)	30	1752884:1752898	1776909:1776923
1752884:1752898	attL	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000090707.1|1764430_1765273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000169527.1|1765743_1766043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1766039_1766906_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_099975594.1|1767024_1768644_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_001049180.1|1768643_1770092_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|1770132_1771689_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262420.1|1771700_1772627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|1772979_1773279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|1773842_1775669_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|1775837_1776188_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|1776334_1776766_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001377740.1|1777010_1778492_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
1776909:1776923	attR	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000697968.1|1778484_1779165_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|1779354_1780740_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|1780767_1781121_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|1781234_1782527_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574029.1|1782537_1785684_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000758224.1|1785770_1786211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353604.1|1786337_1788785_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
WP_000843494.1|1788825_1789023_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|1789056_1789794_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_001023257.1|1790082_1790532_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001242438.1|1792582_1793479_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|1793518_1793899_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|1793903_1794833_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|1794887_1795568_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|1795564_1796965_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|1797182_1797617_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001028905.1|1798275_1799328_-	DUF2776 domain-containing protein	NA	NA	NA	NA	NA
WP_088895425.1|1801175_1802404_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 3
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	2576306	2589489	4690918		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|2576306_2577068_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|2577061_2577688_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2577827_2578967_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2579029_2580022_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|2580115_2581480_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|2581568_2582345_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2582349_2582988_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2582984_2584247_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2584243_2585152_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2585347_2586115_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|2586165_2586822_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2586927_2589489_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	2678417	2689549	4690918	tail	Enterobacteria_phage(45.45%)	13	NA	NA
WP_023363292.1|2678417_2679317_-	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
WP_001596855.1|2679396_2681130_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001331174.1|2682314_2682521_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|2682580_2682796_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001596853.1|2682792_2683155_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_023363286.1|2683145_2683682_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
WP_023277820.1|2683810_2684635_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_000135680.1|2684700_2685063_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001311077.1|2685785_2686478_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|2686575_2686836_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000515841.1|2686828_2687380_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.4	4.9e-100
WP_164538690.1|2688707_2688965_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012135954.1|2688964_2689549_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
>prophage 5
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	3212538	3221980	4690918		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|3212538_3213465_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|3213469_3214201_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3214181_3214289_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3214348_3215080_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3215301_3216987_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3216983_3217703_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3217749_3218220_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3218260_3218722_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_089455097.1|3218846_3220847_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292773.1|3220843_3221980_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 6
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	3775522	3788399	4690918	tail	Escherichia_phage(30.0%)	11	NA	NA
WP_001678529.1|3775522_3776872_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147794.1|3778150_3779131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|3779650_3779758_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|3779802_3780015_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_023147795.1|3780547_3780826_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|3780827_3781877_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|3781889_3782264_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|3782260_3783082_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_001373320.1|3783827_3785990_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
WP_032181053.1|3786821_3788219_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_072163404.1|3788273_3788399_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 7
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	4190475	4201252	4690918	integrase	Enterobacteria_phage(40.0%)	11	4188450:4188473	4199955:4199978
4188450:4188473	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|4190475_4192431_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|4194794_4195334_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|4195516_4195828_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|4195824_4196505_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|4196501_4196660_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|4196656_4197721_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|4197874_4198093_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|4198140_4198380_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|4198519_4198756_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|4198745_4199888_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|4200001_4201252_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
4199955:4199978	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	4471121	4535332	4690918	integrase,portal,protease	Salmonella_phage(38.46%)	59	4481900:4481914	4536008:4536022
WP_000934041.1|4471121_4473398_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4473428_4473749_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_022645452.1|4474604_4474886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645451.1|4475144_4477034_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.4	1.2e-182
WP_022645450.1|4478131_4479541_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.2	4.0e-114
WP_000770177.1|4479537_4479837_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_022645449.1|4479842_4480076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645448.1|4480077_4480299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164538692.1|4480291_4480513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108048.1|4480900_4481206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206971.1|4481586_4481796_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	69.6	3.4e-17
4481900:4481914	attL	ACACAACCTTGCTAA	NA	NA	NA	NA
WP_022645445.1|4482215_4483454_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.5e-125
WP_000410785.1|4483858_4484083_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188182.1|4484155_4486102_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746468.1|4486098_4487214_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001309384.1|4487370_4488321_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|4488317_4489976_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|4490401_4491097_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|4491591_4492491_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|4492634_4494287_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001372573.1|4494298_4495267_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|4495399_4497118_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|4497154_4498156_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|4498166_4499597_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|4499695_4500709_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|4500705_4501536_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|4501532_4501856_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270738.1|4501981_4502497_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4502714_4503443_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|4503460_4504192_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001372575.1|4504198_4504915_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|4504914_4505583_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001372577.1|4505874_4506606_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000389260.1|4507946_4508435_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|4508494_4509340_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093864.1|4509336_4510290_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000126053.1|4511526_4512639_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4512988_4513465_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4513552_4514455_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|4514515_4515238_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|4515221_4515509_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|4515668_4515926_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|4515955_4516333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|4516602_4518288_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_001504085.1|4518523_4518742_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_072163412.1|4518832_4518976_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	83.8	5.5e-11
WP_001372578.1|4520401_4521430_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.8	3.4e-171
WP_023147874.1|4521460_4523305_-	P-loop domain protein, KAP family	NA	X2KLG0	Campylobacter_phage	26.2	1.8e-13
WP_001678413.1|4523403_4526055_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001376441.1|4526564_4526753_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_089455086.1|4526911_4529305_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.5	0.0e+00
WP_001544405.1|4529301_4530159_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|4530155_4530383_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|4530382_4530616_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|4530683_4531025_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|4531142_4531439_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|4531446_4531956_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|4531988_4532210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|4534279_4535332_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
4536008:4536022	attR	ACACAACCTTGCTAA	NA	NA	NA	NA
>prophage 9
NZ_CP034253	Escherichia coli strain IVRI Kol CP4 chromosome, complete genome	4690918	4617461	4642090	4690918	integrase,lysis,tail	Enterobacteria_phage(48.48%)	40	4616807:4616821	4642163:4642177
4616807:4616821	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|4617461_4618793_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|4618866_4619043_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_000539196.1|4619275_4619860_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000105084.1|4621698_4621932_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|4621988_4622399_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|4622750_4622903_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|4622890_4623358_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001372488.1|4623354_4623852_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|4623851_4624067_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|4625336_4626296_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|4626488_4627013_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|4627168_4627546_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|4627631_4627772_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|4627768_4628131_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|4628127_4628418_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|4628410_4628581_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|4628580_4629036_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|4629032_4629134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|4629226_4629679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|4629675_4630236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|4630720_4631014_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|4631010_4631712_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|4631708_4632638_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|4632724_4633264_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|4633333_4633564_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4633668_4634358_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|4634480_4635230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233576.1|4636560_4636767_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|4636842_4637139_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4637144_4637930_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|4637926_4638607_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|4638603_4638786_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|4638758_4638950_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|4638960_4639242_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|4639340_4639562_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|4639772_4640375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|4640617_4640785_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|4640824_4641043_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_151233600.1|4641020_4641314_+	hypothetical protein	NA	Q9MCR4	Enterobacteria_phage	100.0	1.6e-44
WP_001372425.1|4641397_4642090_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.6	4.3e-125
4642163:4642177	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
