The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	0	5908	5162306		Vibrio_phage(100.0%)	4	NA	NA
WP_000626404.1|313_1681_-	L-serine ammonia-lyase II	NA	NA	NA	NA	NA
WP_000450476.1|1738_3028_-	HAAAP family serine/threonine permease SdaC	NA	NA	NA	NA	NA
WP_000627995.1|3583_4948_-	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_000100411.1|5059_5908_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 2
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	10509	17556	5162306		Oenococcus_phage(33.33%)	4	NA	NA
WP_001521173.1|10509_11850_+	glucarate dehydratase-related protein	NA	Q6A202	Oenococcus_phage	23.8	3.5e-06
WP_000098243.1|11870_13211_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000186450.1|13441_16198_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_001521172.1|16254_17556_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	1.5e-38
>prophage 3
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	21574	26494	5162306		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
WP_000210878.1|21574_23212_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|23298_24597_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_020232912.1|24656_25529_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001199973.1|25822_26494_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 4
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	31209	31995	5162306		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_021523232.1|31209_31995_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 5
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	36663	38012	5162306	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190663.1|36663_38012_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 6
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	57465	59498	5162306		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|57465_58893_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_089502618.1|58892_59498_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	7.2e-28
>prophage 7
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	62609	66325	5162306		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|62609_63371_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_045149077.1|63364_63991_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|64130_65270_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|65332_66325_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 8
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	71538	78678	5162306		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|71538_72177_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|72173_73436_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|73432_74341_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|74536_75304_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|75354_76011_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|76116_78678_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 9
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	97785	98796	5162306		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015912547.1|97785_98796_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 10
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	106208	107174	5162306		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|106208_107174_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 11
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	112641	118028	5162306	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|112641_113139_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|113218_114280_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|114348_114849_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047170.1|114977_117608_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|117842_118028_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 12
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	131073	136371	5162306		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|131073_132276_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_001521117.1|132632_133592_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_020233016.1|133601_135746_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
WP_001521113.1|135727_136129_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_001223227.1|136125_136371_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 13
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	140305	144357	5162306		Clostridium_phage(50.0%)	4	NA	NA
WP_000522417.1|140305_140755_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000156814.1|140755_141418_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_089502620.1|141438_142839_-	GABA permease	NA	NA	NA	NA	NA
WP_000097652.1|143076_144357_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
>prophage 14
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	159786	160269	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001520337.1|159786_160269_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
>prophage 15
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	174014	175085	5162306		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|174014_175085_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 16
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	180990	183564	5162306		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|180990_183564_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 17
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	189144	192100	5162306	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_100190661.1|189144_190492_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
WP_000841103.1|190801_192100_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 18
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	197393	203481	5162306	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|197393_197813_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001521090.1|198019_199057_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262721.1|199104_199794_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000627804.1|200097_200481_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001521088.1|200542_201130_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001521087.1|201232_202114_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|202146_203481_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 19
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	209252	212994	5162306		Tupanvirus(50.0%)	3	NA	NA
WP_001521085.1|209252_211052_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|211067_212042_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|212313_212994_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 20
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	216453	216714	5162306		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|216453_216714_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 21
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	227570	232121	5162306		Bacillus_phage(50.0%)	4	NA	NA
WP_001298983.1|227570_228905_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|228965_229304_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001521077.1|229348_230539_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|230867_232121_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 22
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	237879	239391	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521073.1|237879_239391_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 23
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	254527	260865	5162306		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|254527_255742_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|255769_256156_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|256172_256496_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_001357290.1|256591_257107_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196617.1|257123_258974_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|258975_259311_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|259322_259523_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001521059.1|259581_260865_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
>prophage 24
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	270991	271423	5162306		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|270991_271423_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 25
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	291891	293268	5162306		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_021551967.1|291891_293268_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
>prophage 26
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	296635	298381	5162306		Escherichia_phage(100.0%)	4	NA	NA
WP_001521044.1|296635_297175_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
WP_014639259.1|297190_297709_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|298019_298211_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|298228_298381_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 27
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	304626	308628	5162306		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_020233339.1|304626_305265_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	1.2e-28
WP_001295474.1|305264_306302_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|306626_307253_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001309646.1|307338_308628_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	6.6e-63
>prophage 28
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	329894	330608	5162306		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|329894_330608_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 29
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	347875	348826	5162306		Cyanophage(100.0%)	1	NA	NA
WP_001003734.1|347875_348826_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 30
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	367432	373078	5162306	transposase	Deep-sea_thermophilic_phage(33.33%)	7	NA	NA
WP_021523195.1|367432_368302_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|368515_368941_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001296281.1|368927_369377_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_001520984.1|369437_370013_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|370108_371008_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000526135.1|371207_371666_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_020233887.1|371776_373078_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 31
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	376556	391938	5162306		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517443.1|376556_377348_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_000290240.1|377518_378535_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458420.1|378534_379368_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|379367_380243_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021036.1|380232_381330_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001306253.1|381463_382375_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	2.9e-57
WP_001520980.1|382377_382746_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|382850_383702_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|383743_384253_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|384293_386021_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|386065_386323_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|386706_387678_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|387862_388624_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001520979.1|388853_389852_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_001520978.1|389922_391938_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	3.8e-150
>prophage 32
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	419073	419808	5162306		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|419073_419808_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 33
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	423626	424547	5162306		Morganella_phage(100.0%)	1	NA	NA
WP_000484013.1|423626_424547_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 34
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	428237	429932	5162306		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001283480.1|428237_429932_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
>prophage 35
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	442463	443897	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_001520960.1|442463_443897_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	4.1e-29
>prophage 36
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	446942	447569	5162306		Clostridium_phage(100.0%)	1	NA	NA
WP_001102877.1|446942_447569_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.7	1.0e-08
>prophage 37
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	455637	458171	5162306	integrase	Stenotrophomonas_phage(50.0%)	2	446786:446808	457089:457111
446786:446808	attL	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_001535474.1|455637_456924_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_000368131.1|457238_458171_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
457089:457111	attR	TGGTGTCCCCTGCAGGAATCGAA	NA	NA	NA	NA
>prophage 38
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	476194	477280	5162306		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|476194_477280_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 39
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	485762	486899	5162306		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699144.1|485762_486899_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
>prophage 40
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	493363	494881	5162306		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|493363_494881_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 41
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	499092	500965	5162306		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|499092_499866_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001520932.1|500062_500965_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	2.4e-67
>prophage 42
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	511527	514754	5162306		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203403.1|511527_512178_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_001012889.1|512263_514096_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|514154_514754_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 43
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	549559	554563	5162306		Tupanvirus(50.0%)	4	NA	NA
WP_001551384.1|549559_551542_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.1e-19
WP_000461642.1|551541_552510_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_024166496.1|552513_553653_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.1	2.2e-30
WP_001306469.1|553960_554563_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 44
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	558164	562722	5162306	transposase	Oenococcus_phage(50.0%)	5	NA	NA
WP_021523190.1|558164_559370_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_001328560.1|559426_560716_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992991.1|560732_561536_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001520899.1|561576_561750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140566.1|561762_562722_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
>prophage 45
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	568614	569691	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000779071.1|568614_569691_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 46
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	572737	584564	5162306		Pseudomonas_phage(40.0%)	6	NA	NA
WP_021523189.1|572737_572992_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	63.1	1.5e-24
WP_000332037.1|572991_574122_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075170.1|574267_576553_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_021517215.1|577248_581007_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.7	7.7e-19
WP_000990765.1|581067_581790_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281227.1|581936_584564_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 47
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	599484	604327	5162306		Bacillus_phage(50.0%)	2	NA	NA
WP_000559127.1|599484_601311_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
WP_001520877.1|601477_604327_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.9	4.9e-42
>prophage 48
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	608490	614259	5162306		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865539.1|608490_609585_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	2.0e-116
WP_000406118.1|609696_610752_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786358.1|610825_611890_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884972.1|611889_612540_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422190.1|612615_614259_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.6	2.8e-13
>prophage 49
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	623025	623643	5162306		Bacillus_virus(100.0%)	1	NA	NA
WP_001328413.1|623025_623643_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 50
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	635339	642988	5162306		Vibrio_phage(50.0%)	7	NA	NA
WP_020233566.1|635339_636347_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	2.0e-83
WP_000494186.1|636485_636770_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|636894_638655_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|638804_639500_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_001595981.1|639527_640718_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_000202798.1|641050_641395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194914.1|641398_642988_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 51
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	648741	649308	5162306		Clostridioides_phage(100.0%)	1	NA	NA
WP_000241011.1|648741_649308_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 52
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	667535	668393	5162306		Catovirus(100.0%)	1	NA	NA
WP_000873880.1|667535_668393_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 53
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	672461	676234	5162306		Acinetobacter_phage(50.0%)	3	NA	NA
WP_001578658.1|672461_674441_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
WP_021517208.1|674471_675308_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|675565_676234_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 54
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	679928	681449	5162306		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|679928_681449_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 55
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	701702	711145	5162306		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569374.1|701702_702629_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783145.1|702633_703365_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|703345_703453_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|703512_704244_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|704465_706151_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|706147_706867_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|706913_707384_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|707425_707887_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021523183.1|708011_710012_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001520842.1|710008_711145_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 56
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	722582	786425	5162306	tail,tRNA,portal,lysis,head,holin,terminase,plate,integrase,capsid	Escherichia_phage(34.04%)	71	749764:749790	782111:782137
WP_001520834.1|722582_724616_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
WP_001005448.1|724747_725857_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001328276.1|726119_726401_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|726696_727239_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677340.1|727319_727994_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000702203.1|730504_731539_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|731620_731959_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|732177_733002_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|733122_733395_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195594.1|733617_734406_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822277.1|734402_735203_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_020233504.1|735267_736086_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000434044.1|736137_736884_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520829.1|736857_737823_-	kinase	NA	NA	NA	NA	NA
WP_001520828.1|737819_738824_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_000858471.1|738820_740098_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|740354_741407_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001308759.1|741636_742491_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182900.1|743786_744239_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|744269_744554_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|744557_745913_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001520826.1|745960_747001_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|747100_747880_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|747961_748861_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|749275_749593_+	hypothetical protein	NA	NA	NA	NA	NA
749764:749790	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|749869_750883_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001306384.1|750998_751298_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|751412_751688_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|751698_751869_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217662.1|751865_752366_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_164477113.1|752429_752687_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	8.6e-31
WP_020233503.1|752652_752955_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	98.0	1.5e-45
WP_001113264.1|752954_753179_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|753175_753451_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_016235238.1|753440_755726_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_015979593.1|755722_756052_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	98.7	5.1e-36
WP_015979595.1|757025_758786_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038161.1|759168_760203_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156847.1|760202_761975_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085952.1|762148_763003_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|763057_764131_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_000203438.1|764134_764878_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
WP_089502592.1|764977_765487_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	98.8	4.3e-90
WP_000846399.1|765486_765690_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|765693_765975_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|765974_766472_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736608.1|766486_766912_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001512906.1|766899_767325_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_072174950.1|767296_767470_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917186.1|767432_767900_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001802.1|767892_768345_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_021523179.1|768416_769202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233499.1|769285_769921_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127164.1|769917_770265_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|770269_771178_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|771170_771701_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_021523178.1|771711_773733_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_021523177.1|773734_774262_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_032142943.1|774483_775077_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_020233495.1|775406_776597_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251412.1|776609_777128_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233494.1|777184_777460_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|777492_777612_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|777604_780052_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|780066_780546_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_000882966.1|780545_781709_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|781790_782009_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001520824.1|782281_783643_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
782111:782137	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|783790_784123_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|784302_785025_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|785021_786425_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 57
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	800594	801947	5162306		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001520814.1|800594_801947_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	7.1e-07
>prophage 58
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	806610	817001	5162306		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|806610_807252_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|807343_807925_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_021523172.1|807946_809800_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_021523171.1|810073_811657_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|812315_813455_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|813460_813904_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_021523170.1|813906_816069_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|816161_817001_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 59
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	821244	828038	5162306		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|821244_822366_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_021523167.1|822368_823337_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	3.8e-87
WP_024166508.1|823336_823816_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_021523165.1|823812_825036_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|825038_826475_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_021523164.1|826667_828038_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
>prophage 60
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	833829	841347	5162306		Escherichia_phage(42.86%)	7	NA	NA
WP_021523160.1|833829_835224_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
WP_021523159.1|835381_836377_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|836608_837502_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|837873_838959_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|838958_839858_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|839915_840794_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|840798_841347_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 61
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	844733	851430	5162306		Catovirus(25.0%)	6	NA	NA
WP_021523151.1|844733_845666_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.3	2.4e-14
WP_021523150.1|845662_846715_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_032142977.1|846745_847456_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_021523148.1|847494_848514_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.5	1.5e-89
WP_021523147.1|848608_850015_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.7e-38
WP_021523146.1|850263_851430_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.3e-110
>prophage 62
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	858784	859684	5162306		Cellulophaga_phage(100.0%)	1	NA	NA
WP_021523143.1|858784_859684_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 63
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	867328	868495	5162306		Stx2-converting_phage(100.0%)	1	NA	NA
WP_021523140.1|867328_868495_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	4.2e-226
>prophage 64
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	872836	874995	5162306		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692323.1|872836_873058_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|873120_873597_-	RadC family protein	NA	NA	NA	NA	NA
WP_001703514.1|873612_874092_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	6.8e-13
WP_021523139.1|874173_874995_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	8.0e-46
>prophage 65
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	884773	885796	5162306	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000255926.1|884773_885796_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	7.0e-201
>prophage 66
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	932280	943296	5162306		Bacillus_phage(66.67%)	4	NA	NA
WP_000623056.1|932280_938388_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000970688.1|938578_939538_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001295636.1|939794_941507_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	2.3e-31
WP_001334858.1|941493_943296_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
>prophage 67
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	952199	962399	5162306		Bacillus_phage(40.0%)	8	NA	NA
WP_001339045.1|952199_952871_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826783.1|952870_954229_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001157256.1|956337_957756_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000228683.1|957736_958207_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001212225.1|958195_959116_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|959288_960206_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|960284_960467_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_020233536.1|960704_962399_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 68
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	978382	979638	5162306	transposase	Helicobacter_phage(33.33%)	3	NA	NA
WP_001347174.1|978382_978907_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_001336494.1|978929_979259_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_000334576.1|979140_979638_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.2	5.9e-52
>prophage 69
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	991649	992402	5162306		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|991649_992402_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 70
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1004381	1005896	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|1004381_1005896_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 71
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1015984	1021628	5162306		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001306742.1|1015984_1017646_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483203.1|1017691_1019293_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	1.6e-13
WP_000204344.1|1019311_1020172_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|1020174_1021224_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1021238_1021628_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 72
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1026148	1027882	5162306	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|1026148_1027882_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 73
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1034365	1036416	5162306		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019591.1|1034365_1035109_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1035149_1035545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001563891.1|1035597_1036416_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	4.6e-70
>prophage 74
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1040434	1047501	5162306		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|1040434_1040956_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001520719.1|1040957_1041560_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072146566.1|1041630_1041696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1041834_1042446_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568522.1|1042454_1043465_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_001520716.1|1043614_1044400_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202987.1|1044396_1045152_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_011076428.1|1045230_1046163_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1046178_1047501_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 75
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1051499	1052975	5162306		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1051499_1052975_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 76
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1061030	1065500	5162306		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|1061030_1061693_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011653.1|1061716_1062373_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1062474_1062705_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204705.1|1062843_1063218_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879330.1|1063221_1064094_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_001520705.1|1064106_1064448_+	YebY family protein	NA	NA	NA	NA	NA
WP_001520704.1|1064843_1065500_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	2.8e-57
>prophage 77
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1072996	1075045	5162306		Moraxella_phage(100.0%)	1	NA	NA
WP_001055785.1|1072996_1075045_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 78
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1080377	1080587	5162306		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1080377_1080587_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 79
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1086227	1087784	5162306		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1086227_1087784_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 80
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1091646	1093008	5162306		Pandoravirus(100.0%)	1	NA	NA
WP_001520695.1|1091646_1093008_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.8e-42
>prophage 81
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1098064	1099750	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000758422.1|1098064_1099750_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 82
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1114495	1119072	5162306		Bacillus_phage(100.0%)	3	NA	NA
WP_000766137.1|1114495_1115986_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000621404.1|1116166_1117642_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|1117788_1119072_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 83
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1132058	1136144	5162306		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723698.1|1132058_1133039_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
WP_000719088.1|1133175_1133934_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438819.1|1134051_1135410_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135079.1|1135502_1136144_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
>prophage 84
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1141069	1143025	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_021523123.1|1141069_1143025_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 85
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1147414	1148068	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_001520652.1|1147414_1148068_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	4.4e-15
>prophage 86
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1154832	1156053	5162306		Klosneuvirus(100.0%)	1	NA	NA
WP_000082004.1|1154832_1156053_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.5e-27
>prophage 87
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1163526	1164354	5162306		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|1163526_1164354_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 88
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1170482	1172744	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_001520636.1|1170482_1172744_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 89
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1184032	1203481	5162306	tRNA	Tupanvirus(22.22%)	18	NA	NA
WP_001144202.1|1184032_1185961_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|1185964_1186507_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|1186603_1186801_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1186854_1187211_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1187333_1187378_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|1187516_1188500_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672359.1|1188514_1190902_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|1190906_1191206_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_001520628.1|1191306_1192287_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|1192349_1192901_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|1192900_1193650_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209784.1|1193727_1194192_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	8.6e-13
WP_021517148.1|1195213_1196650_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|1196653_1196845_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001520625.1|1196976_1198023_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	1.2e-83
WP_000368046.1|1198179_1199013_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|1199345_1201724_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_023144643.1|1201780_1203481_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
>prophage 90
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1222072	1227156	5162306		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367171.1|1222072_1222441_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_001314771.1|1222449_1223937_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948865.1|1223946_1224693_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001520613.1|1224667_1225939_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001520612.1|1225935_1227156_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 91
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1235446	1237713	5162306		Escherichia_phage(50.0%)	3	NA	NA
WP_001309532.1|1235446_1236115_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
WP_020233101.1|1236111_1236897_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587571.1|1236900_1237713_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
>prophage 92
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1243219	1252023	5162306		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|1243219_1243861_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098886.1|1243900_1245049_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_001182362.1|1245339_1246551_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|1246663_1247596_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|1247592_1248618_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|1248916_1249006_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_001520605.1|1249171_1250341_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|1250486_1251068_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101181.1|1251195_1252023_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 93
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1260826	1262325	5162306		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|1260826_1261723_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001296937.1|1261803_1262325_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 94
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1269239	1401622	5162306	tail,tRNA,portal,lysis,head,terminase,transposase,protease,integrase,capsid	Enterobacteria_phage(33.33%)	150	1287115:1287131	1407545:1407561
WP_001295400.1|1269239_1270514_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001302086.1|1270575_1271436_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765742.1|1271479_1272085_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100932.1|1272190_1273693_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|1274303_1274939_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|1274938_1275634_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920799.1|1275637_1276258_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_029701344.1|1277319_1279542_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|1279534_1280113_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|1280112_1280694_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001306099.1|1280770_1281211_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|1281296_1281512_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|1281784_1281910_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282537.1|1282152_1283193_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|1283247_1284249_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459387.1|1284352_1285525_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|1285534_1287127_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
1287115:1287131	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_021523112.1|1287301_1288330_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|1288441_1289209_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_164477117.1|1289437_1290028_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520590.1|1290418_1292230_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
WP_020233466.1|1292226_1293600_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001520589.1|1293638_1294904_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_020233465.1|1294949_1296458_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001520587.1|1296558_1297734_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|1297932_1299579_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001520586.1|1299721_1301125_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001520585.1|1301121_1302051_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001298660.1|1303431_1304151_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|1304279_1304615_+	GlpM family protein	NA	NA	NA	NA	NA
WP_001552898.1|1304611_1305334_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|1305370_1306753_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|1306938_1307883_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001520575.1|1308406_1309939_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|1309949_1311338_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085276.1|1312444_1313674_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953272.1|1314038_1314227_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_088888692.1|1314284_1315310_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032346737.1|1315302_1315764_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|1315760_1315991_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336138.1|1315980_1316202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|1316194_1316560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|1316552_1316786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088888693.1|1316778_1317012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|1317017_1317317_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761836.1|1317313_1319068_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|1319356_1319635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|1319631_1320042_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|1320054_1320327_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|1320614_1321772_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|1321811_1322384_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|1322385_1323597_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|1323593_1323932_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|1323928_1324225_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|1324224_1324665_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1324648_1324831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1324953_1325310_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|1325293_1326955_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|1326968_1327250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118259.1|1327948_1328113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|1328524_1328890_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|1328876_1329206_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260850.1|1329244_1330066_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1330165_1330249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|1330341_1330677_-	acid shock protein	NA	NA	NA	NA	NA
WP_001019534.1|1332432_1333326_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021523109.1|1333460_1334681_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1334805_1335501_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071593650.1|1335453_1336746_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_001520571.1|1336904_1337519_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
WP_020233477.1|1337561_1338416_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520568.1|1338417_1339035_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_089502603.1|1339045_1341469_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	8.3e-208
WP_001551145.1|1341529_1343956_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|1344154_1344460_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|1344567_1345278_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1345280_1345841_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|1345875_1346217_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|1346351_1346678_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_001295394.1|1346883_1348098_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|1348109_1349129_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|1349186_1349315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523105.1|1349316_1350597_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_000005552.1|1350631_1350883_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048363.1|1350955_1353427_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|1353520_1353712_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1353708_1353897_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|1354383_1354959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1354960_1355116_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000381212.1|1355284_1355692_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|1355772_1356000_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705355.1|1355983_1356505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|1356485_1357451_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151242.1|1357491_1357890_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_021523102.1|1358092_1358758_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001265627.1|1358966_1359581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000915483.1|1359583_1360606_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000589005.1|1361089_1362403_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|1362839_1363172_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|1363374_1363680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|1363704_1363944_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1363943_1364231_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1364302_1364458_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|1364674_1364926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|1364992_1365271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|1365272_1366322_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|1366335_1367088_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|1367365_1367455_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|1367509_1367722_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|1368022_1368238_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|1368991_1369207_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|1369211_1369523_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|1369519_1370053_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|1370049_1370547_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|1370909_1371122_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|1371132_1371321_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|1371323_1371389_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|1371468_1371624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|1371795_1371969_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|1372120_1372531_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|1372588_1372822_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453587.1|1373210_1373756_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|1373730_1375656_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1375652_1375859_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001356819.1|1375855_1377457_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_020233915.1|1377437_1378757_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001708751.1|1378766_1379099_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063277.1|1379153_1380179_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_020233914.1|1380220_1380619_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000752979.1|1380630_1380984_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|1380995_1381574_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|1381570_1381966_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001349920.1|1381973_1382714_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1382729_1383152_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1383133_1383568_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_032153656.1|1383560_1386122_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000847345.1|1386118_1386448_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001551186.1|1386447_1387146_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_162543934.1|1387151_1387505_+	cell wall hydrolase	NA	K7PLW1	Enterobacteria_phage	98.0	9.9e-54
WP_162543933.1|1387501_1387894_+	C40 family peptidase	NA	A5LH41	Enterobacteria_phage	96.9	1.1e-72
WP_001542091.1|1392038_1392638_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|1392702_1395102_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|1395098_1395380_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|1395389_1396094_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|1396104_1396398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|1396625_1397216_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1397532_1397766_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1397834_1397948_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527786.1|1399922_1401383_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000214712.1|1401418_1401622_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
1407545:1407561	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 95
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1406514	1407405	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_001523326.1|1406514_1407405_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 96
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1414909	1417039	5162306		Pandoravirus(50.0%)	3	NA	NA
WP_001523317.1|1414909_1416349_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
WP_000803518.1|1416405_1416624_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|1416655_1417039_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 97
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1425255	1426203	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_077251915.1|1425255_1426203_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	4.3e-19
>prophage 98
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1434074	1435610	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_089502644.1|1434074_1435610_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.7e-20
>prophage 99
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1468360	1475296	5162306		Bacillus_phage(50.0%)	3	NA	NA
WP_001523278.1|1468360_1470046_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.8	2.2e-10
WP_001523277.1|1470083_1472456_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_023153758.1|1472500_1475296_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.7e-18
>prophage 100
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1480575	1484382	5162306		Bacillus_virus(50.0%)	2	NA	NA
WP_000426279.1|1480575_1481958_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001523271.1|1481982_1484382_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
>prophage 101
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1488698	1490604	5162306		Planktothrix_phage(100.0%)	2	NA	NA
WP_001523266.1|1488698_1489685_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
WP_001523264.1|1489677_1490604_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	5.9e-13
>prophage 102
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1493877	1495318	5162306		Tupanvirus(50.0%)	2	NA	NA
WP_089502666.1|1493877_1494888_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|1495033_1495318_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 103
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1502042	1503143	5162306		Enterobacteria_phage(100.0%)	2	NA	NA
WP_048218999.1|1502042_1502276_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	66.7	5.6e-21
WP_075208424.1|1502333_1503143_+	porin	NA	Q1MVN1	Enterobacteria_phage	65.4	2.7e-102
>prophage 104
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1509805	1511350	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_001523255.1|1509805_1511350_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 105
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1515937	1519058	5162306		Tetraselmis_virus(50.0%)	2	NA	NA
WP_001523249.1|1515937_1517914_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.5e-159
WP_020233927.1|1518008_1519058_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	3.1e-18
>prophage 106
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1524681	1526790	5162306		Ralstonia_phage(100.0%)	1	NA	NA
WP_001523247.1|1524681_1526790_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.6	5.3e-25
>prophage 107
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1531683	1533786	5162306		Salmonella_phage(100.0%)	1	NA	NA
WP_001523241.1|1531683_1533786_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
>prophage 108
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1540918	1657990	5162306	tail,tRNA,holin,terminase,transposase,integrase	Escherichia_phage(47.46%)	110	1576683:1576699	1657123:1657139
WP_001523231.1|1540918_1541932_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_164477118.1|1541909_1543094_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001523229.1|1543338_1544745_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|1544823_1545240_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001306887.1|1545285_1545462_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	2.1e-12
WP_000494241.1|1545683_1545914_+	YncJ family protein	NA	NA	NA	NA	NA
WP_024166512.1|1546005_1547967_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.6e-23
WP_020233877.1|1548039_1548576_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_000526135.1|1549946_1550405_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001261003.1|1550582_1551251_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586719.1|1551553_1552147_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|1552143_1553136_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001551086.1|1553259_1554240_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001523221.1|1554231_1554771_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1554833_1555058_-	YdcH family protein	NA	NA	NA	NA	NA
WP_048265110.1|1555197_1556853_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001523218.1|1557077_1558421_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1558637_1559561_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523216.1|1559598_1561239_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001309484.1|1561637_1561787_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731851.1|1561858_1562032_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001390056.1|1562276_1562807_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048645.1|1562995_1563997_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|1564038_1565478_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027943.1|1565674_1566475_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|1566590_1566968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|1567087_1567537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|1567523_1567862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517100.1|1568146_1572049_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048963.1|1572249_1572855_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|1572908_1574225_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|1574214_1575972_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
1576683:1576699	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177498.1|1576883_1577489_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|1577659_1579966_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_059321765.1|1581095_1583504_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|1587577_1587901_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|1587908_1588094_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_020233705.1|1588090_1590730_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1590937_1591927_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|1592037_1592460_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1592456_1592723_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_021517097.1|1592996_1596521_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1596887_1598021_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|1598161_1598596_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_113328759.1|1599204_1600095_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|1600094_1600922_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|1600918_1601776_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|1601772_1602630_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000354607.1|1603102_1603897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405873.1|1604442_1604736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|1604778_1605819_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|1605828_1606110_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|1606109_1608485_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001542091.1|1608549_1609149_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|1609216_1612696_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001152432.1|1614042_1614741_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|1614740_1615079_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_023153989.1|1615071_1618305_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_032139919.1|1618468_1618669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122452218.1|1618775_1619135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|1619285_1620248_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_000673077.1|1620274_1620667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164477119.1|1620663_1621044_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	43.6	9.5e-18
WP_000524260.1|1621044_1621428_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|1621427_1621823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|1621826_1622003_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_020233804.1|1622045_1623185_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000770042.1|1623283_1624048_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_001363932.1|1624152_1625265_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000763701.1|1625248_1626655_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|1626657_1627959_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089448.1|1627939_1629034_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000126788.1|1629037_1629247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233805.1|1629224_1630157_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_001291105.1|1630149_1630941_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|1631078_1632536_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_023153991.1|1633133_1633610_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_000781775.1|1633613_1633955_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001328752.1|1634031_1634334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208722.1|1634302_1634872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640106.1|1635093_1635636_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000228032.1|1635632_1635923_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000940344.1|1635922_1636522_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_001445776.1|1637389_1637731_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001445775.1|1637813_1637939_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_000200358.1|1638461_1639235_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000137958.1|1639355_1639859_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_029702111.1|1640019_1640442_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000450716.1|1640457_1641219_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_020233967.1|1641241_1641988_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_001396581.1|1641994_1642783_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|1642860_1643283_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|1643279_1643534_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|1643613_1644033_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|1644275_1644455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|1644465_1644621_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|1644617_1645106_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|1645547_1645769_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1645768_1645939_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|1646013_1646289_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|1646390_1648991_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|1648983_1649793_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1649848_1649998_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1650035_1650224_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1650323_1650539_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|1650540_1651776_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001523172.1|1651827_1652763_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123748.1|1652891_1654265_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1654742_1655726_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_100190652.1|1657042_1657990_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
1657123:1657139	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 109
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1667804	1668320	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945046.1|1667804_1668320_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 110
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1685603	1686686	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057972.1|1685603_1686686_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 111
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1700664	1703395	5162306	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_100190637.1|1700664_1702012_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000069237.1|1702129_1703395_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 112
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1716183	1718203	5162306		Bacillus_virus(50.0%)	2	NA	NA
WP_000573407.1|1716183_1716990_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_001523129.1|1717039_1718203_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	9.6e-29
>prophage 113
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1727136	1729071	5162306		Lactococcus_phage(100.0%)	1	NA	NA
WP_000484983.1|1727136_1729071_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 114
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1736883	1737474	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1736883_1737474_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 115
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1742398	1748401	5162306	protease,transposase	Tupanvirus(33.33%)	5	NA	NA
WP_001295576.1|1742398_1744996_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|1745375_1745627_+	YciN family protein	NA	NA	NA	NA	NA
WP_000526135.1|1745735_1746194_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001523120.1|1746373_1747423_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559277.1|1747642_1748401_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 116
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1756861	1759819	5162306		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763524.1|1756861_1758457_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001523118.1|1758460_1759819_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.7e-37
>prophage 117
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1771483	1773498	5162306		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|1771483_1772488_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110954.1|1772484_1773498_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 118
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1781909	1792632	5162306		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068076.1|1781909_1782527_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|1783130_1783544_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1783688_1784597_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|1784798_1785812_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|1785903_1786809_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001314642.1|1786921_1787380_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1787429_1788272_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1789709_1790387_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571694.1|1790386_1791097_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1791093_1792632_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 119
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1803765	1803996	5162306		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|1803765_1803996_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 120
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1807271	1811279	5162306		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|1807271_1808126_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|1808161_1808971_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200377.1|1808974_1809367_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456570.1|1809363_1810197_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1810196_1811279_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 121
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1814415	1815363	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_001298109.1|1814415_1815363_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 122
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1833032	1833791	5162306		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_029701750.1|1833032_1833791_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-14
>prophage 123
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1851746	1853434	5162306		Salmonella_phage(50.0%)	2	NA	NA
WP_001522918.1|1851746_1853015_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	8.7e-209
WP_000897378.1|1853014_1853434_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 124
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1865044	1867708	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_001522908.1|1865044_1867708_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	2.2e-84
>prophage 125
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1873253	1876992	5162306		Enterobacteria_phage(33.33%)	5	NA	NA
WP_089502640.1|1873253_1873985_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	4.6e-53
WP_001522899.1|1874205_1874610_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_019842521.1|1874662_1874773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020232865.1|1875315_1875639_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	62.6	6.3e-39
WP_001522898.1|1875741_1876992_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
>prophage 126
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1881641	1883012	5162306		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|1881641_1883012_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 127
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1888034	1890012	5162306		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531594.1|1888034_1889171_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799401.1|1889154_1890012_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 128
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1893283	1897006	5162306		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|1893283_1894105_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291248.1|1894120_1895032_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251363.1|1895060_1896305_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033689.1|1896304_1897006_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
>prophage 129
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1904294	1904552	5162306		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1904294_1904552_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 130
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1916874	1918517	5162306		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267945.1|1916874_1917879_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257007.1|1917875_1918517_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	3.4e-28
>prophage 131
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1922500	1923682	5162306		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1922500_1922737_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000007233.1|1922947_1923682_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
>prophage 132
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1936854	1937796	5162306		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001522863.1|1936854_1937796_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 133
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1953640	1953886	5162306		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1953640_1953886_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 134
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	1958548	2027389	5162306	transposase	Stx2-converting_phage(17.65%)	63	NA	NA
WP_000183364.1|1958548_1959469_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
WP_000074172.1|1959639_1960866_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_000180063.1|1960948_1961323_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_001237205.1|1961323_1961551_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_000526135.1|1961744_1962203_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001309403.1|1962434_1964978_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_001300662.1|1964970_1966506_-	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001522842.1|1966899_1968057_+	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_001590029.1|1968064_1969546_-	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_000857405.1|1969487_1970021_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
WP_000489569.1|1970115_1970427_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000992818.1|1970547_1970880_-	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_000771435.1|1970938_1971394_-	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_001360656.1|1971434_1971890_-	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_000481500.1|1972633_1973284_+	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_000833288.1|1973288_1973678_+	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_001264096.1|1973702_1974119_+	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_001189321.1|1974145_1974979_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
WP_001308552.1|1975042_1975534_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001921.1|1975635_1976190_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283664.1|1976213_1976951_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001522839.1|1977005_1977944_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_000839253.1|1979339_1979537_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032180032.1|1979553_1980042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|1980038_1980422_-	toxin	NA	NA	NA	NA	NA
WP_001285602.1|1980502_1980883_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086768.1|1980893_1981577_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.1	9.0e-27
WP_000692298.1|1981595_1981817_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|1981879_1982356_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|1982371_1982857_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001761104.1|1982948_1983770_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000581506.1|1984179_1984635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531238.1|1984710_1987227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180029.1|1987347_1990194_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|1990565_1991438_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032180028.1|1991804_1992500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180027.1|1992502_1993009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399639.1|1993005_1993836_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	30.2	5.4e-26
WP_024224214.1|1995157_1995397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032180025.1|1995436_1997875_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.4	1.9e-74
WP_032180130.1|1997886_1999230_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000312833.1|1999242_1999899_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000634203.1|1999895_2000963_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000108736.1|2000981_2004077_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	3.0e-53
WP_001122107.1|2004076_2004793_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000262203.1|2005995_2007294_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_164477121.1|2007359_2008079_-	amino acid racemase	NA	NA	NA	NA	NA
WP_001333359.1|2008423_2009368_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_021513032.1|2009485_2009944_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000976514.1|2010672_2011818_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2012141_2013404_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000483766.1|2013669_2015016_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179884.1|2015371_2015548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032262852.1|2015791_2016571_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_032180022.1|2018303_2019842_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_000612601.1|2019891_2020239_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_021566758.1|2020235_2020616_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2021070_2022084_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2022095_2023412_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2023439_2024360_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2024665_2025448_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2025449_2025548_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_104976704.1|2026160_2027389_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
>prophage 135
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2035934	2109687	5162306	protease,integrase,transposase	Escherichia_phage(20.0%)	59	2051082:2051096	2054414:2054428
WP_162895303.1|2035934_2037148_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_164477122.1|2037199_2038624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162895303.1|2040763_2041976_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_032180014.1|2045565_2046129_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_032141622.1|2048600_2048798_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2049042_2049339_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_042002566.1|2050450_2052268_+	hypothetical protein	NA	NA	NA	NA	NA
2051082:2051096	attL	AAAAAATAATTTCTG	NA	NA	NA	NA
WP_000279872.1|2052454_2053657_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_001522838.1|2053935_2055303_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.9e-20
2054414:2054428	attR	AAAAAATAATTTCTG	NA	NA	NA	NA
WP_021523062.1|2055894_2058318_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_001522835.1|2058326_2060345_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610446.1|2060337_2061663_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061098.1|2061664_2062078_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001304747.1|2062127_2063051_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.1e-91
WP_001522834.1|2063535_2064807_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154395.1|2064812_2065940_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2065997_2066828_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001522832.1|2067481_2068990_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2069148_2069358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522830.1|2069412_2073375_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191701.1|2073414_2074053_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001522828.1|2074340_2075432_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001445752.1|2075431_2076124_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|2076135_2076522_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001522827.1|2076529_2077342_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001172.1|2077338_2077929_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|2077939_2078434_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_021523061.1|2078454_2079783_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.9e-233
WP_001273658.1|2079865_2080039_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|2080411_2081008_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|2081028_2081256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522825.1|2081293_2082535_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_021523060.1|2082827_2084084_-	YccE family protein	NA	NA	NA	NA	NA
WP_164477123.1|2084343_2085270_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|2085262_2085568_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_100190637.1|2085665_2087014_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_001522821.1|2087096_2087696_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_020233001.1|2087692_2090239_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.5e-71
WP_001522819.1|2090238_2091411_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2091540_2092233_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001522818.1|2092205_2093234_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_071779334.1|2093316_2096061_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_001522816.1|2096132_2097206_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2097253_2097427_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_020232998.1|2097416_2097647_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2097621_2097810_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2097820_2098033_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2098318_2098531_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001522815.1|2098518_2099829_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|2099908_2100001_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001522814.1|2100013_2101150_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263563.1|2101161_2102706_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_001522812.1|2102839_2103697_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|2103693_2104092_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_021523058.1|2104088_2104676_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186413.1|2104672_2105380_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2105398_2107192_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2107188_2108307_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000375136.1|2109027_2109687_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 136
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2113920	2115975	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_020232990.1|2113920_2115975_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 137
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2128585	2130493	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|2128585_2130493_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 138
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2146411	2157194	5162306	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090506.1|2146411_2147179_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193813.1|2147220_2149833_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001305916.1|2150098_2151301_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025380284.1|2151469_2152870_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	3.1e-82
WP_000977905.1|2153472_2154546_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
WP_000462687.1|2154730_2155921_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109449.1|2155971_2156619_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2156645_2157194_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 139
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2171899	2176440	5162306		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|2171899_2173648_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_021523053.1|2173684_2175949_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2176155_2176440_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 140
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2181527	2182616	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|2181527_2182616_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 141
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2186714	2189929	5162306		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292809.1|2186714_2188997_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|2189188_2189929_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 142
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2194768	2217045	5162306	tRNA,protease	Escherichia_phage(18.18%)	15	NA	NA
WP_000213098.1|2194768_2195386_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850305.1|2195396_2197841_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000886683.1|2198079_2199372_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2199462_2200806_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001522754.1|2200816_2201428_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001522753.1|2201586_2205654_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2205788_2206283_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001522752.1|2206827_2207793_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043595.1|2207915_2209682_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522751.1|2209682_2211404_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001241678.1|2211445_2212150_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2212434_2212653_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2213870_2216147_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2216177_2216498_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2216820_2217045_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
>prophage 143
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2228349	2230068	5162306		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815339.1|2228349_2230068_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
>prophage 144
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2233655	2234486	5162306		Roseobacter_phage(100.0%)	1	NA	NA
WP_089502607.1|2233655_2234486_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 145
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2238166	2238895	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027208.1|2238166_2238895_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 146
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2242020	2251161	5162306		Streptococcus_phage(25.0%)	11	NA	NA
WP_001522739.1|2242020_2243148_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	1.8e-27
WP_000389260.1|2243188_2243677_-	YbjO family protein	NA	NA	NA	NA	NA
WP_072859476.1|2243736_2244582_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001522736.1|2244578_2245523_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001522735.1|2245532_2246666_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126102.1|2246760_2247873_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001522733.1|2248223_2248700_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2248787_2249690_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189134.1|2249750_2250473_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201580.1|2250456_2250744_-	YbjC family protein	NA	NA	NA	NA	NA
WP_001195231.1|2250903_2251161_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 147
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2259726	2260929	5162306		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2259726_2260929_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 148
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2273218	2275090	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_021523050.1|2273218_2275090_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-17
>prophage 149
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2278305	2282436	5162306		Synechococcus_phage(50.0%)	3	NA	NA
WP_001522680.1|2278305_2278968_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
WP_001522679.1|2279098_2279998_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001522678.1|2280003_2282436_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 150
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2290036	2291632	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_001522676.1|2290036_2291632_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	7.7e-61
>prophage 151
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2296628	2301853	5162306		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|2296628_2297144_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2297196_2297262_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|2297496_2298384_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_001522673.1|2298682_2299186_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	3.8e-06
WP_000843866.1|2299589_2300336_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|2300474_2301134_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2301130_2301853_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 152
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2305393	2320330	5162306		Erwinia_phage(16.67%)	14	NA	NA
WP_000710619.1|2305393_2305654_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_021517034.1|2305918_2308201_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_020233042.1|2308242_2308920_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.1e-19
WP_000146357.1|2308993_2309260_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|2309524_2309785_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001522665.1|2309923_2311009_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_001522664.1|2311149_2312112_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001522662.1|2312139_2314290_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	1.4e-41
WP_001522659.1|2314460_2314742_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_001522657.1|2314741_2315182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522656.1|2315338_2316703_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001522655.1|2316931_2317603_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_020233037.1|2317602_2318601_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_021551930.1|2318593_2320330_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 153
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2331314	2332223	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001522645.1|2331314_2332223_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
>prophage 154
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2338550	2339840	5162306		Klosneuvirus(100.0%)	1	NA	NA
WP_001309367.1|2338550_2339840_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 155
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2350031	2356606	5162306		Planktothrix_phage(33.33%)	7	NA	NA
WP_001522636.1|2350031_2351090_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.1e-20
WP_000604037.1|2351092_2351782_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001522635.1|2351781_2352555_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|2352720_2352870_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|2352998_2353787_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_089502638.1|2353854_2355327_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001265443.1|2355589_2356606_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 156
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2360968	2364487	5162306		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109181.1|2360968_2362021_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
WP_000784342.1|2362335_2362716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951276.1|2362829_2363771_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_001578005.1|2363767_2364487_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
>prophage 157
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2390501	2391899	5162306		Bordetella_phage(100.0%)	1	NA	NA
WP_001522602.1|2390501_2391899_+	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	32.5	8.8e-37
>prophage 158
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2419822	2434196	5162306		uncultured_Caudovirales_phage(40.0%)	10	NA	NA
WP_089502635.1|2419822_2421304_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	9.3e-45
WP_021517020.1|2421346_2422765_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.0e-61
WP_001522578.1|2422761_2423271_-	YbgA family protein	NA	NA	NA	NA	NA
WP_021523046.1|2424287_2424893_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.3	5.5e-20
WP_000720081.1|2424957_2425461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048219329.1|2425457_2429597_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.5	6.7e-24
WP_000424926.1|2429844_2430051_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|2430362_2430452_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_001522568.1|2430451_2432125_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001522567.1|2432147_2434196_+	potassium-transporting ATPase subunit KdpB	NA	A0A218MNH6	uncultured_virus	27.6	2.3e-25
>prophage 159
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2437449	2438127	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_000186102.1|2437449_2438127_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 160
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2444782	2445547	5162306		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773272.1|2444782_2445547_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
>prophage 161
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2449698	2454224	5162306	tRNA,transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_020233305.1|2449698_2451363_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
WP_000526135.1|2451595_2452054_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001522554.1|2452277_2454224_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
>prophage 162
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2458850	2460515	5162306		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337063.1|2458850_2460515_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 163
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2464609	2465689	5162306		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|2464609_2465689_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 164
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2471572	2476696	5162306	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_000631384.1|2471572_2472298_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_020233368.1|2472415_2473351_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001044880.1|2473395_2473878_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001157896.1|2474113_2476696_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 165
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2483706	2486146	5162306		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231416.1|2483706_2484795_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|2484934_2486146_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 166
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2490964	2491611	5162306		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|2490964_2491348_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|2491401_2491611_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 167
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2505698	2507813	5162306		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|2505698_2506127_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_032142912.1|2506247_2507813_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	1.7e-44
>prophage 168
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2510921	2512744	5162306		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029780.1|2510921_2512142_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	7.9e-58
WP_000502941.1|2512114_2512744_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 169
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2527033	2533076	5162306		Klosneuvirus(50.0%)	3	NA	NA
WP_000140646.1|2527033_2527849_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_021523039.1|2527845_2528979_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001522519.1|2529194_2533076_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	4.9e-61
>prophage 170
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2544504	2547648	5162306		Leptospira_phage(100.0%)	1	NA	NA
WP_001522511.1|2544504_2547648_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	9.8e-60
>prophage 171
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2550793	2555552	5162306		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|2550793_2551477_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_001522505.1|2553650_2555552_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	6.6e-27
>prophage 172
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2581181	2584312	5162306	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729154.1|2581181_2582048_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190286.1|2582049_2582262_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001522081.1|2582369_2582891_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912350.1|2582926_2584312_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 173
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2595747	2596893	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001522069.1|2595747_2596893_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.3	4.8e-49
>prophage 174
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2603085	2604867	5162306		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001309310.1|2603085_2604867_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 175
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2610975	2618629	5162306		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_021523019.1|2610975_2615103_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.5	1.1e-23
WP_001522060.1|2615531_2617946_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|2617942_2618629_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 176
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2621765	2622443	5162306		Bacillus_virus(100.0%)	1	NA	NA
WP_001522056.1|2621765_2622443_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 177
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2628146	2630309	5162306		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_089502651.1|2628146_2630309_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.1	3.2e-17
>prophage 178
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2655380	2657885	5162306		uncultured_virus(100.0%)	1	NA	NA
WP_001522043.1|2655380_2657885_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.0e-115
>prophage 179
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2664936	2676311	5162306	transposase	Bacillus_phage(20.0%)	10	NA	NA
WP_100190644.1|2664936_2666284_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000671574.1|2666397_2667702_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_000801805.1|2667853_2668813_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	2.5e-14
WP_001250117.1|2668809_2669772_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|2669903_2670548_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678201.1|2670728_2672603_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|2672712_2673318_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|2673317_2673647_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122011.1|2673699_2675631_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|2675759_2676311_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 180
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2683149	2686299	5162306		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|2683149_2686299_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 181
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2695135	2698682	5162306		Bacillus_phage(100.0%)	2	NA	NA
WP_001256221.1|2695135_2696917_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.8e-42
WP_021516960.1|2696909_2698682_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 182
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2702004	2702700	5162306		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|2702004_2702700_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 183
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2705840	2710887	5162306	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|2705840_2706113_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|2706321_2708676_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|2708863_2710138_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|2710263_2710887_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 184
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2734242	2737889	5162306	transposase	Staphylococcus_phage(33.33%)	4	NA	NA
WP_001021161.1|2734242_2734713_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001522013.1|2734800_2735904_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	6.3e-54
WP_000543535.1|2735907_2736357_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_071779335.1|2736731_2737889_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.0e-200
>prophage 185
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2741200	2745540	5162306	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000046637.1|2741200_2742172_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|2742182_2744030_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|2744057_2744390_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|2744412_2745540_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 186
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2754277	2760852	5162306		Bacillus_phage(75.0%)	4	NA	NA
WP_029702132.1|2754277_2755573_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.4	6.5e-26
WP_000113933.1|2755630_2756320_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001521994.1|2756509_2757712_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_001521993.1|2757708_2760852_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
>prophage 187
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2764310	2765222	5162306		Salmonella_phage(100.0%)	1	NA	NA
WP_001298537.1|2764310_2765222_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 188
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2769510	2770626	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_001521984.1|2769510_2770626_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 189
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2786066	2786834	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_001521976.1|2786066_2786834_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	2.1e-24
>prophage 190
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2792122	2793232	5162306		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|2792122_2793232_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 191
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2796315	2798276	5162306		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013507.1|2796315_2797329_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
WP_001521966.1|2797325_2798276_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
>prophage 192
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2803686	2807966	5162306		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805887.1|2803686_2804769_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.9	4.1e-191
WP_001521962.1|2804891_2807966_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.7	0.0e+00
>prophage 193
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2812491	2818086	5162306		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952490.1|2812491_2813391_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	1.9e-16
WP_001314516.1|2813430_2814714_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076233.1|2814703_2815963_-	cytosine permease	NA	NA	NA	NA	NA
WP_001521955.1|2816199_2818086_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.4e-53
>prophage 194
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2826466	2831004	5162306		Tupanvirus(50.0%)	4	NA	NA
WP_001521951.1|2826466_2827516_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.3e-72
WP_000750344.1|2827602_2828559_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818902.1|2828555_2829527_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021523012.1|2829519_2831004_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	4.7e-12
>prophage 195
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2843617	2849537	5162306	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000131040.1|2843617_2845651_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001376735.1|2845779_2846367_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089090.1|2846380_2847853_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001521934.1|2847866_2849537_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
>prophage 196
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2855111	2858416	5162306		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001046306.1|2855111_2856437_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474077.1|2856545_2856782_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001521928.1|2856793_2857387_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_021516948.1|2857546_2858416_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	7.1e-53
>prophage 197
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2864462	2865314	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521924.1|2864462_2865314_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.5e-47
>prophage 198
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2884310	2886509	5162306		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021516944.1|2884310_2886509_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
>prophage 199
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2898144	2901856	5162306		Streptococcus_phage(66.67%)	3	NA	NA
WP_001521908.1|2898144_2899398_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	2.9e-95
WP_001285288.1|2899409_2900513_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|2900800_2901856_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 200
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2912012	2915235	5162306		Clostridioides_phage(50.0%)	4	NA	NA
WP_016233951.1|2912012_2912762_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|2913062_2913803_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2913773_2914541_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2914656_2915235_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 201
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	2931941	2995878	5162306	tRNA,transposase,protease,plate	Escherichia_phage(20.0%)	52	NA	NA
WP_001521866.1|2931941_2932355_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|2932358_2934209_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|2934172_2935255_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|2935279_2936560_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2936556_2937081_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|2937083_2938415_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001521863.1|2938419_2939181_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_029702118.1|2939189_2942153_+	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	28.3	2.3e-74
WP_139471981.1|2944416_2946375_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_162895303.1|2946426_2947639_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001087587.1|2949174_2950527_+	membrane protein	NA	NA	NA	NA	NA
WP_000002621.1|2950550_2951033_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908071.1|2951076_2951991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521857.1|2952000_2952468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|2952616_2953402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|2953939_2954671_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|2954735_2955203_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|2955199_2955922_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021523003.1|2955955_2956711_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2956782_2958141_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001521855.1|2958187_2958958_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2959035_2959836_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|2960076_2960991_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|2960987_2961791_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_001520530.1|2967551_2968124_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|2968311_2969343_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2969335_2969989_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2970028_2970844_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202321.1|2970961_2971366_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094022.1|2971362_2972070_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_020233843.1|2972180_2973899_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021523001.1|2973951_2974776_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001520527.1|2974805_2975516_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635534.1|2975529_2975952_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|2975948_2976494_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|2976659_2976860_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062315.1|2976846_2977107_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001520525.1|2977155_2978454_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|2978518_2978908_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|2978964_2981106_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055748.1|2981203_2982163_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001520523.1|2982175_2985658_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
WP_000569434.1|2985694_2986291_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_000139675.1|2986287_2987436_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|2987435_2988224_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2988227_2988683_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|2988787_2989813_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|2989816_2990302_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|2990423_2992856_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001520521.1|2992885_2994238_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_020233386.1|2994249_2995107_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001520518.1|2995119_2995878_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 202
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3007726	3009151	5162306	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001520514.1|3007726_3009151_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 203
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3013080	3013425	5162306		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3013080_3013425_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 204
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3019336	3020134	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3019336_3020134_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 205
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3025272	3027702	5162306		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001520511.1|3025272_3027702_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
>prophage 206
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3041279	3042170	5162306	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_021522998.1|3041279_3042170_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	6.2e-60
>prophage 207
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3045432	3051894	5162306		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|3045432_3046359_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|3046467_3047130_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|3047170_3047707_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_021516789.1|3047912_3050297_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001550615.1|3050343_3051894_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
>prophage 208
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3059565	3060990	5162306		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3059565_3060990_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 209
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3069617	3070169	5162306		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|3069617_3070169_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 210
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3074414	3075458	5162306		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|3074414_3075458_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 211
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3101541	3103266	5162306		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425672.1|3101541_3103266_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 212
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3115755	3116454	5162306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916278.1|3115755_3116454_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 213
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3122786	3128208	5162306		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_032152759.1|3122786_3125138_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	8.7e-37
WP_001117011.1|3125301_3128208_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 214
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3137296	3139257	5162306		Microcystis_phage(50.0%)	4	NA	NA
WP_000257196.1|3137296_3138145_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_001520461.1|3138204_3138456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520458.1|3138458_3138692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000624375.1|3138777_3139257_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 215
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3147150	3152800	5162306		Vibrio_phage(50.0%)	4	NA	NA
WP_000787109.1|3147150_3148665_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|3148695_3149838_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349954.1|3149955_3151173_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001520452.1|3151246_3152800_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
>prophage 216
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3158303	3159452	5162306		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3158303_3159452_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 217
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3164238	3167055	5162306	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_001520439.1|3164238_3167055_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.3	3.5e-77
>prophage 218
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3176540	3185606	5162306		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681352.1|3176540_3177707_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
WP_000935262.1|3178235_3178445_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|3178548_3179679_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|3179767_3181684_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843579.1|3182058_3182463_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102367.1|3182488_3183202_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|3183350_3183917_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094685.1|3183950_3184538_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|3184652_3185606_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 219
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3199394	3200084	5162306		Bacillus_phage(100.0%)	1	NA	NA
WP_001188679.1|3199394_3200084_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 220
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3203270	3207086	5162306		Bacillus_phage(50.0%)	2	NA	NA
WP_021523345.1|3203270_3205208_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3205418_3207086_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
>prophage 221
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3212793	3214026	5162306		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|3212793_3214026_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 222
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3220743	3222066	5162306		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3220743_3222066_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 223
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3227653	3230529	5162306		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|3227653_3227815_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3227941_3228547_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|3228939_3230529_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 224
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3238424	3239704	5162306		Salmonella_phage(50.0%)	2	NA	NA
WP_001350779.1|3238424_3238964_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000799911.1|3238966_3239704_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 225
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3249660	3251325	5162306		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919580.1|3249660_3251325_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	5.3e-12
>prophage 226
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3266068	3266989	5162306	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181195.1|3266068_3266989_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 227
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3280055	3281516	5162306		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208176.1|3280055_3281516_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 228
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3291703	3361145	5162306	integrase,transposase	Stx2-converting_phage(33.33%)	58	3280249:3280264	3344099:3344114
3280249:3280264	attL	ACCACGTCAATGGCAT	NA	NA	NA	NA
WP_126709165.1|3291703_3292378_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.4	3.4e-50
WP_000790583.1|3292855_3293458_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_001295734.1|3294913_3295630_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001309184.1|3295649_3296756_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991438.1|3296820_3297801_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
WP_001323209.1|3298383_3299370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001054376.1|3300361_3300619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309181.1|3300630_3301176_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000354251.1|3301231_3301978_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000010829.1|3302763_3303885_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_000722973.1|3303881_3304160_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000460843.1|3304171_3305485_+	PTS system EIIC permease component	NA	NA	NA	NA	NA
WP_000118626.1|3305497_3306304_+	BtpA family protein SgcQ	NA	NA	NA	NA	NA
WP_000600622.1|3306876_3307509_+	ribulose-phosphate 3 epimerase family protein	NA	NA	NA	NA	NA
WP_000082780.1|3307525_3308308_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000251798.1|3308610_3309399_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000714563.1|3309403_3310309_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000116326.1|3310319_3312287_+	xylonate dehydratase YjhG	NA	NA	NA	NA	NA
WP_001128363.1|3312393_3313743_+	GntP family permease	NA	NA	NA	NA	NA
WP_000373366.1|3314089_3315076_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000471147.1|3315116_3316121_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_000439687.1|3316224_3316866_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001022014.1|3316896_3318012_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000132327.1|3318021_3319281_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_001295723.1|3320207_3320576_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|3320738_3320960_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|3321022_3321499_-	RadC family protein	NA	NA	NA	NA	NA
WP_001234656.1|3322327_3323146_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001323397.1|3323300_3323459_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820500.1|3323529_3326649_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069701.1|3327021_3327894_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|3329124_3330609_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000813451.1|3330930_3331533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221515.1|3333353_3333923_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270981.1|3334182_3334584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|3334571_3335006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|3335360_3335741_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|3335737_3336085_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|3336134_3337520_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3337758_3339117_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3339867_3340125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3341873_3342395_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068913.1|3342391_3343345_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|3343431_3345756_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
3344099:3344114	attR	ATGCCATTGACGTGGT	NA	NA	NA	NA
WP_000879164.1|3345800_3346703_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|3346699_3347698_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684855.1|3347694_3348651_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000175457.1|3348651_3349419_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3349975_3350233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|3351166_3351469_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|3351504_3352323_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000625671.1|3354535_3354949_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|3354883_3356051_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|3356364_3356622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|3356674_3356800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|3356842_3357961_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|3357972_3359190_-	MFS transporter	NA	NA	NA	NA	NA
WP_000547193.1|3359816_3361145_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 229
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3365702	3366722	5162306		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001318460.1|3365702_3366722_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
>prophage 230
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3371849	3381125	5162306	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
WP_021523335.1|3371849_3373352_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
WP_001295681.1|3373512_3374595_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|3374594_3375695_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|3375961_3377473_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|3377826_3378270_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416387.1|3378269_3381125_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 231
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3390102	3396199	5162306		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|3390102_3391038_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|3391050_3391512_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|3391584_3391971_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471850.1|3392176_3394873_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_001387276.1|3395013_3395067_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|3395251_3396199_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 232
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3399837	3403147	5162306		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000187798.1|3399837_3401976_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_164477127.1|3401991_3402171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009182.1|3402159_3402624_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_001105433.1|3402624_3402915_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_000212715.1|3402904_3403147_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
>prophage 233
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3407606	3414087	5162306		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|3407606_3408605_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596021.1|3408637_3409633_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001361374.1|3409619_3410642_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001522399.1|3410655_3412158_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001522398.1|3412290_3413247_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|3413556_3414087_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 234
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3435234	3436443	5162306	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_024194431.1|3435234_3436443_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.0e-206
>prophage 235
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3450737	3451901	5162306		Ralstonia_phage(100.0%)	1	NA	NA
WP_000944019.1|3450737_3451901_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
>prophage 236
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3455744	3468775	5162306	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076315.1|3455744_3458186_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|3458224_3458650_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3458854_3460153_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|3460256_3460454_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3460535_3461540_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312481.1|3461542_3462802_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_164477129.1|3462887_3464168_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3464243_3464552_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|3464637_3465588_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122460.1|3465580_3467428_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_020233522.1|3467437_3468775_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 237
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3472810	3473356	5162306		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3472810_3473356_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 238
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3480784	3481762	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3480784_3481762_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 239
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3486681	3487215	5162306		Morganella_phage(100.0%)	1	NA	NA
WP_001522351.1|3486681_3487215_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
>prophage 240
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3492129	3494113	5162306		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|3492129_3493776_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3493819_3494113_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 241
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3502446	3503712	5162306	integrase	Enterobacteria_phage(100.0%)	1	3497443:3497455	3506861:3506873
3497443:3497455	attL	ATGCCAGCTAAAG	NA	NA	NA	NA
WP_001218773.1|3502446_3503712_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
WP_001218773.1|3502446_3503712_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	7.2e-78
3506861:3506873	attR	CTTTAGCTGGCAT	NA	NA	NA	NA
>prophage 242
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3514334	3516178	5162306		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502858.1|3514334_3514973_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	3.0e-56
WP_032180381.1|3514957_3516178_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	7.2e-59
>prophage 243
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3521731	3522945	5162306	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_162895303.1|3521731_3522945_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
>prophage 244
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3533220	3533796	5162306		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000722279.1|3533220_3533796_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 245
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3540621	3544203	5162306		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000792585.1|3540621_3541851_+	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
WP_000494233.1|3541867_3542923_+	response regulator	NA	NA	NA	NA	NA
WP_001001003.1|3543051_3544203_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
>prophage 246
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3564220	3566560	5162306		Yersinia_phage(33.33%)	4	NA	NA
WP_001175165.1|3564220_3565039_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
WP_000706978.1|3565304_3565784_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.2e-12
WP_001186774.1|3565799_3566276_+	RadC family protein	NA	NA	NA	NA	NA
WP_023356553.1|3566338_3566560_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
>prophage 247
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3575175	3578387	5162306	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856827.1|3575175_3576633_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.8	2.3e-48
WP_000003806.1|3576869_3578387_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 248
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3599584	3601087	5162306		Burkholderia_virus(100.0%)	1	NA	NA
WP_001305708.1|3599584_3601087_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	7.0e-56
>prophage 249
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3605926	3606715	5162306		Cedratvirus(100.0%)	1	NA	NA
WP_089502621.1|3605926_3606715_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	3.2e-12
>prophage 250
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3612339	3613889	5162306		Bacillus_virus(50.0%)	2	NA	NA
WP_001075537.1|3612339_3613098_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
WP_000611392.1|3613208_3613889_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	6.7e-06
>prophage 251
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3617771	3619757	5162306		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001522248.1|3617771_3619757_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	4.6e-148
>prophage 252
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3625001	3627149	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_077468916.1|3625001_3627149_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	3.1e-33
>prophage 253
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3643999	3645349	5162306		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3643999_3645349_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 254
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3649166	3652780	5162306		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|3649166_3649703_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|3649957_3652780_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 255
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3656986	3659534	5162306		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147328.1|3656986_3658066_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|3658118_3659534_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 256
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3666095	3666704	5162306		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3666095_3666704_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 257
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3675919	3677035	5162306		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3675919_3677035_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 258
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3698631	3705600	5162306	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_100190637.1|3698631_3699980_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_000956830.1|3700065_3701697_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000096041.1|3701916_3705600_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 259
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3721522	3723112	5162306		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187540.1|3721522_3723112_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 260
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3728501	3730265	5162306		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|3728501_3728774_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|3728960_3729551_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|3729593_3730265_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 261
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3739628	3747957	5162306		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|3739628_3743852_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|3743928_3747957_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 262
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3752073	3755126	5162306		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|3752073_3753258_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023085.1|3754175_3755126_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
>prophage 263
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3763463	3765308	5162306		Acinetobacter_phage(100.0%)	1	NA	NA
WP_021523320.1|3763463_3765308_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
>prophage 264
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3782294	3789541	5162306		Serratia_phage(33.33%)	5	NA	NA
WP_001521845.1|3782294_3784592_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_001521843.1|3784642_3784963_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|3784977_3786057_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001521842.1|3786365_3788867_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424838.1|3788878_3789541_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 265
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3805277	3809450	5162306		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032152781.1|3805277_3809450_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	33.5	4.0e-24
>prophage 266
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3815086	3819589	5162306		Erwinia_phage(50.0%)	5	NA	NA
WP_001293344.1|3815086_3816418_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|3816484_3817411_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|3817503_3817989_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|3818073_3818319_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|3818743_3819589_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 267
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3831163	3836023	5162306		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|3831163_3831862_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580427.1|3831858_3833232_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	2.9e-16
WP_001270251.1|3833337_3834012_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_071892900.1|3834160_3835105_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|3835402_3836023_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 268
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3851780	3854831	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|3851780_3854831_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 269
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3866342	3869122	5162306		Escherichia_phage(50.0%)	3	NA	NA
WP_001521801.1|3866342_3867128_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_001521800.1|3867161_3868058_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_001521799.1|3868225_3869122_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	1.8e-59
>prophage 270
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3886118	3888589	5162306		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|3886118_3887168_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|3887179_3888589_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 271
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3892667	3895454	5162306		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3892667_3895454_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 272
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3902285	3903634	5162306	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_100190636.1|3902285_3903634_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
>prophage 273
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3911286	3911901	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3911286_3911901_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 274
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3920682	3923969	5162306		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|3920682_3921459_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459600.1|3921461_3921977_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|3921980_3922250_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187543.1|3922328_3923969_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 275
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3938606	3940436	5162306		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3938606_3940436_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 276
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3947813	3951672	5162306		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|3947813_3949976_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|3950059_3950776_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|3950775_3951672_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 277
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3961972	3963628	5162306		Tetraselmis_virus(100.0%)	1	NA	NA
WP_021523313.1|3961972_3963628_+	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	6.1e-45
>prophage 278
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3971645	3975885	5162306		uncultured_marine_virus(33.33%)	4	NA	NA
WP_000612044.1|3971645_3972776_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145185.1|3972780_3973455_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_001521756.1|3973495_3974758_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.3e-23
WP_001306792.1|3974754_3975885_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
>prophage 279
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3979915	3985329	5162306		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3979915_3980245_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_001521751.1|3980375_3981641_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	5.4e-41
WP_001445788.1|3981776_3983261_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001521748.1|3983307_3985329_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 280
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	3993653	3995300	5162306		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012630.1|3993653_3995300_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.2	6.7e-68
>prophage 281
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4008690	4015249	5162306	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
WP_020233744.1|4008690_4009578_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	4.3e-05
WP_000211858.1|4009602_4010568_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|4010572_4012078_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|4012085_4012505_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000526135.1|4012740_4013199_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000102332.1|4013380_4015249_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.3e-64
>prophage 282
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4018417	4019410	5162306		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|4018417_4019410_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 283
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4031362	4038877	5162306		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
WP_001521725.1|4031362_4032733_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	6.9e-34
WP_000334086.1|4032894_4034724_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_000867151.1|4035037_4036078_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|4036163_4037123_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|4037122_4038013_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|4038103_4038877_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 284
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4047880	4049218	5162306		Moraxella_phage(100.0%)	1	NA	NA
WP_001316740.1|4047880_4049218_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 285
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4061885	4069254	5162306		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|4061885_4062143_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|4062106_4062466_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|4062482_4062623_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_122134670.1|4062852_4062933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059111.1|4063229_4064633_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|4064637_4065738_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|4065737_4066811_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_001521708.1|4066839_4069254_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 286
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4073958	4075107	5162306		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4073958_4075107_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 287
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4079532	4080486	5162306		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|4079532_4079946_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|4080057_4080486_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 288
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4087345	4095821	5162306		Aeromonas_phage(25.0%)	8	NA	NA
WP_001521693.1|4087345_4089061_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
WP_001521692.1|4089057_4090551_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.7	6.6e-30
WP_001113432.1|4090946_4091309_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148043.1|4091305_4091803_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001306726.1|4091810_4092995_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|4093274_4093364_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|4093928_4094027_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001521691.1|4094132_4095821_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.3e-55
>prophage 289
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4140283	4141468	5162306	integrase	Enterobacteria_phage(100.0%)	1	4133446:4133462	4146662:4146678
4133446:4133462	attL	AATGCCGTTAATCAGTA	NA	NA	NA	NA
WP_001218910.1|4140283_4141468_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
WP_001218910.1|4140283_4141468_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
4146662:4146678	attR	TACTGATTAACGGCATT	NA	NA	NA	NA
>prophage 290
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4154976	4156368	5162306		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4154976_4156368_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 291
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4160668	4185815	5162306	integrase	Morganella_phage(35.71%)	27	4153275:4153288	4188192:4188205
4153275:4153288	attL	CATTGGCCTGAATA	NA	NA	NA	NA
WP_000280473.1|4160668_4162777_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|4162795_4163071_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001521613.1|4163125_4163749_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.9	7.0e-18
WP_001521612.1|4164006_4165689_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	3.9e-23
WP_000924289.1|4165685_4166303_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001521610.1|4166595_4167420_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	79.0	1.2e-97
WP_000617439.1|4168169_4168457_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000230718.1|4168716_4169160_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|4169176_4169554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|4169557_4170040_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000560496.1|4170952_4171342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029844.1|4171360_4173466_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	7.2e-91
WP_164477135.1|4174854_4175562_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	71.6	7.3e-56
WP_000420674.1|4175555_4176017_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|4176033_4176195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244106.1|4176779_4179536_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001058744.1|4179548_4180151_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|4180143_4180365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|4180361_4180625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|4180621_4180816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958754.1|4180808_4181837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042977.1|4181830_4182013_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_089502642.1|4182005_4182839_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	4.0e-21
WP_000412532.1|4182851_4183283_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001018038.1|4183282_4183486_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063101851.1|4183592_4184543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028120363.1|4184561_4185815_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.9e-193
4188192:4188205	attR	TATTCAGGCCAATG	NA	NA	NA	NA
>prophage 292
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4189156	4193718	5162306		Xanthomonas_phage(33.33%)	6	NA	NA
WP_000976070.1|4189156_4189615_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_001521609.1|4190983_4191652_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|4191868_4192105_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|4192125_4192293_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114542.1|4192390_4193200_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	5.9e-25
WP_001171866.1|4193238_4193718_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 293
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4201156	4202990	5162306		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000364807.1|4201156_4202185_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.6e-11
WP_001052917.1|4202216_4202990_+	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	33.7	7.6e-06
>prophage 294
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4206344	4215851	5162306		Synechococcus_phage(16.67%)	9	NA	NA
WP_000587750.1|4206344_4207277_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|4207490_4208687_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|4208696_4209722_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982100.1|4209960_4210995_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483830.1|4210981_4211941_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214156.1|4211944_4213228_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|4213237_4214782_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|4215026_4215458_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|4215599_4215851_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 295
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4238177	4240022	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_020233168.1|4238177_4240022_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 296
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4268482	4270024	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521578.1|4268482_4270024_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 297
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4275340	4276336	5162306		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182662.1|4275340_4276336_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	1.6e-11
>prophage 298
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4280959	4281172	5162306		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4280959_4281172_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 299
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4284826	4287160	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_001521567.1|4284826_4287160_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	7.0e-71
>prophage 300
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4297100	4299085	5162306		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196487.1|4297100_4298084_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000103574.1|4298080_4299085_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 301
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4345583	4347053	5162306		Bacillus_virus(50.0%)	2	NA	NA
WP_001296814.1|4345583_4346231_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
WP_001521540.1|4346282_4347053_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 302
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4360120	4362256	5162306		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065800.1|4360120_4360546_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
WP_001328189.1|4360558_4361848_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.3e-172
WP_000008965.1|4361902_4362256_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.3e-24
>prophage 303
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4365604	4367647	5162306		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|4365604_4367647_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 304
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4381054	4383790	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001586382.1|4381054_4383790_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 305
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4387400	4388060	5162306		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042045864.1|4387400_4388060_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.8	1.1e-24
>prophage 306
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4392001	4397604	5162306		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_048237751.1|4392001_4396189_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	7.5e-23
WP_001190062.1|4396391_4396793_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_001521512.1|4396797_4397604_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
>prophage 307
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4405497	4409630	5162306		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|4405497_4406163_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130615.1|4406383_4406629_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001521507.1|4406731_4408930_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.5	1.9e-118
WP_000964718.1|4409003_4409630_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 308
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4412636	4415455	5162306		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|4412636_4413305_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|4413297_4414356_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|4414600_4415455_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 309
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4421190	4422673	5162306		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|4421190_4421958_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_001521501.1|4421959_4422673_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	2.0e-13
>prophage 310
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4426215	4428026	5162306		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907822.1|4426215_4427286_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073586.1|4427282_4428026_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
>prophage 311
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4448035	4450483	5162306		Dickeya_phage(100.0%)	1	NA	NA
WP_000993442.1|4448035_4450483_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 312
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4459085	4460312	5162306		Ralstonia_phage(100.0%)	1	NA	NA
WP_001521480.1|4459085_4460312_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.2	8.9e-134
>prophage 313
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4464702	4467096	5162306		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001521478.1|4464702_4467096_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 314
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4473256	4474150	5162306		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|4473256_4474150_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 315
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4480715	4485227	5162306		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|4480715_4481435_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253707.1|4481431_4482784_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_000650973.1|4482815_4483112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|4483170_4483488_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001521469.1|4483604_4485227_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.2e-141
>prophage 316
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4502133	4502970	5162306		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4502133_4502970_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 317
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4521875	4525902	5162306		Acinetobacter_phage(50.0%)	3	NA	NA
WP_001521451.1|4521875_4522439_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	1.3e-60
WP_000963771.1|4522524_4523745_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_123057704.1|4523811_4525902_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
>prophage 318
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4529500	4531414	5162306		Tupanvirus(100.0%)	1	NA	NA
WP_020232893.1|4529500_4531414_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	1.5e-74
>prophage 319
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4536984	4542558	5162306		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209690.1|4536984_4537371_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
WP_000820714.1|4537370_4537730_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903377.1|4537737_4538025_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|4538150_4538525_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|4538621_4539092_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124703.1|4539188_4541303_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.1e-57
WP_000031783.1|4541373_4542558_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 320
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4562434	4563906	5162306	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004456.1|4562434_4563382_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|4563396_4563906_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 321
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4574413	4578567	5162306		Bacillus_virus(50.0%)	4	NA	NA
WP_000078344.1|4574413_4575172_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001308990.1|4575179_4576283_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|4576292_4577474_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|4577541_4578567_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 322
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4585071	4585956	5162306		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258942.1|4585071_4585956_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	1.6e-23
>prophage 323
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4596519	4597563	5162306		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4596519_4597563_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 324
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4614059	4616584	5162306	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|4614059_4615127_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|4615216_4616584_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 325
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4620550	4621048	5162306	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|4620550_4621048_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 326
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4624753	4629486	5162306		Burkholderia_virus(50.0%)	5	NA	NA
WP_001521408.1|4624753_4626244_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	3.7e-09
WP_000054239.1|4626291_4626981_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209000.1|4626977_4627853_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979887.1|4627849_4628314_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001521407.1|4628373_4629486_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 327
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4636235	4651029	5162306		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001521402.1|4636235_4637165_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_020233286.1|4637260_4639597_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	5.8e-41
WP_001300411.1|4639826_4640480_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_164475255.1|4640476_4641205_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620396.1|4641201_4641834_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|4642046_4642319_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|4642315_4643170_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|4643215_4643707_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|4643824_4644112_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|4644134_4645568_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|4645615_4646341_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|4646347_4646905_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|4646873_4647449_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030006.1|4647445_4648012_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_001295557.1|4648032_4649019_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922873.1|4649032_4650010_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|4650219_4651029_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 328
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4655097	4656575	5162306		Vibrio_phage(50.0%)	2	NA	NA
WP_000445407.1|4655097_4655376_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
WP_001047336.1|4655603_4656575_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 329
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4663203	4666076	5162306	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|4663203_4665138_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_001603854.1|4665227_4666076_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 330
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4670156	4676795	5162306		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|4670156_4671500_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|4672130_4672583_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|4672610_4674098_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|4674122_4676795_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 331
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4682271	4684161	5162306		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4682271_4684161_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 332
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4689863	4697658	5162306		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189309.1|4689863_4690166_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	6.6e-14
WP_001521391.1|4690215_4690659_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037605.1|4690638_4691157_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_000084526.1|4691284_4691920_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001521390.1|4691992_4693033_+	permease	NA	NA	NA	NA	NA
WP_000646047.1|4693145_4693721_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|4693730_4694321_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_001521388.1|4694340_4694736_-	YraN family protein	NA	NA	NA	NA	NA
WP_001521387.1|4694693_4696730_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809258.1|4696794_4697658_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 333
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4715279	4716425	5162306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001521378.1|4715279_4716425_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 334
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4724407	4726702	5162306		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861720.1|4724407_4726702_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.7e-157
>prophage 335
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4747486	4748452	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|4747486_4748452_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 336
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4760168	4776306	5162306	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_021523277.1|4760168_4763261_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
WP_000212458.1|4763444_4764428_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|4764646_4764979_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000633385.1|4765020_4766511_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.4e-32
WP_000094730.1|4766817_4768338_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000018005.1|4768444_4769068_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_029701451.1|4769344_4770109_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|4770362_4770869_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|4770947_4772789_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918837.1|4772983_4774729_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	2.4e-76
WP_001144069.1|4774839_4775055_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|4775292_4776306_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 337
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4782608	4783847	5162306	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708491.1|4782608_4783847_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 338
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4788984	4790418	5162306		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|4788984_4790418_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 339
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4799935	4810898	5162306		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|4799935_4800589_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|4800850_4801021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|4801078_4801852_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188362.1|4801967_4802783_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|4802820_4803981_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|4803986_4804658_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|4804805_4806287_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|4806491_4807121_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|4807121_4807544_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|4807568_4808396_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|4808395_4808977_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195292.1|4809005_4810898_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	7.6e-92
>prophage 340
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4814725	4815118	5162306		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|4814725_4815118_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 341
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4818428	4825475	5162306		Bacillus_virus(50.0%)	4	NA	NA
WP_001281841.1|4818428_4820687_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000965722.1|4820920_4821658_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059388.1|4821732_4823145_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|4823255_4825475_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
>prophage 342
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4833854	4834739	5162306		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|4833854_4834739_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 343
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4856949	4858122	5162306		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|4856949_4858122_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 344
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4872482	4928831	5162306	protease,transposase	Staphylococcus_phage(20.0%)	34	NA	NA
WP_033559595.1|4872482_4877051_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001547020.1|4877248_4878058_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001300497.1|4878123_4878534_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_000135079.1|4878551_4879511_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498829.1|4879540_4881601_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249312.1|4881600_4883094_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_089502605.1|4883093_4884317_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|4884333_4884789_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115118.1|4884792_4885356_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820140.1|4885352_4885724_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_021547736.1|4885720_4886326_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000631648.1|4886322_4887300_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097238.1|4887296_4888475_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942779.1|4888476_4889013_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_000124288.1|4890069_4890846_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000590260.1|4890842_4891511_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	9.2e-08
WP_001703434.1|4892737_4894378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104182439.1|4896855_4898083_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.0	8.8e-166
WP_089502673.1|4898097_4899531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720959.1|4899581_4899962_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_001703898.1|4899952_4901521_+	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	30.5	4.7e-47
WP_000685103.1|4902337_4903507_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	53.7	1.4e-112
WP_001389266.1|4903635_4904976_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000546115.1|4905135_4906347_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_001703901.1|4906381_4908409_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000030754.1|4908405_4909146_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001296395.1|4909155_4910832_-	polysialic acid transporter	NA	NA	NA	NA	NA
WP_000905920.1|4910855_4912004_-	capsule polysaccharide export inner-membrane protein KpsE	NA	NA	NA	NA	NA
WP_001296394.1|4912075_4913059_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_001189111.1|4917104_4918613_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032212789.1|4920979_4921834_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|4921882_4923034_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_162895303.1|4923584_4924798_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001034083.1|4924943_4928831_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
>prophage 345
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4939187	4940416	5162306	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_103103190.1|4939187_4940416_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
>prophage 346
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4945584	4945800	5162306		Escherichia_phage(100.0%)	1	NA	NA
WP_001327564.1|4945584_4945800_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	83.6	1.1e-26
>prophage 347
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4950084	4951350	5162306	integrase	Enterobacteria_phage(100.0%)	1	4949336:4949350	4958646:4958660
4949336:4949350	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|4950084_4951350_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_001218869.1|4950084_4951350_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
4958646:4958660	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
>prophage 348
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4974756	4975911	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|4974756_4975911_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 349
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4984064	4984973	5162306		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|4984064_4984973_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 350
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	4990025	4990703	5162306		Bacillus_virus(100.0%)	1	NA	NA
WP_000956881.1|4990025_4990703_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 351
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5008597	5009830	5162306		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|5008597_5009830_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 352
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5017965	5023131	5162306		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000195044.1|5017965_5020839_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.2	2.2e-263
WP_001605840.1|5021697_5023131_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.4	3.3e-31
>prophage 353
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5027064	5042456	5162306	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|5027064_5027961_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715223.1|5027985_5028696_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813232.1|5028701_5030435_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	2.4e-60
WP_099004485.1|5030525_5031623_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003061.1|5031633_5033151_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001192809.1|5033193_5033742_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|5033796_5033868_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|5033864_5033990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|5033991_5035440_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001469294.1|5035875_5037795_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838417.1|5037794_5038283_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012178.1|5038318_5039686_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.8e-160
WP_001469293.1|5039721_5041038_-	guanine deaminase	NA	NA	NA	NA	NA
WP_020232943.1|5041055_5042456_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 354
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5066737	5067490	5162306		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|5066737_5067490_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 355
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5099299	5101794	5162306		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|5099299_5100061_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_001521196.1|5100375_5101794_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	27.1	2.7e-25
>prophage 356
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5112138	5118910	5162306		Moraxella_phage(33.33%)	5	NA	NA
WP_001521193.1|5112138_5112852_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	2.0e-45
WP_000082188.1|5112920_5113610_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|5114294_5114825_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957911.1|5114837_5117084_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000816232.1|5118115_5118910_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 357
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5124388	5127277	5162306		Klosneuvirus(100.0%)	1	NA	NA
WP_021523235.1|5124388_5127277_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	9.0e-68
>prophage 358
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5130809	5145263	5162306	tRNA	Virus_Rctr197k(14.29%)	12	NA	NA
WP_000775943.1|5130809_5132636_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_000237938.1|5132697_5134029_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|5134260_5135514_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_001445845.1|5135771_5136596_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810566.1|5136627_5138208_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	1.6e-05
WP_001100456.1|5138207_5139392_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001065576.1|5139384_5139981_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.0	4.0e-23
WP_001328930.1|5140052_5141000_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	26.2	2.0e-16
WP_000678646.1|5141584_5142682_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|5142757_5143564_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_001521182.1|5143614_5144058_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001521181.1|5144057_5145263_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
>prophage 359
NZ_CP049198	Escherichia coli strain E686 chromosome, complete genome	5162306	5153485	5154985	5162306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001521178.1|5153485_5154985_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	1.5e-21
