The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	7523	89347	5166228	transposase,integrase,protease	Staphylococcus_phage(14.29%)	54	58261:58276	95359:95374
WP_033559595.1|7523_12092_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001547020.1|12289_13099_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001300497.1|13164_13575_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_000135079.1|13592_14552_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498829.1|14581_16642_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249312.1|16641_18135_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_089502605.1|18134_19358_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|19374_19830_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115118.1|19833_20397_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820140.1|20393_20765_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_021547736.1|20761_21367_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000631648.1|21363_22341_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097238.1|22337_23516_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942779.1|23517_24054_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_000124288.1|25110_25887_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000590260.1|25883_26552_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	9.2e-08
WP_001703436.1|26573_27593_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.1	1.8e-84
WP_001703434.1|27779_29420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025667.1|29717_31778_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_104182439.1|31898_33126_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.0	8.8e-166
WP_089502673.1|33140_34574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720959.1|34624_35005_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_001703898.1|34995_36564_+	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	30.5	4.7e-47
WP_021566528.1|36560_37286_+	hypothetical protein	NA	M1H491	Acanthocystis_turfacea_Chlorella_virus	31.1	9.6e-19
WP_000685103.1|37381_38551_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	53.7	1.4e-112
WP_001389266.1|38679_40020_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000546115.1|40179_41391_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_001703901.1|41425_43453_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000030754.1|43449_44190_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001296395.1|44199_45876_-	polysialic acid transporter	NA	NA	NA	NA	NA
WP_000905920.1|45899_47048_-	capsule polysaccharide export inner-membrane protein KpsE	NA	NA	NA	NA	NA
WP_001296394.1|47119_48103_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_001189111.1|52148_53657_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032212789.1|56023_56878_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|56926_58078_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
58261:58276	attL	GCGGCGGTAACCCATT	NA	NA	NA	NA
WP_001034083.1|58674_62562_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_011076574.1|62811_62955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973516.1|63505_65707_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|65788_67066_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|67062_68805_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|68804_69752_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|69752_71477_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|71612_72806_+	MFS transporter	NA	NA	NA	NA	NA
WP_103103190.1|72918_74147_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_001296373.1|74855_75284_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|75323_75884_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|75925_76186_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|78019_78133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006213.1|80000_80234_-	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_000147017.1|82519_83563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218869.1|83818_85084_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000234491.1|85462_86170_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_089502669.1|86568_88704_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000526135.1|88888_89347_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	6.7e-10
95359:95374	attR	GCGGCGGTAACCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	366890	374030	5166228		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|366890_367529_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|367525_368788_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|368784_369693_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|369888_370656_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|370706_371363_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|371468_374030_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 3
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	997085	1006528	5166228		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569374.1|997085_998012_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783145.1|998016_998748_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|998728_998836_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|998895_999627_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|999848_1001534_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|1001530_1002250_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1002296_1002767_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1002808_1003270_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021523183.1|1003394_1005395_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001520842.1|1005391_1006528_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 4
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	1017967	1081813	5166228	plate,lysis,portal,tail,capsid,terminase,head,holin,integrase,tRNA	Escherichia_phage(35.42%)	73	1045150:1045176	1077499:1077525
WP_001520834.1|1017967_1020001_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
WP_001005448.1|1020132_1021242_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001328276.1|1021504_1021786_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1022081_1022624_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677340.1|1022704_1023379_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001520833.1|1023394_1025875_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000702203.1|1025890_1026925_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1027006_1027345_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|1027563_1028388_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1028508_1028781_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195594.1|1029003_1029792_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822277.1|1029788_1030589_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_020233504.1|1030653_1031472_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000434044.1|1031523_1032270_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520829.1|1032243_1033209_-	kinase	NA	NA	NA	NA	NA
WP_001520828.1|1033205_1034210_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_000858471.1|1034206_1035484_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1035740_1036793_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001308759.1|1037022_1037877_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182900.1|1039172_1039625_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|1039655_1039940_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|1039943_1041299_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001520826.1|1041346_1042387_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1042486_1043266_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|1043347_1044247_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|1044661_1044979_+	hypothetical protein	NA	NA	NA	NA	NA
1045150:1045176	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1045255_1046269_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001306384.1|1046384_1046684_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1046798_1047074_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1047084_1047255_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217662.1|1047251_1047752_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_000557701.1|1047815_1048040_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_020233503.1|1048039_1048342_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	98.0	1.5e-45
WP_001113264.1|1048341_1048566_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|1048562_1048838_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_016235238.1|1048827_1051113_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_015979593.1|1051109_1051439_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	98.7	5.1e-36
WP_015979594.1|1051477_1052239_-	hypothetical protein	NA	P79670	Escherichia_phage	100.0	3.2e-142
WP_015979595.1|1052413_1054174_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038161.1|1054556_1055591_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156847.1|1055590_1057363_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085952.1|1057536_1058391_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|1058445_1059519_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_000203438.1|1059522_1060266_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
WP_089502592.1|1060365_1060875_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	98.8	4.3e-90
WP_000846399.1|1060874_1061078_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1061081_1061363_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1061362_1061860_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736608.1|1061874_1062300_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001512906.1|1062287_1062713_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_072174950.1|1062684_1062858_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917186.1|1062820_1063288_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001802.1|1063280_1063733_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_021523179.1|1063804_1064590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233499.1|1064673_1065309_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127164.1|1065305_1065653_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|1065657_1066566_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|1066558_1067089_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_021523178.1|1067099_1069121_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_021523177.1|1069122_1069650_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_032142943.1|1069871_1070465_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_020233495.1|1070794_1071985_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251412.1|1071997_1072516_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233494.1|1072572_1072848_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1072880_1073000_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|1072992_1075440_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|1075454_1075934_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_000882966.1|1075933_1077097_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|1077178_1077397_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001520824.1|1077669_1079031_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
1077499:1077525	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|1079178_1079511_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1079690_1080413_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|1080409_1081813_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 5
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	1129218	1136736	5166228		Escherichia_phage(42.86%)	7	NA	NA
WP_021523160.1|1129218_1130613_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
WP_021523159.1|1130770_1131766_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|1131997_1132891_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|1133262_1134348_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|1134347_1135247_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|1135304_1136183_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|1136187_1136736_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	1564649	1696801	5166228	protease,lysis,portal,tail,transposase,capsid,head,terminase,integrase,tRNA	Enterobacteria_phage(34.29%)	154	1582526:1582542	1702964:1702980
WP_001295400.1|1564649_1565924_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001302086.1|1565985_1566846_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765742.1|1566889_1567495_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100932.1|1567600_1569103_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|1569713_1570349_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|1570348_1571044_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920799.1|1571047_1571668_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_020233109.1|1571671_1572730_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_029701344.1|1572730_1574953_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|1574945_1575524_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|1575523_1576105_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001306099.1|1576181_1576622_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|1576707_1576923_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|1577195_1577321_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282537.1|1577563_1578604_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|1578658_1579660_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459387.1|1579763_1580936_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|1580945_1582538_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
1582526:1582542	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_021523112.1|1582712_1583741_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|1583852_1584620_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|1584848_1585439_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_001520590.1|1585829_1587641_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
WP_020233466.1|1587637_1589011_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001520589.1|1589049_1590315_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_020233465.1|1590360_1591869_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001520587.1|1591969_1593145_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|1593343_1594990_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001520586.1|1595132_1596536_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001520585.1|1596532_1597462_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001520578.1|1597538_1598840_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	4.2e-17
WP_001298660.1|1598843_1599563_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|1599691_1600027_+	GlpM family protein	NA	NA	NA	NA	NA
WP_001552898.1|1600023_1600746_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|1600782_1602165_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|1602350_1603295_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001520575.1|1603818_1605351_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|1605361_1606750_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085276.1|1607856_1609086_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953272.1|1609451_1609640_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_088888692.1|1609697_1610723_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032346737.1|1610715_1611177_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|1611173_1611404_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336138.1|1611393_1611615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|1611607_1611973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|1611965_1612199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088888693.1|1612191_1612425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|1612430_1612730_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761836.1|1612726_1614481_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|1614769_1615048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|1615044_1615455_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|1615467_1615740_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|1616027_1617185_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|1617224_1617797_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|1617798_1619010_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|1619006_1619345_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|1619341_1619638_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|1619637_1620078_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1620061_1620244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1620366_1620723_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|1620706_1622368_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|1622381_1622663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118259.1|1623361_1623526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|1623937_1624303_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|1624289_1624619_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260850.1|1624657_1625479_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1625578_1625662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|1625754_1626090_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1626486_1627740_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019534.1|1627846_1628740_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021523109.1|1628874_1630095_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1630219_1630915_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071593650.1|1630867_1632160_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_001520571.1|1632318_1632933_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
WP_020233477.1|1632975_1633830_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520568.1|1633831_1634449_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_089502603.1|1634459_1636883_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	8.3e-208
WP_001551145.1|1636943_1639370_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|1639568_1639874_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|1639981_1640692_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1640694_1641255_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|1641289_1641631_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|1641765_1642092_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_001295394.1|1642297_1643512_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|1643523_1644543_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|1644600_1644729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523105.1|1644730_1646011_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_000005552.1|1646045_1646297_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048363.1|1646369_1648841_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|1648934_1649126_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1649122_1649311_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|1649797_1650373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1650374_1650530_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000381212.1|1650698_1651106_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|1651186_1651414_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705355.1|1651397_1651919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|1651899_1652865_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151242.1|1652905_1653304_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_021523102.1|1653506_1654172_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001265627.1|1654380_1654995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000915483.1|1654997_1656020_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000589005.1|1656503_1657817_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|1658253_1658586_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|1658788_1659094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|1659118_1659358_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1659357_1659645_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1659716_1659872_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|1660088_1660340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|1660406_1660685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|1660686_1661736_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|1661749_1662502_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|1662779_1662869_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|1662923_1663136_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|1663436_1663652_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|1664405_1664621_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|1664625_1664937_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|1664933_1665467_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|1665463_1665961_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|1666323_1666536_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|1666546_1666735_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|1666737_1666803_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|1666882_1667038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|1667209_1667383_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|1667534_1667945_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|1668002_1668236_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453587.1|1668624_1669170_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|1669144_1671070_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1671066_1671273_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001356819.1|1671269_1672871_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_020233915.1|1672851_1674171_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001708751.1|1674180_1674513_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063277.1|1674567_1675593_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_020233914.1|1675634_1676033_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000752979.1|1676044_1676398_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|1676409_1676988_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|1676984_1677380_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001349920.1|1677387_1678128_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1678143_1678566_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1678547_1678982_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_032153656.1|1678974_1681536_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000847345.1|1681532_1681862_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001551186.1|1681861_1682560_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_032153655.1|1682565_1683309_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_049286672.1|1683245_1683848_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|1683908_1687388_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|1687455_1688055_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|1688119_1690519_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|1690515_1690797_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|1690806_1691511_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|1691521_1691815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|1692042_1692633_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1692949_1693183_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1693251_1693365_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001523332.1|1693968_1695252_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|1695340_1696801_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
1702964:1702980	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	1845380	1953430	5166228	lysis,tail,transposase,holin,terminase,integrase,tRNA	Escherichia_phage(49.12%)	103	1872118:1872134	1952563:1952579
WP_000526135.1|1845380_1845839_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	6.7e-10
WP_001261003.1|1846016_1846685_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586719.1|1846987_1847581_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|1847577_1848570_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001551086.1|1848693_1849674_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001523221.1|1849665_1850205_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1850267_1850492_-	YdcH family protein	NA	NA	NA	NA	NA
WP_048265110.1|1850631_1852287_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001523218.1|1852511_1853855_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1854071_1854995_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523216.1|1855032_1856673_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001309484.1|1857071_1857221_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731851.1|1857292_1857466_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001390056.1|1857710_1858241_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048645.1|1858429_1859431_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|1859472_1860912_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027943.1|1861108_1861909_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|1862024_1862402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|1862521_1862971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517100.1|1863581_1867484_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048963.1|1867684_1868290_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|1868343_1869660_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|1869649_1871407_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
1872118:1872134	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177498.1|1872318_1872924_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|1873094_1875401_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_021523074.1|1875464_1876325_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_059321765.1|1876532_1878941_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|1883014_1883338_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|1883345_1883531_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_020233705.1|1883527_1886167_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1886374_1887364_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|1887474_1887897_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1887893_1888160_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_021517097.1|1888433_1891958_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1892324_1893458_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|1893598_1894033_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_113328759.1|1894641_1895532_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|1895531_1896359_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|1896355_1897213_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|1897209_1898067_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000354607.1|1898539_1899334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405873.1|1899879_1900173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|1900215_1901256_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|1901265_1901547_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|1901546_1903922_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_021523093.1|1904652_1908132_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001351716.1|1908730_1909474_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_001152432.1|1909479_1910178_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|1910177_1910516_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_023153989.1|1910508_1913742_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_032139919.1|1913905_1914106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122452218.1|1914213_1914573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|1914723_1915686_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_000673077.1|1915712_1916105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|1916101_1916482_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|1916482_1916866_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|1916865_1917261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|1917264_1917441_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_020233804.1|1917483_1918623_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000770042.1|1918721_1919486_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_001363932.1|1919590_1920703_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000763701.1|1920686_1922093_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|1922095_1923397_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089448.1|1923377_1924472_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000126788.1|1924475_1924685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233805.1|1924662_1925595_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_001291105.1|1925587_1926379_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|1926516_1927974_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|1928170_1928356_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_023153991.1|1928572_1929049_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_000781775.1|1929052_1929394_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001328752.1|1929470_1929773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208722.1|1929741_1930311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640106.1|1930532_1931075_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000228032.1|1931071_1931362_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000940344.1|1931361_1931961_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_001445776.1|1932828_1933170_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001445775.1|1933252_1933378_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_000200358.1|1933900_1934674_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000137958.1|1934794_1935298_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_029702111.1|1935459_1935882_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000450716.1|1935897_1936659_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_020233967.1|1936681_1937428_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_001396581.1|1937434_1938223_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|1938300_1938723_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|1938719_1938974_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|1939053_1939473_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|1939715_1939895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|1939905_1940061_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|1940057_1940546_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|1940987_1941209_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1941208_1941379_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|1941453_1941729_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|1941830_1944431_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|1944423_1945233_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1945288_1945438_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1945475_1945664_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1945763_1945979_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|1945980_1947216_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001523172.1|1947267_1948203_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123748.1|1948331_1949705_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1950182_1951166_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_100190652.1|1952482_1953430_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
1952563:1952579	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 8
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	2260785	2326432	5166228	transposase	Stx2-converting_phage(16.67%)	59	NA	NA
WP_000526135.1|2260785_2261244_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	6.7e-10
WP_001309403.1|2261475_2264019_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_001300662.1|2264011_2265547_-	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001522842.1|2265940_2267098_+	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_001590029.1|2267105_2268587_-	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_000857405.1|2268528_2269062_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
WP_000489569.1|2269156_2269468_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000992818.1|2269588_2269921_-	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_000771435.1|2269979_2270435_-	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_001360656.1|2270475_2270931_-	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_000481500.1|2271674_2272325_+	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_000833288.1|2272329_2272719_+	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_001264096.1|2272743_2273160_+	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_001189321.1|2273186_2274020_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
WP_001308552.1|2274083_2274575_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001921.1|2274676_2275231_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283664.1|2275254_2275992_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001522839.1|2276046_2276985_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_000839253.1|2278381_2278579_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032180032.1|2278595_2279084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|2279080_2279464_-	toxin	NA	NA	NA	NA	NA
WP_001285602.1|2279544_2279925_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086768.1|2279935_2280619_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.1	9.0e-27
WP_000692298.1|2280637_2280859_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|2280921_2281398_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|2281413_2281899_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001761104.1|2281990_2282812_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000581506.1|2283221_2283677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531238.1|2283752_2286269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180029.1|2286389_2289236_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|2289607_2290480_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032180028.1|2290847_2291543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180027.1|2291545_2292052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399639.1|2292048_2292879_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	30.2	5.4e-26
WP_024224214.1|2294200_2294440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032180025.1|2294479_2296918_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.4	1.9e-74
WP_032180130.1|2296929_2298273_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000312833.1|2298285_2298942_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000634203.1|2298938_2300006_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000108736.1|2300024_2303120_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	3.0e-53
WP_001122107.1|2303119_2303836_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000262203.1|2305038_2306337_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677245.1|2306402_2307122_-	amino acid racemase	NA	NA	NA	NA	NA
WP_001333359.1|2307466_2308411_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_021513032.1|2308528_2308987_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	32.2	1.7e-08
WP_000976514.1|2309715_2310861_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2311184_2312447_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000483766.1|2312712_2314059_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179884.1|2314414_2314591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032262852.1|2314834_2315614_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_032180022.1|2317346_2318885_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_000612601.1|2318934_2319282_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_021566758.1|2319278_2319659_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2320113_2321127_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2321138_2322455_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2322482_2323403_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2323708_2324491_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2324492_2324591_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_104976704.1|2325203_2326432_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
>prophage 9
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	3229704	3291979	5166228	transposase,protease,plate,tRNA	Escherichia_phage(22.22%)	52	NA	NA
WP_001521866.1|3229704_3230118_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|3230121_3231972_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|3231935_3233018_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|3233042_3234323_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3234319_3234844_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|3234846_3236178_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001521863.1|3236182_3236944_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_099004468.1|3236952_3239904_+	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	28.5	7.8e-75
WP_000088867.1|3239900_3240644_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240537.1|3240648_3242061_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_139471981.1|3242169_3244128_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_162895303.1|3244179_3245392_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001087587.1|3246915_3248268_+	membrane protein	NA	NA	NA	NA	NA
WP_000002621.1|3248291_3248774_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908071.1|3248817_3249732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521857.1|3249741_3250209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|3250357_3251143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|3251680_3252412_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|3252476_3252944_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|3252940_3253663_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021523003.1|3253696_3254452_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3254523_3255882_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001521855.1|3255928_3256699_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3256776_3257577_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|3257817_3258732_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|3258728_3259532_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_001520530.1|3265292_3265865_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3266052_3267084_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3267076_3267730_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3267769_3268585_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202321.1|3268702_3269107_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094022.1|3269103_3269811_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_020233843.1|3269921_3271640_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021523001.1|3271692_3272517_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001520527.1|3272546_3273257_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635534.1|3273270_3273693_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|3273689_3274235_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3274400_3274601_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062315.1|3274587_3274848_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001520525.1|3274896_3276195_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3276259_3276649_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3276705_3278847_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055748.1|3278944_3279904_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001520523.1|3279916_3283399_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
WP_000569434.1|3283435_3284032_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_000139675.1|3284028_3285177_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3285176_3285965_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3285968_3286424_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|3286528_3287554_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3287557_3288043_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3288164_3290597_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001520521.1|3290626_3291979_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 10
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	3633901	3662226	5166228	transposase	Stx2-converting_phage(16.67%)	22	NA	NA
WP_000998019.1|3633901_3635287_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3635525_3636884_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3637634_3637892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3639641_3640163_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068913.1|3640159_3641113_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|3641199_3643524_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|3643568_3644471_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|3644467_3645466_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684855.1|3645462_3646419_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000175457.1|3646419_3647187_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3647743_3648001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|3648934_3649237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|3649272_3650091_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000976514.1|3650843_3651989_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|3652312_3653575_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000625671.1|3655616_3656030_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|3655964_3657132_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|3657445_3657703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|3657755_3657881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|3657923_3659042_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|3659053_3660271_-	MFS transporter	NA	NA	NA	NA	NA
WP_000547193.1|3660897_3662226_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP049197	Escherichia coli strain E597 chromosome, complete genome	5166228	4469962	4484087	5166228		Morganella_phage(22.22%)	17	NA	NA
WP_000230718.1|4469962_4470406_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|4470422_4470800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|4470803_4471286_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000560496.1|4472198_4472588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029844.1|4472606_4474712_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	7.2e-91
WP_001555748.1|4474711_4476133_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	3.7e-123
WP_000909176.1|4476132_4476810_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|4476803_4477265_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|4477281_4477443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244106.1|4478027_4480784_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001058744.1|4480796_4481399_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|4481391_4481613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|4481609_4481873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|4481869_4482064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958754.1|4482056_4483085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042977.1|4483078_4483261_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_089502642.1|4483253_4484087_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	4.0e-21
