The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	210217	276839	5268889	transposase,protease	Staphylococcus_phage(18.18%)	42	NA	NA
WP_033559595.1|210217_214786_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_164476935.1|214983_215793_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001300497.1|215858_216269_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_000135079.1|216286_217246_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498829.1|217275_219336_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249312.1|219335_220829_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_089502605.1|220828_222052_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|222068_222524_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115118.1|222527_223091_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820140.1|223087_223459_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_021547736.1|223455_224061_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000631648.1|224057_225035_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000097238.1|225031_226210_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942779.1|226211_226748_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_000124288.1|227804_228581_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000590260.1|228577_229246_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	9.2e-08
WP_001703436.1|229267_230287_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.1	1.8e-84
WP_001703434.1|230473_232114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104182439.1|234591_235819_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.0	8.8e-166
WP_089502673.1|235833_237267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720959.1|237317_237698_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_001703898.1|237688_239257_+	hypothetical protein	NA	B2ZYD9	Ralstonia_phage	30.5	4.7e-47
WP_000685103.1|240073_241243_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	53.7	1.4e-112
WP_001389266.1|241371_242712_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000546115.1|242871_244083_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_001703901.1|244117_246145_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000030754.1|246141_246882_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001296395.1|246891_248568_-	polysialic acid transporter	NA	NA	NA	NA	NA
WP_000905920.1|248591_249740_-	capsule polysaccharide export inner-membrane protein KpsE	NA	NA	NA	NA	NA
WP_001296394.1|249811_250795_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.2e-37
WP_001189111.1|254840_256349_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032212789.1|258715_259570_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|259618_260770_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|261366_265254_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_011076574.1|265503_265647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973516.1|266197_268399_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|268480_269758_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|269754_271497_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|271496_272444_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|272444_274169_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|274304_275498_+	MFS transporter	NA	NA	NA	NA	NA
WP_103103190.1|275610_276839_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
>prophage 2
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	572032	579172	5268889		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|572032_572671_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|572667_573930_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|573926_574835_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|575030_575798_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|575848_576505_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|576610_579172_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 3
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	1200790	1209100	5268889		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569374.1|1200790_1201717_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783145.1|1201721_1202453_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1202433_1202541_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1202600_1203332_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|1203553_1205239_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|1205235_1205955_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1206001_1206472_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1206513_1206975_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021523183.1|1207099_1209100_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
>prophage 4
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	1221672	1285517	5268889	plate,integrase,head,tRNA,capsid,lysis,tail,terminase,portal,holin	Escherichia_phage(35.42%)	72	1248854:1248880	1281203:1281229
WP_001520834.1|1221672_1223706_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
WP_001005448.1|1223837_1224947_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001328276.1|1225209_1225491_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1225786_1226329_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677340.1|1226409_1227084_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000702203.1|1229594_1230629_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1230710_1231049_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134572.1|1231267_1232092_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1232212_1232485_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195594.1|1232707_1233496_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822277.1|1233492_1234293_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_020233504.1|1234357_1235176_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000434044.1|1235227_1235974_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520829.1|1235947_1236913_-	kinase	NA	NA	NA	NA	NA
WP_001520828.1|1236909_1237914_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_000858471.1|1237910_1239188_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1239444_1240497_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001308759.1|1240726_1241581_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182900.1|1242876_1243329_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823282.1|1243359_1243644_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490663.1|1243647_1245003_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_001520826.1|1245050_1246091_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1246190_1246970_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807371.1|1247051_1247951_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_001303579.1|1248365_1248683_+	hypothetical protein	NA	NA	NA	NA	NA
1248854:1248880	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1248959_1249973_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001306384.1|1250088_1250388_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1250502_1250778_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1250788_1250959_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217662.1|1250955_1251456_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.3e-91
WP_000557701.1|1251519_1251744_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_020233503.1|1251743_1252046_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	98.0	1.5e-45
WP_001113264.1|1252045_1252270_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|1252266_1252542_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_016235238.1|1252531_1254817_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_015979593.1|1254813_1255143_+	DUF3850 domain-containing protein	NA	Q7Y4B7	Escherichia_virus	98.7	5.1e-36
WP_015979594.1|1255181_1255943_-	hypothetical protein	NA	P79670	Escherichia_phage	100.0	3.2e-142
WP_015979595.1|1256117_1257878_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038161.1|1258260_1259295_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156847.1|1259294_1261067_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001085952.1|1261240_1262095_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|1262149_1263223_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_000203438.1|1263226_1263970_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	1.6e-122
WP_089502592.1|1264069_1264579_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	98.8	4.3e-90
WP_000846399.1|1264578_1264782_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1264785_1265067_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1265066_1265564_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736608.1|1265578_1266004_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001512906.1|1265991_1266417_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_072174950.1|1266388_1266562_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_000917186.1|1266524_1266992_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001802.1|1266984_1267437_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_021523179.1|1267508_1268294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233499.1|1268377_1269013_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127164.1|1269009_1269357_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|1269361_1270270_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|1270262_1270793_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_021523178.1|1270803_1272825_+|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_021523177.1|1272826_1273354_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_032142943.1|1273575_1274169_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
WP_020233495.1|1274498_1275689_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251412.1|1275701_1276220_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_020233494.1|1276276_1276552_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1276584_1276704_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|1276696_1279144_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|1279158_1279638_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_000882966.1|1279637_1280801_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|1280882_1281101_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001520824.1|1281373_1282735_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.6e-216
1281203:1281229	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|1282882_1283215_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1283394_1284117_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|1284113_1285517_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 5
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	1332921	1340439	5268889		Escherichia_phage(42.86%)	7	NA	NA
WP_021523160.1|1332921_1334316_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
WP_021523159.1|1334473_1335469_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523158.1|1335700_1336594_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|1336965_1338051_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523157.1|1338050_1338950_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_021523156.1|1339007_1339886_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523155.1|1339890_1340439_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	1768343	1900494	5268889	integrase,head,protease,tRNA,capsid,lysis,transposase,tail,terminase,portal	Enterobacteria_phage(34.29%)	153	1786219:1786235	1906656:1906672
WP_001295400.1|1768343_1769618_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001302086.1|1769679_1770540_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765742.1|1770583_1771189_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100932.1|1771294_1772797_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|1773407_1774043_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|1774042_1774738_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920799.1|1774741_1775362_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_029701344.1|1776423_1778646_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|1778638_1779217_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|1779216_1779798_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001306099.1|1779874_1780315_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|1780400_1780616_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|1780888_1781014_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282537.1|1781256_1782297_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|1782351_1783353_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459387.1|1783456_1784629_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|1784638_1786231_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
1786219:1786235	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_021523112.1|1786405_1787434_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|1787545_1788313_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|1788541_1789132_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_001520590.1|1789522_1791334_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
WP_020233466.1|1791330_1792704_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001520589.1|1792742_1794008_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_020233465.1|1794053_1795562_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001520587.1|1795662_1796838_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066639.1|1797036_1798683_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001520586.1|1798825_1800229_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001520585.1|1800225_1801155_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001520578.1|1801231_1802533_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	4.2e-17
WP_001298660.1|1802536_1803256_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524861.1|1803384_1803720_+	GlpM family protein	NA	NA	NA	NA	NA
WP_001552898.1|1803716_1804439_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|1804475_1805858_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|1806043_1806988_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001520575.1|1807511_1809044_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|1809054_1810443_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085276.1|1811549_1812779_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953272.1|1813144_1813333_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_088888692.1|1813390_1814416_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032346737.1|1814408_1814870_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|1814866_1815097_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336138.1|1815086_1815308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|1815300_1815666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|1815658_1815892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088888693.1|1815884_1816118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|1816123_1816423_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164476939.1|1816419_1818174_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	1.9e-92
WP_000557476.1|1818462_1818741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|1818737_1819148_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|1819160_1819433_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|1819720_1820878_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|1820917_1821490_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|1821491_1822703_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|1822699_1823038_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|1823034_1823331_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|1823330_1823771_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1823754_1823937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|1824059_1824416_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|1824399_1826061_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|1826074_1826356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118259.1|1827054_1827219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|1827630_1827996_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|1827982_1828312_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260850.1|1828350_1829172_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1829271_1829355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|1829447_1829783_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1830179_1831433_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019534.1|1831539_1832433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021523109.1|1832567_1833788_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1833912_1834608_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071593650.1|1834560_1835853_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_001520571.1|1836011_1836626_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	4.3e-28
WP_020233477.1|1836668_1837523_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_001520568.1|1837524_1838142_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.1	2.5e-76
WP_089502603.1|1838152_1840576_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	8.3e-208
WP_001551145.1|1840636_1843063_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001295396.1|1843261_1843567_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|1843674_1844385_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1844387_1844948_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|1844982_1845324_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|1845458_1845785_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_001295394.1|1845990_1847205_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|1847216_1848236_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|1848293_1848422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021523105.1|1848423_1849704_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	3.9e-156
WP_000005552.1|1849738_1849990_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048363.1|1850062_1852534_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_001083276.1|1852627_1852819_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1852815_1853004_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|1853490_1854066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1854067_1854223_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000381212.1|1854391_1854799_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|1854879_1855107_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705355.1|1855090_1855612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|1855592_1856558_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151242.1|1856598_1856997_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_021523102.1|1857199_1857865_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001265627.1|1858073_1858688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000915483.1|1858690_1859713_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000589005.1|1860196_1861510_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|1861946_1862279_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|1862481_1862787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|1862811_1863051_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1863050_1863338_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1863409_1863565_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|1863781_1864033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|1864099_1864378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|1864379_1865429_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|1865442_1866195_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|1866472_1866562_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|1866616_1866829_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|1867129_1867345_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|1868098_1868314_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|1868318_1868630_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|1868626_1869160_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|1869156_1869654_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|1870016_1870229_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|1870239_1870428_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|1870430_1870496_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|1870575_1870731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|1870902_1871076_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|1871227_1871638_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|1871695_1871929_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453587.1|1872317_1872863_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|1872837_1874763_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1874759_1874966_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001356819.1|1874962_1876564_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_020233915.1|1876544_1877864_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001708751.1|1877873_1878206_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063277.1|1878260_1879286_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_020233914.1|1879327_1879726_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000752979.1|1879737_1880091_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|1880102_1880681_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683128.1|1880677_1881073_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001349920.1|1881080_1881821_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1881836_1882259_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1882240_1882675_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_032153656.1|1882667_1885229_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000847345.1|1885225_1885555_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001551186.1|1885554_1886253_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_032153655.1|1886258_1887002_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_049286672.1|1886938_1887541_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|1887601_1891081_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|1891148_1891748_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|1891812_1894212_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|1894208_1894490_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|1894499_1895204_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000355609.1|1895214_1895508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|1895735_1896326_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1896642_1896876_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1896944_1897058_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001523332.1|1897661_1898945_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|1899033_1900494_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
1906656:1906672	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	2049072	2157119	5268889	integrase,tRNA,transposase,tail,terminase,holin	Escherichia_phage(50.91%)	102	2075808:2075824	2156252:2156268
WP_000526135.1|2049072_2049531_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001261003.1|2049708_2050377_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586719.1|2050679_2051273_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2051269_2052262_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001551086.1|2052385_2053366_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001523221.1|2053357_2053897_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2053959_2054184_-	YdcH family protein	NA	NA	NA	NA	NA
WP_048265110.1|2054323_2055979_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001523218.1|2056203_2057547_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2057763_2058687_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523216.1|2058724_2060365_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001309484.1|2060763_2060913_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001390056.1|2061401_2061932_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048645.1|2062120_2063122_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|2063163_2064603_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027943.1|2064799_2065600_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|2065715_2066093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2066212_2066662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|2066648_2066987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517100.1|2067271_2071174_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048963.1|2071374_2071980_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|2072033_2073350_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|2073339_2075097_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
2075808:2075824	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177498.1|2076008_2076614_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|2076784_2079091_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_059321765.1|2080221_2082630_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|2086703_2087027_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2087034_2087220_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_020233705.1|2087216_2089856_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2090063_2091053_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|2091163_2091586_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2091582_2091849_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_021517097.1|2092122_2095647_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2096013_2097147_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|2097287_2097722_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_113328759.1|2098330_2099221_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|2099220_2100048_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2100044_2100902_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|2100898_2101756_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000354607.1|2102228_2103023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405873.1|2103568_2103862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|2103904_2104945_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|2104954_2105236_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|2105235_2107611_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001542091.1|2107675_2108275_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|2108342_2111822_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001351716.1|2112420_2113164_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	1.0e-145
WP_001152432.1|2113169_2113868_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|2113867_2114206_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_023153989.1|2114198_2117432_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_032139919.1|2117595_2117796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122452218.1|2117903_2118263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|2118413_2119376_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_000673077.1|2119402_2119795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2119791_2120172_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2120172_2120556_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2120555_2120951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|2120954_2121131_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_020233804.1|2121173_2122313_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000770042.1|2122411_2123176_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_001363932.1|2123280_2124393_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000763701.1|2124376_2125783_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_000625348.1|2125785_2127087_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000089448.1|2127067_2128162_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000126788.1|2128165_2128375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233805.1|2128352_2129285_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_001291105.1|2129277_2130069_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2130206_2131664_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_023153991.1|2132261_2132738_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_000781775.1|2132741_2133083_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001328752.1|2133159_2133462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208722.1|2133430_2134000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640106.1|2134221_2134764_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_000228032.1|2134760_2135051_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000940344.1|2135050_2135650_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_001445776.1|2136517_2136859_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001445775.1|2136941_2137067_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_000200358.1|2137589_2138363_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_000137958.1|2138483_2138987_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_029702111.1|2139148_2139571_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000450716.1|2139586_2140348_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_020233967.1|2140370_2141117_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_001396581.1|2141123_2141912_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2141989_2142412_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2142408_2142663_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2142742_2143162_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2143404_2143584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2143594_2143750_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2143746_2144235_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2144676_2144898_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2144897_2145068_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2145142_2145418_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2145519_2148120_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2148112_2148922_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2148977_2149127_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2149164_2149353_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2149452_2149668_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2149669_2150905_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001523172.1|2150956_2151892_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123748.1|2152020_2153394_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2153871_2154855_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_100190652.1|2156171_2157119_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
2156252:2156268	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 8
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	2244865	2314588	5268889	integrase,head,protease,capsid,transposase,tail,terminase,portal,holin	Enterobacteria_phage(28.57%)	77	2262809:2262836	2314725:2314752
WP_000526135.1|2244865_2245324_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001523120.1|2245503_2246553_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559277.1|2246772_2247531_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_089502652.1|2247527_2248118_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_020233117.1|2248169_2248478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020233118.1|2248488_2249490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476940.1|2249659_2250535_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_021523068.1|2250747_2252631_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2252658_2253279_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285692.1|2253275_2254157_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2254294_2254339_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194628.1|2254430_2255993_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2255992_2257588_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001523118.1|2257591_2258950_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.7e-37
WP_000209513.1|2258961_2260155_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443071.1|2260154_2260961_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2261341_2261521_+	general stress protein	NA	NA	NA	NA	NA
WP_021523067.1|2261606_2262107_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001523116.1|2262152_2262659_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2262809:2262836	attL	GTGGTATCGATATCCATGTACCAGACTG	NA	NA	NA	NA
WP_000251936.1|2263146_2263317_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000937498.1|2263431_2263701_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2263757_2264426_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072666654.1|2264480_2265065_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.0e-103
WP_113488219.1|2265064_2268091_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.3	6.3e-56
WP_001228318.1|2268242_2268842_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_164476941.1|2268909_2272383_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_122993581.1|2272726_2273359_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.3	3.5e-102
WP_000194704.1|2273304_2274048_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	8.6e-148
WP_001375867.1|2274058_2274757_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_000807924.1|2274756_2275098_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_021520064.1|2275090_2278333_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001513217.1|2278380_2278590_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2278685_2279060_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2279074_2279791_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_094354877.1|2279855_2280200_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	5.5e-57
WP_000573362.1|2280196_2280643_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_094354878.1|2280639_2280990_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000125990.1|2280999_2281326_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_096944700.1|2281322_2283908_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_001063099.1|2283853_2284075_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2284119_2286057_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001339613.1|2286120_2287782_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000958372.1|2287778_2288342_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000829198.1|2288631_2288997_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	6.2e-59
WP_000095744.1|2289038_2289239_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828072.1|2289370_2289697_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_072006851.1|2290089_2290275_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	6.0e-18
WP_032140280.1|2290496_2290583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|2291137_2291671_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_000369850.1|2291776_2292049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2292014_2292359_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2292363_2292579_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874529.1|2292729_2294586_-	DUF1737 domain-containing protein	NA	Q08JA2	Stx2-converting_phage	88.4	0.0e+00
WP_000935515.1|2295860_2296910_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_000917749.1|2297060_2297258_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000762910.1|2297482_2298304_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	2.5e-79
WP_000904100.1|2298300_2298675_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	63.9	4.2e-34
WP_061091269.1|2298687_2299737_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_033868694.1|2299738_2300017_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.8e-11
WP_024190764.1|2300132_2301230_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.4	7.6e-52
WP_021548141.1|2301222_2303334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033871096.1|2303910_2304321_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.7	5.7e-61
WP_000450999.1|2304336_2305107_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	1.0e-79
WP_000788950.1|2305128_2305875_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000693845.1|2306865_2307291_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048458.1|2307274_2307550_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000824162.1|2307657_2308158_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_000100896.1|2308175_2308367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014966210.1|2308366_2308657_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021538048.1|2308926_2309079_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_001435739.1|2309090_2309411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351093.1|2309388_2309826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450218.1|2310226_2310415_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093903.1|2310411_2310603_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097509247.1|2310695_2313167_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	3.8e-59
WP_000113189.1|2313231_2313480_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2313457_2314588_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2314725:2314752	attR	GTGGTATCGATATCCATGTACCAGACTG	NA	NA	NA	NA
>prophage 9
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	2430905	2489346	5268889	integrase,head,tRNA,capsid,lysis,tail,terminase,portal,holin	Escherichia_phage(38.18%)	75	2439098:2439112	2489448:2489462
WP_000004751.1|2430905_2432012_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2432047_2432689_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2432692_2434063_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|2434232_2434904_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2434903_2436364_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_164476942.1|2436439_2437561_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_001522887.1|2437609_2438836_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2439085_2440222_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2439098:2439112	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2440205_2441069_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000937481.1|2441300_2441567_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000240999.1|2441623_2442292_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|2442346_2442931_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_089502639.1|2442930_2445957_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_001233148.1|2446108_2446708_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000514726.1|2446775_2450468_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_032300536.1|2450811_2451444_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000194723.1|2451389_2452133_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001328631.1|2452143_2452842_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000847298.1|2452841_2453171_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082417.1|2453167_2455729_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000533402.1|2455709_2456123_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479111.1|2456149_2456581_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000235111.1|2456594_2457347_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000683079.1|2457354_2457750_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975005.1|2457746_2458322_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_001204533.1|2458337_2458691_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000201530.1|2458683_2459058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522603.1|2459108_2460137_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000256814.1|2460194_2460542_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_001253888.1|2460578_2462084_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_089502660.1|2462073_2463666_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_000258993.1|2463662_2463869_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001309424.1|2463852_2465781_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000235436.1|2465752_2466262_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001322427.1|2466744_2467098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2467220_2467547_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032142285.1|2467857_2468325_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|2468327_2468459_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|2468473_2468656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|2468812_2469346_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|2469382_2470273_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|2470277_2470493_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001309421.1|2470642_2470804_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_001309419.1|2470800_2471004_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_000871291.1|2471249_2471585_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_157835956.1|2471865_2471979_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001309418.1|2471954_2472152_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_001064909.1|2472364_2473054_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_000140038.1|2473046_2473415_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001265256.1|2473415_2474474_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_001309417.1|2474475_2474754_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001309416.1|2474820_2475072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2475288_2475444_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001336454.1|2475702_2475921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208092.1|2476002_2476989_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_001229301.1|2476985_2477351_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000137948.1|2477352_2477760_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_000403791.1|2477855_2478212_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_001209475.1|2478189_2478651_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_001266130.1|2478647_2478944_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001141099.1|2478940_2479333_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_089502659.1|2479348_2480119_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	4.3e-86
WP_001309414.1|2480152_2480695_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000020541.1|2480606_2481647_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_000705383.1|2481618_2482170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912294.1|2482153_2482381_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2482457_2482865_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000379564.1|2483071_2483224_+	DUF1391 family protein	NA	NA	NA	NA	NA
WP_089502662.1|2483235_2483610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935596.1|2484140_2484995_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000450218.1|2485005_2485194_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_001093951.1|2485190_2485394_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001542183.1|2485471_2487928_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_000003742.1|2487989_2488259_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2488227_2489346_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2489448:2489462	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 10
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	2561252	2626899	5268889	transposase	Stx2-converting_phage(18.75%)	59	NA	NA
WP_000526135.1|2561252_2561711_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001309403.1|2561942_2564486_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_001300662.1|2564478_2566014_-	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001522842.1|2566407_2567565_+	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_001590029.1|2567572_2569054_-	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_000857405.1|2568995_2569529_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
WP_000489569.1|2569623_2569935_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000992818.1|2570055_2570388_-	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_000771435.1|2570446_2570902_-	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_001360656.1|2570942_2571398_-	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_000481500.1|2572141_2572792_+	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_000833288.1|2572796_2573186_+	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_001264096.1|2573210_2573627_+	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_001189321.1|2573653_2574487_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
WP_001308552.1|2574550_2575042_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001921.1|2575143_2575698_-	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_000283664.1|2575721_2576459_-	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001522839.1|2576513_2577452_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_000839253.1|2578848_2579046_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032180032.1|2579062_2579551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854686.1|2579547_2579931_-	toxin	NA	NA	NA	NA	NA
WP_001285602.1|2580011_2580392_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086768.1|2580402_2581086_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.1	9.0e-27
WP_000692298.1|2581104_2581326_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186726.1|2581388_2581865_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214307.1|2581880_2582366_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001761104.1|2582457_2583279_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	4.0e-45
WP_000581506.1|2583688_2584144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531238.1|2584219_2586736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180029.1|2586856_2589703_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|2590074_2590947_-	GTPase family protein	NA	NA	NA	NA	NA
WP_032180028.1|2591314_2592010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032180027.1|2592012_2592519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399639.1|2592515_2593346_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	30.2	5.4e-26
WP_024224214.1|2594667_2594907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032180025.1|2594946_2597385_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.4	1.9e-74
WP_032180130.1|2597396_2598740_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000312833.1|2598752_2599409_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000634203.1|2599405_2600473_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000108736.1|2600491_2603587_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	3.0e-53
WP_001122107.1|2603586_2604303_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000262203.1|2605505_2606804_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677245.1|2606869_2607589_-	amino acid racemase	NA	NA	NA	NA	NA
WP_001333359.1|2607933_2608878_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_021513032.1|2608995_2609454_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000976514.1|2610182_2611328_-	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_000608644.1|2611651_2612914_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000483766.1|2613179_2614526_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179884.1|2614881_2615058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032262852.1|2615301_2616081_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_032180022.1|2617813_2619352_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_000612601.1|2619401_2619749_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_021566758.1|2619745_2620126_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000107485.1|2620580_2621594_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|2621605_2622922_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|2622949_2623870_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|2624175_2624958_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|2624959_2625058_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_104976704.1|2625670_2626899_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
>prophage 11
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	3530164	3592450	5268889	tRNA,plate,transposase,protease	Escherichia_phage(22.22%)	52	NA	NA
WP_001521866.1|3530164_3530578_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|3530581_3532432_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|3532395_3533478_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|3533502_3534783_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3534779_3535304_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|3535306_3536638_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001521863.1|3536642_3537404_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_099004468.1|3537412_3540364_+	AAA domain-containing protein	NA	A0A1C3S747	Escherichia_phage	28.5	7.8e-75
WP_000088867.1|3540360_3541104_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240537.1|3541108_3542521_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_139471981.1|3542629_3544588_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_162895303.1|3544639_3545852_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	5.5e-168
WP_001087587.1|3547387_3548740_+	membrane protein	NA	NA	NA	NA	NA
WP_000002621.1|3548763_3549246_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908071.1|3549289_3550204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521857.1|3550213_3550681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086163.1|3550829_3551615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308374.1|3552152_3552884_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|3552948_3553416_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|3553412_3554135_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_021523003.1|3554168_3554924_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3554995_3556354_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001521855.1|3556400_3557171_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3557248_3558049_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|3558289_3559204_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|3559200_3560004_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_001520530.1|3565763_3566336_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3566523_3567555_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3567547_3568201_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3568240_3569056_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202321.1|3569173_3569578_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094022.1|3569574_3570282_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_020233843.1|3570392_3572111_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_021523001.1|3572163_3572988_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001520527.1|3573017_3573728_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635534.1|3573741_3574164_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185283.1|3574160_3574706_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3574871_3575072_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062315.1|3575058_3575319_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001520525.1|3575367_3576666_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3576730_3577120_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3577176_3579318_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055748.1|3579415_3580375_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001520523.1|3580387_3583870_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
WP_000569434.1|3583906_3584503_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_000139675.1|3584499_3585648_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3585647_3586436_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3586439_3586895_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|3586999_3588025_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3588028_3588514_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3588635_3591068_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001520521.1|3591097_3592450_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 12
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	3941936	3989444	5268889	tRNA,transposase	Stx2-converting_phage(10.0%)	36	NA	NA
WP_000998019.1|3941936_3943322_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3943560_3944919_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3945669_3945927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3947676_3948198_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068913.1|3948194_3949148_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|3949234_3951559_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|3951603_3952506_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|3952502_3953501_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684855.1|3953497_3954454_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000175457.1|3954454_3955222_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|3955778_3956036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|3956969_3957272_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|3957307_3958126_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_001293436.1|3958279_3960277_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|3960339_3960753_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|3960687_3961855_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|3962168_3962426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|3962478_3962604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|3962646_3963765_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179691.1|3963776_3964994_-	MFS transporter	NA	NA	NA	NA	NA
WP_000547193.1|3965620_3966949_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001318460.1|3971506_3972526_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000896738.1|3972529_3973093_-	gluconokinase	NA	NA	NA	NA	NA
WP_001197411.1|3973309_3974341_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000998695.1|3974364_3975129_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001128347.1|3975191_3976511_+	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_001309159.1|3976577_3977576_+	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_021523335.1|3977653_3979156_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
WP_001295681.1|3979316_3980399_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|3980398_3981499_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|3981765_3983277_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|3983630_3984074_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416387.1|3984073_3986929_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_016245205.1|3986984_3988181_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059412.1|3988373_3988877_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000526135.1|3988985_3989444_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP049196	Escherichia coli strain E118 chromosome, complete genome	5268889	4773243	4787368	5268889		Morganella_phage(22.22%)	17	NA	NA
WP_000230718.1|4773243_4773687_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|4773703_4774081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|4774084_4774567_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000560496.1|4775479_4775869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029844.1|4775887_4777993_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	7.2e-91
WP_001555748.1|4777992_4779414_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	53.0	3.7e-123
WP_000909176.1|4779413_4780091_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|4780084_4780546_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001018524.1|4780562_4780724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244106.1|4781308_4784065_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_001058744.1|4784077_4784680_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_000181940.1|4784672_4784894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|4784890_4785154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|4785150_4785345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958754.1|4785337_4786366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042977.1|4786359_4786542_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_089502642.1|4786534_4787368_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	4.0e-21
