The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	808241	868844	5409430	plate,transposase	Stx2-converting_phage(27.27%)	52	NA	NA
WP_164475446.1|808241_809780_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	4.5e-300
WP_000612591.1|809829_810177_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|810173_810554_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_072146476.1|811291_811603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057698554.1|811719_812274_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_057698553.1|812356_812941_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_164475331.1|813079_815629_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_057697964.1|815758_816490_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_164475332.1|816525_817113_+	nuclease PIN	NA	NA	NA	NA	NA
WP_057698003.1|817130_817697_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_057698004.1|817844_818411_+	fimbrial protein	NA	NA	NA	NA	NA
WP_061361400.1|818578_819538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160462491.1|819576_820506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164475447.1|820538_821483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061322826.1|821806_822022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521361.1|822188_823019_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_164475334.1|823028_824126_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_164475335.1|824207_825149_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_040089126.1|825160_826108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040100188.1|826305_826557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057697995.1|826649_827795_+	DUF4056 domain-containing protein	NA	NA	NA	NA	NA
WP_160521686.1|827829_828708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164475336.1|828728_829568_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040089139.1|830221_831451_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	2.0e-61
WP_040089121.1|831435_832074_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	5.1e-56
WP_072301575.1|832506_833922_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_164475448.1|834657_835677_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_163516589.1|837378_837522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021580263.1|838140_838752_-	YfdX family protein	NA	NA	NA	NA	NA
WP_072146492.1|839280_839919_+	porin	NA	Q1MVN1	Enterobacteria_phage	64.7	3.0e-72
WP_057698615.1|840552_841065_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	4.1e-08
WP_157839846.1|841184_841328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139964320.1|841939_842563_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000124171.1|842649_842883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287796.1|842935_843127_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001559830.1|843632_844130_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_164475449.1|844151_845696_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_057698599.1|845711_847049_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_057698600.1|847045_847699_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_061330170.1|847701_849432_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001380974.1|849437_849929_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_164475450.1|850097_852785_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	4.0e-94
WP_000376469.1|852771_853413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057698465.1|853715_856238_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.7	3.0e-03
WP_164476227.1|856312_858145_+	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	28.6	2.1e-09
WP_032175926.1|858128_858890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047628076.1|859493_859760_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	39.0	1.5e-06
WP_096973992.1|859817_860912_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_057698467.1|860904_864294_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_057698468.1|864293_865892_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032252203.1|866025_867789_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_164475451.1|867743_868844_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	1603261	1649033	5409430	head,portal,integrase,capsid,plate,tRNA,holin,tail,terminase	Enterobacteria_phage(84.09%)	56	1609194:1609213	1646009:1646028
WP_097470086.1|1603261_1605268_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1605426_1606647_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127789.1|1606921_1608100_+	arabinose transporter	NA	NA	NA	NA	NA
WP_069912946.1|1608096_1609092_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1609194:1609213	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_000215759.1|1609321_1610113_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	1.1e-65
WP_001353016.1|1610057_1610255_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000078916.1|1610490_1610631_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488105.1|1610821_1611082_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_164475578.1|1611124_1612234_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.2e-195
WP_000005413.1|1612391_1613576_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_000290450.1|1613575_1614088_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1614142_1614508_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|1614516_1614672_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853388.1|1614658_1617466_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000979954.1|1617478_1617967_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905059.1|1617993_1618593_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_000972164.1|1619620_1620154_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	9.3e-96
WP_064506815.1|1620182_1620710_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	2.0e-90
WP_064506814.1|1620711_1622874_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	75.5	4.2e-288
WP_001443704.1|1622876_1623407_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	9.6e-93
WP_001111925.1|1623399_1624296_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_000213447.1|1624299_1624650_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271922.1|1624646_1625228_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	2.5e-102
WP_000356320.1|1625224_1625860_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	1.5e-113
WP_000920594.1|1625852_1626320_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780572.1|1626457_1626865_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|1626861_1627254_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1627250_1627574_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1627576_1627777_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063093.1|1627776_1628271_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_000632345.1|1628372_1629173_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_001055107.1|1629218_1630271_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_001262639.1|1630294_1631131_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	2.1e-147
WP_064506808.1|1631285_1633037_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|1633036_1634083_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001068330.1|1634731_1635229_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_071529707.1|1635268_1636111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211280.1|1636194_1636509_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686549.1|1636513_1637473_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	3.2e-179
WP_000599382.1|1640379_1640745_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_157923231.1|1640741_1641359_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000108348.1|1641370_1641670_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	82.7	1.6e-36
WP_000153709.1|1641666_1641933_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.6e-30
WP_000985157.1|1641929_1642133_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991906.1|1642156_1642573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|1642665_1642779_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|1642775_1643018_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_001040240.1|1643029_1643308_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	1.8e-34
WP_064506806.1|1643318_1643669_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	89.7	3.4e-54
WP_000183754.1|1643788_1643995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004248.1|1644001_1644289_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000581441.1|1644404_1644725_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	45.0	1.3e-12
WP_000023401.1|1644821_1645826_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_164475579.1|1645984_1647142_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.2e-24
1646009:1646028	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001289167.1|1647207_1648221_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1648220_1649033_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	1856028	1865473	5409430		Enterobacteria_phage(85.71%)	10	NA	NA
WP_164475617.1|1856028_1856955_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1856959_1857691_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1857671_1857779_-	protein YohO	NA	NA	NA	NA	NA
WP_001240399.1|1857838_1858570_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1858791_1860477_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1860473_1861193_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1861239_1861710_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_047669483.1|1861750_1862212_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	1.6e-75
WP_164475618.1|1862336_1864340_-	dipeptidase	NA	Q9EYF6	Enterobacteria_phage	96.9	0.0e+00
WP_069912987.1|1864336_1865473_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	2077586	2111205	5409430	tail,transposase	Enterobacteria_phage(69.23%)	35	NA	NA
WP_164475647.1|2077586_2078795_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	7.8e-207
WP_114213122.1|2078846_2079506_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	2.1e-81
WP_000789493.1|2079612_2079846_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|2079842_2081048_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|2081234_2081648_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245719.1|2081681_2083169_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015023.1|2083246_2083612_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270663.1|2083611_2084022_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_164475648.1|2084046_2085453_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_027662894.1|2085718_2087536_+	flagellin FliC	NA	NA	NA	NA	NA
WP_001087467.1|2087855_2088575_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001362553.1|2088620_2089172_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001295643.1|2089259_2090060_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_164475649.1|2090164_2091151_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2091165_2091834_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272991.1|2091830_2092583_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_164475650.1|2092812_2093535_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2093602_2093827_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590344.1|2093813_2093990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|2094285_2094942_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_164475651.1|2094938_2096771_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2096827_2097376_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_071589622.1|2098370_2098652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2098843_2098984_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488113.1|2099174_2099435_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_112025169.1|2101272_2102382_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	1.8e-194
WP_000005413.1|2102539_2103724_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_000290450.1|2103723_2104236_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|2104290_2104656_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|2104664_2104820_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_164475652.1|2104806_2107614_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.7	0.0e+00
WP_000979954.1|2107626_2108115_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_164475653.1|2108211_2109390_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_164475654.1|2109484_2110084_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.1	2.3e-98
WP_164476240.1|2110083_2111205_-|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	56.6	6.8e-40
>prophage 5
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	2438986	2501309	5409430	portal,lysis,integrase,protease,tail,terminase	Enterobacteria_phage(41.3%)	69	2438465:2438480	2472085:2472100
2438465:2438480	attL	ATCGGTATTTTATTTA	NA	NA	NA	NA
WP_112826586.1|2438986_2439808_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2439907_2439991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2440083_2440419_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2440815_2442069_-	MFS transporter	NA	NA	NA	NA	NA
WP_094281674.1|2442175_2443069_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2443203_2444424_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2444548_2445244_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_164475703.1|2445196_2446489_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148698.1|2446646_2447261_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
WP_164475704.1|2447303_2448158_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2448159_2448777_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_164476243.1|2448787_2451211_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	2.8e-208
WP_164475705.1|2451271_2453698_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.0e-213
WP_001356084.1|2453896_2454202_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072129879.1|2454309_2455020_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2455022_2455583_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2455617_2455959_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2456093_2456420_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_094281668.1|2456625_2457840_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	4.8e-47
WP_094281666.1|2457851_2458871_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	3.9e-18
WP_001594117.1|2458928_2459039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134743645.1|2459058_2460339_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	5.1e-156
WP_000005552.1|2460373_2460625_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_164475706.1|2460697_2463169_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	7.7e-60
WP_001083273.1|2463262_2463454_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2463450_2463639_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_128553471.1|2464125_2464701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2464702_2464858_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000381212.1|2465026_2465434_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_001594109.1|2465514_2465742_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2465725_2466247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054495.1|2466227_2467193_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151189.1|2467233_2467635_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000782641.1|2467831_2468470_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_134743731.1|2468493_2469138_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000887491.1|2469630_2469843_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_164475707.1|2470059_2470311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2470377_2470656_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_164475708.1|2470657_2471707_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.7	1.6e-115
WP_016159280.1|2471724_2472069_+	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
WP_164475709.1|2472061_2473288_-	hypothetical protein	NA	NA	NA	NA	NA
2472085:2472100	attR	TAAATAAAATACCGAT	NA	NA	NA	NA
WP_103522718.1|2473284_2474451_-	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	1.3e-12
WP_000917724.1|2474696_2474900_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_164475710.1|2475050_2476103_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	1.2e-206
WP_000839596.1|2476169_2476385_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000075159.1|2476384_2476882_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_122986183.1|2477098_2477284_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.4e-19
WP_000232224.1|2477367_2477730_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_000373425.1|2478184_2478679_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_023356415.1|2478678_2480781_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.9	0.0e+00
WP_001072975.1|2480777_2480990_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985944.1|2480989_2482498_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
WP_001136591.1|2482442_2484470_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.8	0.0e+00
WP_001097046.1|2484556_2484880_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283152.1|2484872_2485148_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677112.1|2485159_2485738_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079416.1|2485734_2486136_+|tail	phage tail protein U	tail	A5LH34	Enterobacteria_phage	98.5	4.1e-72
WP_000211095.1|2486146_2486890_+	hypothetical protein	NA	A0A291AWU6	Escherichia_phage	99.2	5.0e-132
WP_001420256.1|2486950_2487337_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	98.4	8.0e-65
WP_001161009.1|2487345_2487675_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_074516694.1|2487646_2490703_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.0	0.0e+00
WP_000447253.1|2490702_2491032_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|2491041_2491740_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_074472026.1|2491745_2492489_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	7.5e-152
WP_001309913.1|2492386_2493034_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000515713.1|2493094_2496592_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_047667381.1|2496662_2497262_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	4.8e-109
WP_164475711.1|2497326_2500728_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_164475712.1|2500727_2501309_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	7.3e-102
>prophage 6
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	2701884	2754026	5409430	integrase,plate,tRNA,holin,tail,terminase	Escherichia_phage(78.12%)	70	2699532:2699546	2748676:2748690
2699532:2699546	attL	ATACAATCTGAACAA	NA	NA	NA	NA
WP_164475759.1|2701884_2702448_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	73.8	9.2e-78
WP_164475760.1|2702455_2703880_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	53.9	1.4e-74
WP_061336307.1|2703903_2704449_-|tail	phage tail protein	tail	Q8W612	Enterobacteria_phage	77.5	1.2e-77
WP_061336306.1|2704451_2706005_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.0	1.9e-226
WP_001199731.1|2706001_2706628_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_072277864.1|2706611_2707838_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.5	4.9e-225
WP_000426903.1|2707878_2709039_-	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	30.0	4.9e-33
WP_001261327.1|2709188_2709536_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000063620.1|2709818_2710532_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
WP_001271166.1|2710531_2711539_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	91.0	8.0e-181
WP_000209262.1|2711538_2711805_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_164475761.1|2711801_2712470_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_061317093.1|2712473_2714447_-	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	99.4	0.0e+00
WP_061317094.1|2714510_2715128_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	99.0	8.5e-109
WP_000613368.1|2715124_2715556_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_061336303.1|2715579_2716917_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.0	5.2e-244
WP_042966456.1|2716916_2717861_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	4.9e-172
WP_000762302.1|2717847_2718288_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_061336302.1|2718284_2718725_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	97.9	4.0e-76
WP_000780862.1|2718724_2719195_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_061336301.1|2719251_2720280_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	98.8	4.8e-189
WP_164475762.1|2720294_2720912_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	98.0	7.2e-116
WP_097738967.1|2720904_2722227_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	96.4	6.5e-191
WP_024190735.1|2722207_2722927_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
WP_061336298.1|2722985_2724422_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.7	7.2e-268
WP_164475763.1|2724439_2725768_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	97.1	3.3e-259
WP_000089453.1|2725757_2726849_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
WP_000126789.1|2726852_2727062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061336297.1|2727039_2727972_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	3.2e-83
WP_040092206.1|2727964_2728753_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.5	2.5e-49
WP_164475764.1|2728766_2728988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050940003.1|2729226_2729508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050940005.1|2729575_2730121_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.5	2.4e-91
WP_000950579.1|2730122_2730401_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.9	7.3e-36
WP_032215181.1|2730390_2730780_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_164475765.1|2732144_2732687_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.7e-76
WP_040092199.1|2732683_2732974_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	1.8e-45
WP_040092198.1|2732973_2733573_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.9e-106
WP_040092197.1|2733632_2733806_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	73.1	1.1e-16
WP_072278258.1|2734059_2734197_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	86.7	4.0e-11
WP_040092196.1|2734654_2734942_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	50.5	1.5e-15
WP_040092222.1|2735050_2735284_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	87.0	1.0e-30
WP_164475766.1|2735413_2735587_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	71.9	5.8e-15
WP_040092195.1|2735713_2736025_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	1.2e-50
WP_074169268.1|2736217_2736508_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	91.5	9.0e-45
WP_072278261.1|2736504_2736786_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	67.7	9.7e-28
WP_164475767.1|2736824_2737571_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	86.3	1.2e-112
WP_164475768.1|2737593_2738340_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	6.4e-111
WP_105466891.1|2738346_2739153_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	86.6	1.9e-63
WP_000010975.1|2739232_2739484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101968808.1|2739484_2739781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105466890.1|2739793_2740216_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.1e-67
WP_139951522.1|2740199_2740475_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	64.6	5.4e-23
WP_001253183.1|2740579_2741044_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	70.2	1.2e-54
WP_139951524.1|2741279_2741585_+	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	95.0	3.6e-44
WP_000560226.1|2742195_2742417_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245534.1|2742410_2742587_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_164476244.1|2742622_2742961_+	DNA breaking-rejoining protein	NA	K7P7B3	Enterobacteria_phage	38.3	1.7e-10
WP_164475769.1|2742985_2744887_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	70.2	1.3e-237
WP_164476246.1|2744864_2745161_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	81.6	4.0e-40
WP_000100847.1|2745166_2745952_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_164475770.1|2745948_2746629_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_164476245.1|2746661_2746856_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_164475771.1|2746848_2747037_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
WP_000079604.1|2747136_2747352_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_164475772.1|2747353_2748589_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	2.7e-239
WP_001157377.1|2748640_2749576_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
2748676:2748690	attR	ATACAATCTGAACAA	NA	NA	NA	NA
WP_000123737.1|2749704_2751078_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2751555_2752539_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2752793_2754026_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	2828913	2896103	5409430	head,portal,integrase,holin,capsid,plate,protease,tail,terminase	Enterobacteria_phage(27.78%)	91	2859147:2859163	2878703:2878719
WP_032202609.1|2828913_2829963_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	4.6e-22
WP_000559268.1|2830182_2830941_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_164475783.1|2830937_2831528_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|2831567_2832443_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_164475784.1|2832655_2834551_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2834578_2835199_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285678.1|2835195_2836077_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2836214_2836259_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194606.1|2836350_2837913_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2837912_2839508_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_164476247.1|2839511_2840870_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
WP_000209521.1|2840881_2842075_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443065.1|2842074_2842881_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807649.1|2843261_2843441_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2843526_2844027_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_164475785.1|2844072_2844579_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_096147370.1|2845224_2845788_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	64.9	3.1e-49
WP_164475786.1|2845824_2846403_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	74.2	3.6e-77
WP_164475787.1|2846410_2847835_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	48.5	1.7e-56
WP_164475788.1|2847859_2848936_-	late control protein	NA	R9TNM7	Vibrio_phage	30.1	2.7e-33
WP_057698229.1|2848926_2849145_-|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	49.3	1.9e-10
WP_105466838.1|2849119_2849608_-|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	43.4	1.9e-23
WP_105466839.1|2849610_2851266_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	36.4	1.4e-49
WP_063119930.1|2851383_2851686_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_057698225.1|2851746_2852265_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_164475789.1|2852261_2853737_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.8	3.6e-73
WP_164475790.1|2853792_2854338_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	96.1	2.5e-96
WP_105493938.1|2854340_2855708_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	62.1	1.6e-99
WP_164475791.1|2855717_2856299_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.5	2.1e-24
WP_105493934.1|2856291_2857206_-|plate	baseplate assembly protein	plate	A0A193GYM8	Enterobacter_phage	44.2	1.5e-61
WP_057698219.1|2857180_2857537_-|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	45.5	5.5e-20
WP_164475792.1|2857571_2858195_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	31.0	3.4e-12
WP_105493760.1|2858760_2859045_-	hypothetical protein	NA	NA	NA	NA	NA
2859147:2859163	attL	TTTATGAAAATTTTTCG	NA	NA	NA	NA
WP_164475793.1|2859310_2859895_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	53.3	2.9e-50
WP_032223714.1|2860194_2860620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475794.1|2860634_2860964_-|head	head decoration protein	head	NA	NA	NA	NA
WP_033562018.1|2860974_2862030_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	46.0	1.4e-74
WP_021558959.1|2862029_2862236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475795.1|2862494_2862917_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_164475796.1|2862913_2863165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475797.1|2863366_2864782_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	57.3	5.0e-112
WP_164475798.1|2864778_2865078_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_029593906.1|2865286_2865520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475799.1|2865492_2865753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306492.1|2866088_2866283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000605263.1|2866340_2866823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164475800.1|2867238_2867820_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	60.1	5.8e-51
WP_074578390.1|2867870_2868080_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164475801.1|2868086_2869319_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	35.9	5.4e-54
WP_057698217.1|2869894_2870617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061352094.1|2870597_2870999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105493931.1|2871001_2871388_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_000522659.1|2871438_2872467_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
WP_057698658.1|2872537_2872873_-|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	50.0	1.8e-20
WP_164475802.1|2872913_2874392_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	1.2e-100
WP_105493937.1|2874381_2875905_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.8	1.4e-184
WP_105493929.1|2875949_2876159_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	46.0	2.0e-09
WP_073521062.1|2876162_2878079_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.2	7.4e-252
WP_073521063.1|2878050_2878560_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.0	8.8e-19
WP_057697880.1|2879421_2879604_-	hypothetical protein	NA	NA	NA	NA	NA
2878703:2878719	attR	CGAAAAATTTTCATAAA	NA	NA	NA	NA
WP_057697881.1|2879873_2880155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475803.1|2880222_2880768_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	88.3	6.8e-94
WP_000950579.1|2880769_2881048_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.9	7.3e-36
WP_032215181.1|2881037_2881427_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_160541232.1|2882190_2883237_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.2	4.0e-191
WP_160541233.1|2883387_2883585_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	96.9	6.8e-28
WP_042973071.1|2883902_2884913_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	31.0	3.1e-39
WP_042973072.1|2884928_2885309_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	88.2	2.2e-54
WP_042973074.1|2885298_2885670_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.0e-37
WP_164475804.1|2885682_2886732_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	3.9e-106
WP_096147693.1|2886733_2887006_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	2.7e-11
WP_163426341.1|2887072_2887240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475805.1|2887492_2887705_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	3.8e-24
WP_042973096.1|2888102_2888336_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	89.6	1.6e-31
WP_164475806.1|2888466_2888640_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	77.2	3.6e-17
WP_139582581.1|2888730_2889129_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	92.4	3.9e-54
WP_096147373.1|2889088_2889418_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	34.1	2.1e-21
WP_096147374.1|2889414_2889729_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	86.0	3.5e-50
WP_139582578.1|2889742_2889925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096147375.1|2889921_2890212_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	88.3	1.4e-42
WP_057697772.1|2890208_2890643_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	65.2	1.4e-41
WP_096147376.1|2890658_2891429_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	2.2e-85
WP_061358507.1|2891468_2892197_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.9	7.9e-114
WP_164476248.1|2892203_2893313_-	DNA-binding protein	NA	V5URT9	Shigella_phage	64.5	5.6e-119
WP_072320167.1|2893391_2893847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096147303.1|2894053_2894479_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001585828.1|2894462_2894738_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_001585829.1|2894841_2895231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000379577.1|2895399_2895555_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_158121943.1|2895714_2895933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164475807.1|2895944_2896103_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	63.0	1.1e-07
>prophage 8
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	4612798	4700726	5409430	head,transposase,portal,lysis,integrase,capsid,protease,plate,holin,tail,terminase	Shigella_phage(46.88%)	100	4699725:4699741	4702005:4702021
WP_000878219.1|4612798_4613665_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|4613661_4613961_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_097715208.1|4614906_4615191_+	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_164476069.1|4615211_4617611_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	3.5e-25
WP_164476070.1|4617597_4618401_+	peptidase M35	NA	NA	NA	NA	NA
WP_164476071.1|4618402_4619242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476072.1|4620819_4621362_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_164476073.1|4621346_4623440_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_001297096.1|4624341_4625121_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255946.1|4625120_4626143_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_164476074.1|4626648_4627152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053291253.1|4627242_4627731_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_164476075.1|4628004_4628772_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|4628925_4629399_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_137481885.1|4629441_4631886_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|4632125_4632704_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_069913672.1|4632909_4633677_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_069913671.1|4633647_4634388_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_094281256.1|4634543_4634822_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|4634824_4635085_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_164476262.1|4635294_4636044_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	35.6	7.3e-14
WP_069913669.1|4636220_4636718_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_164476076.1|4637137_4638877_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_164476077.1|4638821_4639607_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|4639677_4640733_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_164476078.1|4640729_4641182_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001321003.1|4641415_4641682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077821207.1|4641614_4642151_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_022645227.1|4642207_4643665_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|4643925_4644384_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_164476079.1|4644475_4645720_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|4645777_4646179_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|4646217_4647273_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|4647560_4648664_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893272.1|4648675_4649929_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
WP_000051893.1|4650133_4651297_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_164476080.1|4651173_4651524_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.1	3.2e-60
WP_000206734.1|4651523_4651829_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_001242749.1|4651828_4652191_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001605537.1|4652181_4652718_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	2.8e-100
WP_000081294.1|4652845_4653670_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000135682.1|4653735_4654098_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000917896.1|4654699_4654996_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000848748.1|4655168_4655843_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4655933_4656134_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515828.1|4656177_4656729_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_001250269.1|4656904_4657084_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|4657073_4658015_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_021576994.1|4658011_4658506_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	2.5e-87
WP_001355692.1|4658505_4659159_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_000210155.1|4659155_4659482_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000767113.1|4659478_4659868_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061418.1|4659887_4660685_+	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	99.2	2.2e-149
WP_001360050.1|4660692_4661682_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_085948622.1|4661696_4662065_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	85.0	2.3e-53
WP_050921965.1|4662093_4663425_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.4	1.4e-20
WP_001120490.1|4663721_4664048_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_021540768.1|4664051_4664528_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.1	4.9e-88
WP_021533220.1|4664511_4664973_+|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	88.8	3.5e-67
WP_021533221.1|4665582_4665894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021533222.1|4665883_4666270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001607219.1|4666315_4666618_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	86.0	2.2e-46
WP_074488041.1|4666703_4667054_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	4.9e-61
WP_000929182.1|4667179_4667674_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	5.6e-87
WP_122989116.1|4667907_4669404_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.0	2.4e-298
WP_021533224.1|4669415_4669598_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	98.3	6.5e-25
WP_001764252.1|4669597_4670839_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
WP_001193631.1|4670816_4671467_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_164476081.1|4671481_4672687_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	2.2e-222
WP_000601360.1|4672736_4672937_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|4672939_4673263_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702401.1|4673259_4673670_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000224838.1|4673644_4674151_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	2.9e-83
WP_000779281.1|4674147_4674708_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	5.2e-105
WP_000497751.1|4674716_4674887_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_164476082.1|4674870_4676367_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.6	1.5e-271
WP_000090998.1|4676366_4676723_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571713.1|4676719_4677043_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_021533227.1|4677127_4679035_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	98.6	0.0e+00
WP_000366152.1|4679059_4680436_+	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.3	1.8e-252
WP_000999509.1|4680432_4681512_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	2.6e-206
WP_001259084.1|4681511_4682060_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_164476263.1|4682059_4682485_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	98.6	5.2e-81
WP_064576231.1|4682471_4683530_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	2.1e-200
WP_000383548.1|4683520_4684105_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_164476083.1|4686367_4686922_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	1.4e-86
WP_000246059.1|4688571_4689315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_097731891.1|4690280_4691471_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.6	3.6e-124
WP_097731892.1|4692056_4692260_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.0	1.1e-07
WP_164476084.1|4692459_4693332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476085.1|4693341_4694349_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	40.7	1.4e-63
WP_112886723.1|4694561_4694753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476086.1|4694960_4695164_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_164476087.1|4695156_4695405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130210776.1|4695397_4695823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476088.1|4695815_4696214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115424602.1|4696310_4696580_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	44.7	2.5e-09
WP_164476089.1|4696643_4699376_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	31.7	3.4e-109
WP_164476090.1|4699570_4699768_-	hypothetical protein	NA	NA	NA	NA	NA
4699725:4699741	attL	GCTTTTCCCTGGCTGGC	NA	NA	NA	NA
WP_164476091.1|4699760_4700726_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	60.5	5.8e-104
WP_164476091.1|4699760_4700726_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	60.5	5.8e-104
4702005:4702021	attR	GCTTTTCCCTGGCTGGC	NA	NA	NA	NA
>prophage 9
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	4979612	5035261	5409430	transposase,integrase,tRNA,protease,tail	Shigella_phage(37.5%)	60	5014196:5014242	5035685:5035731
WP_001157987.1|4979612_4980707_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_097470485.1|4980775_4981702_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|4981931_4982414_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|4982491_4983307_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_053883302.1|4983396_4985178_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	2.7e-38
WP_000943556.1|4985190_4985967_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765840.1|4986066_4986945_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401139.1|4987113_4988568_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|4988627_4989989_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_038340856.1|4990045_4991347_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_069913429.1|4991368_4992514_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.4	2.4e-48
WP_000540946.1|4992741_4993527_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_164476135.1|4993537_4994773_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703913.1|4994794_4995844_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_164476136.1|4996160_4997828_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|4997837_4999097_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|4999107_4999923_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|4999919_5000813_+	carbamate kinase	NA	NA	NA	NA	NA
WP_021577110.1|5000951_5002019_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|5002015_5002525_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_164476137.1|5002641_5003364_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|5003366_5003861_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_135564090.1|5004034_5005420_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_021556572.1|5005455_5005977_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|5006084_5006297_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|5006298_5007165_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_164476138.1|5007645_5008188_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988383.1|5008407_5009100_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_164476139.1|5009130_5011692_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691070.1|5011752_5012760_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_164476140.1|5012770_5013286_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|5013288_5013921_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
5014196:5014242	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|5014255_5015419_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_164476141.1|5015274_5015646_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	80.2	1.0e-45
WP_000206813.1|5015645_5015951_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_164476142.1|5015950_5016124_-	hypothetical protein	NA	U5P092	Shigella_phage	100.0	3.4e-23
WP_000255946.1|5016180_5017203_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001297096.1|5017202_5017982_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_164476143.1|5018032_5018272_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.7	3.7e-36
WP_000008165.1|5018262_5018799_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_164476144.1|5018926_5019751_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000135682.1|5019816_5020179_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|5020649_5021165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|5021484_5022177_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|5022274_5022535_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|5022527_5023079_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|5023254_5023434_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000210176.1|5023820_5024147_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_164476145.1|5024143_5024521_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.4	4.9e-59
WP_000453587.1|5024912_5025458_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_164476265.1|5026819_5028004_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	73.1	2.2e-41
WP_164475712.1|5028003_5028585_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	7.3e-102
WP_032259726.1|5028704_5029595_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|5029613_5030120_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_164475713.1|5030156_5030657_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|5030735_5030918_-	general stress protein	NA	NA	NA	NA	NA
WP_164476146.1|5031422_5032091_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164476147.1|5032147_5032453_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_164476148.1|5032636_5034121_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_164476149.1|5034307_5035261_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
5035685:5035731	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 10
NZ_CP049201	Escherichia coli strain PapRG-04-4 chromosome, complete genome	5409430	5365995	5406087	5409430	protease,integrase,transposase	Moraxella_phage(20.0%)	33	5352998:5353011	5377375:5377388
5352998:5353011	attL	CACAGGTGAAAATA	NA	NA	NA	NA
WP_000520781.1|5365995_5366316_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_164476216.1|5366346_5368623_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279878.1|5369380_5370583_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
WP_164475834.1|5370770_5372588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639577.1|5373700_5373997_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|5374223_5374421_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_057698534.1|5374639_5376073_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_160539739.1|5377011_5377575_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
5377375:5377388	attR	TATTTTCACCTGTG	NA	NA	NA	NA
WP_057697917.1|5378087_5378651_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_057697918.1|5378941_5379715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057697919.1|5380022_5380418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475833.1|5380677_5381301_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_073520813.1|5381387_5381621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057698040.1|5381673_5381865_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164475832.1|5382543_5384196_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	1.0e-39
WP_057698034.1|5384205_5384733_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_164476217.1|5384748_5394069_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	38.6	1.8e-53
WP_158120983.1|5394065_5394551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087892023.1|5394879_5395716_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_001003690.1|5395712_5396051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476218.1|5396272_5396710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040084989.1|5396751_5397231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097754729.1|5397227_5397461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736772.1|5397726_5398284_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	35.3	8.1e-18
WP_163516589.1|5398695_5398839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476219.1|5398852_5400355_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.4	1.9e-77
WP_000957247.1|5400474_5400855_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_164476220.1|5400841_5401171_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_057697977.1|5401288_5401771_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_143362462.1|5402844_5403165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476221.1|5403560_5403671_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	80.0	1.5e-05
WP_061361383.1|5403779_5404535_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.5	2.5e-46
WP_164475457.1|5404551_5406087_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	3.0e-102
>prophage 1
NZ_CP049202	Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence	167766	1256	76575	167766	transposase,integrase	Enterobacteria_phage(30.0%)	63	NA	NA
WP_089586202.1|1256_1997_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_164476316.1|2117_2267_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_040089280.1|3702_4395_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_164476269.1|4387_6796_-	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_089587956.1|6992_7523_-	fimbrial protein	NA	NA	NA	NA	NA
WP_164476270.1|8325_8913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476272.1|9204_9564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057697823.1|10229_10619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040100202.1|10945_11764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040100218.1|12211_12907_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_164476274.1|13963_15454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476275.1|15443_16043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137792.1|17656_17986_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|17972_18353_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_164476276.1|18473_19979_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	2.1e-76
WP_164475337.1|19992_20136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476278.1|20355_20928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476317.1|21403_21685_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_096935884.1|21684_22008_+	CcdB family protein	NA	NA	NA	NA	NA
WP_164476279.1|22520_23084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476281.1|23262_23418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422694.1|23602_24022_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	4.5e-45
WP_057697740.1|24018_24369_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	8.1e-40
WP_000447022.1|26192_27728_+|transposase	IS21-like element ISSso4 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.7	1.7e-102
WP_001282649.1|27744_28500_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.4	2.4e-44
WP_040089121.1|29108_29747_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	5.1e-56
WP_040089139.1|29731_30961_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	2.0e-61
WP_164475336.1|31614_32454_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160521686.1|32474_33353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057697995.1|33387_34533_-	DUF4056 domain-containing protein	NA	NA	NA	NA	NA
WP_040100188.1|34625_34877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040089126.1|35074_36022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164475335.1|36033_36975_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_164475334.1|37056_38154_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_040100192.1|38163_38994_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_052516961.1|39179_40085_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164476282.1|40384_43885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476284.1|45661_46875_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_001196199.1|49367_49949_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	7.1e-41
WP_072146479.1|52948_53665_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_057697731.1|54230_54848_+	YfdX family protein	NA	NA	NA	NA	NA
WP_057697732.1|55668_56673_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164476285.1|56924_57443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476286.1|57442_57844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476287.1|57933_58215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476288.1|58336_58717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476318.1|58739_59018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164476289.1|59081_59303_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164476290.1|59752_59962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144429266.1|61828_62224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164476291.1|62652_63399_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_164476292.1|65282_65453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057697737.1|66104_66395_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	87.4	2.3e-40
WP_057697738.1|66391_66703_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	91.2	1.0e-46
WP_164476293.1|67057_68650_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	3.9e-174
WP_057697740.1|68680_69031_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	8.1e-40
WP_000422694.1|69027_69447_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	4.5e-45
WP_164476294.1|70209_71781_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	7.6e-170
WP_164476295.1|71800_72148_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	2.2e-45
WP_001339397.1|72147_72825_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_164476296.1|73517_74540_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164476297.1|74605_75778_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.0	1.3e-227
WP_123017530.1|75777_76575_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	99.2	3.3e-145
>prophage 2
NZ_CP049202	Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence	167766	153002	160805	167766	integrase	Cronobacter_phage(25.0%)	11	151072:151084	161042:161054
151072:151084	attL	GTTCAGAGTGACA	NA	NA	NA	NA
WP_032219114.1|153002_153686_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	6.7e-30
WP_164476322.1|154070_154973_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_164476315.1|155390_155639_+	DinI family protein	NA	Q2A098	Sodalis_phage	48.0	4.1e-14
WP_032219119.1|155635_156073_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	46.8	2.4e-25
WP_072001427.1|156072_157065_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.9	2.6e-99
WP_000643588.1|157094_157343_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	60.3	5.0e-20
WP_000340833.1|157347_157740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103694.1|157744_158716_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|158944_159589_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|159582_159858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040101096.1|159995_160805_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.8	8.7e-53
161042:161054	attR	TGTCACTCTGAAC	NA	NA	NA	NA
