The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	142877	156611	4550072	tRNA	Tupanvirus(11.11%)	15	NA	NA
WP_006118953.1|142877_144806_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	1.4e-125
WP_006118954.1|144809_145361_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.2	8.3e-15
WP_006118955.1|145461_145659_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006118956.1|145703_146060_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_106120997.1|146181_146226_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_033741123.1|146373_147357_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.1	1.4e-33
WP_164481859.1|147371_149759_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	2.3e-08
WP_006118960.1|149763_150066_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_164481860.1|150165_151173_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_039340642.1|151188_151734_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	41.6	1.1e-14
WP_033741133.1|151734_152484_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	27.1	4.9e-10
WP_033741136.1|152550_153009_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	36.6	4.6e-11
WP_006118964.1|153300_154035_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_164481861.1|154126_155563_+	YdiU family protein	NA	NA	NA	NA	NA
WP_164481862.1|155564_156611_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	50.3	2.2e-85
>prophage 2
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	781653	816983	4550072	plate,capsid,holin,tail,head	uncultured_Caudovirales_phage(30.0%)	54	NA	NA
WP_164482033.1|781653_782076_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.6	9.5e-27
WP_164482034.1|782079_783249_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	56.3	3.6e-15
WP_164482035.1|783248_783929_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	74.8	5.2e-99
WP_164482036.1|783925_785125_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	74.6	5.8e-162
WP_164482037.1|785474_786131_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	58.0	2.7e-73
WP_164482038.1|786184_786559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064352517.1|786561_787176_-	hypothetical protein	NA	A5VW61	Enterobacteria_phage	31.0	2.6e-17
WP_164482039.1|787239_787590_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.4	6.7e-26
WP_164482040.1|787592_788663_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	65.4	2.9e-128
WP_164482041.1|788665_788968_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	54.0	2.7e-28
WP_064352513.1|788967_789576_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	73.2	8.2e-72
WP_164482042.1|789575_791552_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	69.7	3.3e-271
WP_164482043.1|791541_791694_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	66.0	1.5e-11
WP_164482044.1|791729_792161_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	74.2	5.8e-48
WP_110957637.1|792163_792607_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	86.7	2.0e-67
WP_164482045.1|792619_793765_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	68.2	8.6e-147
WP_164482046.1|793768_794317_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	57.8	2.8e-55
WP_164482047.1|794306_794696_-|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	78.3	4.9e-54
WP_164482048.1|794682_795312_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	41.0	6.4e-27
WP_164482049.1|795308_795716_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	68.4	3.7e-44
WP_164482050.1|795696_796068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482051.1|796108_797047_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	56.1	1.0e-97
WP_164482052.1|797061_797559_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	44.3	1.0e-27
WP_164482053.1|797558_798800_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	45.0	3.8e-84
WP_174250593.1|799081_799813_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	65.0	6.4e-71
WP_164482054.1|799700_801179_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	60.0	4.2e-170
WP_164482055.1|801168_802800_-	TerL protein	NA	A9YWZ6	Burkholderia_phage	72.1	5.0e-233
WP_164482056.1|802903_803098_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_164482057.1|803314_803788_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.7	1.4e-55
WP_164482058.1|803819_804437_-	hypothetical protein	NA	F1C5D5	Cronobacter_phage	75.5	6.8e-90
WP_164482059.1|804438_804624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482060.1|804656_804923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482061.1|804919_805228_-	hypothetical protein	NA	L7TH90	Pseudomonas_virus	55.6	4.2e-16
WP_164482062.1|805315_805489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482063.1|805539_805797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482064.1|805943_806345_-	DUF2570 domain-containing protein	NA	S5FKR3	Shigella_phage	38.1	1.9e-08
WP_174250614.1|806341_806824_-	lysozyme	NA	A0A1W6JP42	Morganella_phage	56.5	8.3e-43
WP_105088779.1|806832_807087_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_164483190.1|807826_808162_-	DUF1133 family protein	NA	NA	NA	NA	NA
WP_164482065.1|808092_808407_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	46.5	1.7e-09
WP_164483191.1|808446_808803_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	68.7	8.0e-43
WP_164482066.1|808802_810215_-	AAA family ATPase	NA	K7P852	Enterobacteria_phage	55.3	4.2e-127
WP_164482067.1|810207_811272_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	43.0	1.4e-58
WP_155270046.1|811264_811417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110957206.1|811472_811658_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_029570154.1|811650_811974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072005080.1|812000_812228_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	43.4	1.9e-05
WP_164482068.1|812318_812960_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	75.2	1.1e-63
WP_164482069.1|813806_814211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482070.1|814332_814533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482071.1|814513_814948_+	HNH endonuclease	NA	Q6WYF0	Enterobacteria_phage	40.9	6.1e-21
WP_174250594.1|814952_815618_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.6	3.5e-23
WP_164482072.1|815619_816285_+	ATP-binding protein	NA	G9L667	Escherichia_phage	59.9	3.8e-70
WP_164482073.1|816284_816983_+	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	40.3	1.0e-25
>prophage 3
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	1093577	1137848	4550072	plate,tail,lysis,terminase,head	uncultured_Caudovirales_phage(33.33%)	61	NA	NA
WP_164482167.1|1093577_1094636_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	51.4	1.1e-84
WP_033740422.1|1094708_1095035_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_033740425.1|1095195_1096251_-	FUSC family protein	NA	NA	NA	NA	NA
WP_172913000.1|1096460_1097618_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	63.6	1.6e-145
WP_164482168.1|1097962_1098286_-	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	55.3	4.7e-18
WP_164482169.1|1098287_1098527_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	51.5	1.6e-10
WP_164482170.1|1098737_1099154_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	49.2	1.2e-26
WP_164482171.1|1099157_1100327_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	55.2	6.1e-15
WP_164482172.1|1100326_1101007_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	74.3	7.4e-98
WP_164482173.1|1101003_1102203_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	71.9	2.4e-155
WP_164482174.1|1102202_1102556_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	88.0	2.0e-54
WP_164482175.1|1102555_1103308_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	69.2	4.2e-94
WP_164482176.1|1103366_1103822_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_164482177.1|1103793_1104375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164483202.1|1104429_1104759_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	67.9	1.6e-21
WP_164482178.1|1104758_1105829_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	65.5	1.2e-129
WP_164482179.1|1105831_1106134_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	52.0	1.4e-27
WP_164482180.1|1106133_1106742_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	72.1	2.4e-71
WP_164482181.1|1106741_1108718_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	70.0	3.9e-272
WP_015700135.1|1108707_1108866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482182.1|1108895_1109372_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	61.1	1.3e-37
WP_164482183.1|1109374_1109815_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	86.3	2.3e-68
WP_164482184.1|1109827_1110976_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	72.0	5.9e-156
WP_164483203.1|1110979_1111531_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.7e-39
WP_164482185.1|1111520_1111928_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	67.9	1.6e-42
WP_164482186.1|1111927_1112431_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	39.9	1.3e-22
WP_164482187.1|1112427_1112838_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	49.3	7.8e-26
WP_164482188.1|1112809_1113256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482189.1|1113259_1114207_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	57.9	1.5e-104
WP_164482190.1|1114217_1114721_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	44.2	1.3e-27
WP_164482191.1|1114730_1116005_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	43.1	6.1e-77
WP_164482192.1|1116042_1116213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164483204.1|1116209_1116758_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.0	9.1e-46
WP_164482193.1|1116819_1118289_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	52.2	1.0e-144
WP_164482194.1|1118505_1119924_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.5	1.6e-190
WP_164483205.1|1119877_1120372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482195.1|1120707_1120887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482196.1|1120940_1121198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482197.1|1121202_1121703_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	52.0	5.4e-29
WP_164482198.1|1121699_1122239_-	glycoside hydrolase family protein	NA	H9C184	Pectobacterium_phage	79.9	4.7e-79
WP_081047055.1|1122241_1122478_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_164482199.1|1122631_1123249_-	methyltransferase domain-containing protein	NA	H2BDB7	Pseudomonas_virus	47.2	8.4e-48
WP_164483206.1|1123223_1124057_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	46.5	8.6e-64
WP_164482200.1|1124070_1124634_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	44.3	7.2e-38
WP_164482201.1|1124864_1125443_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.4	2.0e-35
WP_164482202.1|1125439_1125736_-	DUF1364 family protein	NA	E5AGG0	Erwinia_phage	68.1	2.0e-31
WP_164482203.1|1125720_1126104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482204.1|1127773_1128367_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	48.7	2.3e-47
WP_164482205.1|1128368_1129055_-	phage replication protein	NA	G8C7U6	Escherichia_phage	64.5	2.4e-80
WP_164483207.1|1129051_1129984_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.6	1.2e-50
WP_164482206.1|1130104_1130419_-	hypothetical protein	NA	A0A2H4J609	uncultured_Caudovirales_phage	54.9	8.3e-20
WP_028722565.1|1130501_1130717_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	74.6	1.8e-21
WP_164482207.1|1130822_1131476_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	40.4	2.4e-29
WP_164482208.1|1131674_1131869_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	57.1	1.2e-13
WP_164482209.1|1131897_1132251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482210.1|1132261_1134976_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	39.7	8.4e-185
WP_164482211.1|1134987_1136091_+	recombinase RecT	NA	K7P7N5	Enterobacteria_phage	48.1	3.0e-88
WP_164482212.1|1136127_1136427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482213.1|1136416_1136563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164481808.1|1136559_1137084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482214.1|1137080_1137848_+	hypothetical protein	NA	A0A291LAU4	Bordetella_phage	50.2	8.8e-63
>prophage 4
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	1175128	1182253	4550072		Enterobacteria_phage(50.0%)	7	NA	NA
WP_033740468.1|1175128_1175677_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.0	1.8e-54
WP_164482229.1|1175680_1176559_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	8.7e-107
WP_164482230.1|1176608_1177505_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.3e-28
WP_033740474.1|1177504_1178590_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.3e-98
WP_164482231.1|1178732_1179809_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_033740479.1|1180293_1181307_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.0	1.2e-75
WP_006119858.1|1181356_1182253_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.5	2.3e-46
>prophage 5
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	1234381	1325350	4550072	protease,tRNA,transposase,capsid,holin,integrase,tail,lysis,terminase,head,portal	Enterobacteria_phage(19.61%)	95	1285265:1285317	1326953:1327005
WP_039338152.1|1234381_1236415_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	4.7e-55
WP_033740547.1|1236530_1236923_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_033740549.1|1236915_1237608_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_058708419.1|1237726_1238611_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_006119924.1|1238781_1240479_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_006119925.1|1240614_1241334_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_006119926.1|1241877_1242888_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_006119927.1|1242907_1244428_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	1.3e-09
WP_033740552.1|1244498_1245494_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_110268213.1|1245806_1246847_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_164482244.1|1246987_1248148_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_006119934.1|1248197_1248863_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	54.9	2.6e-55
WP_058702635.1|1248988_1250116_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_033740559.1|1250221_1251133_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033740561.1|1251211_1252336_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	1.6e-36
WP_006119939.1|1252347_1253193_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_033740562.1|1253228_1254017_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	2.7e-14
WP_054633448.1|1254016_1255093_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_033740564.1|1255229_1256690_-	amino acid permease	NA	NA	NA	NA	NA
WP_033740566.1|1256871_1257741_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006119946.1|1257758_1258124_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_039338166.1|1258226_1259279_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_164482245.1|1259459_1260353_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.1	8.4e-65
WP_033740573.1|1260593_1261436_+	deoxyribonuclease IV	NA	A0A2R8FEV6	Brazilian_cedratvirus	27.5	4.7e-09
WP_006119954.1|1261472_1263170_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_006119955.1|1263186_1264125_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_006119956.1|1264121_1265252_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_006119957.1|1265742_1265997_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006119958.1|1266268_1266841_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_164482246.1|1266919_1267897_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_006119960.1|1267939_1268647_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_006119961.1|1269156_1269723_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	38.3	1.6e-13
WP_033740578.1|1269931_1271509_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_164482247.1|1271550_1273359_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033740582.1|1273368_1274463_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_033740584.1|1274462_1275485_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_164482248.1|1275485_1277090_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.7	2.3e-17
WP_033740957.1|1277076_1277397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006119971.1|1277650_1278847_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	6.0e-26
WP_033740587.1|1278858_1279578_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_164482249.1|1279733_1281488_+	DEAD/DEAH box helicase family protein	NA	M4Q3N1	Vibrio_phage	42.0	8.6e-98
WP_006119974.1|1281619_1281904_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_033740589.1|1281996_1283001_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.5	4.9e-90
WP_006119976.1|1283160_1283385_+	YejL family protein	NA	NA	NA	NA	NA
WP_058708435.1|1283407_1285162_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
1285265:1285317	attL	GTCATGGGGTGTCAGGGGTCGGAGGTTCAAATCCTCTCGTGCCGACCAAATTA	NA	NA	NA	NA
WP_164482250.1|1285406_1286669_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	73.2	2.5e-176
WP_164482251.1|1286668_1286908_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	53.8	9.1e-19
WP_164482252.1|1287121_1288243_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	33.5	2.9e-38
WP_164482253.1|1288310_1288673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482254.1|1288742_1289819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482255.1|1289818_1293016_-	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	68.9	0.0e+00
WP_164482256.1|1293103_1293691_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	67.5	3.3e-62
WP_164482257.1|1293705_1294131_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	32.2	9.6e-11
WP_164482258.1|1294190_1294901_-	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	73.9	4.4e-109
WP_164482259.1|1294903_1295659_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	78.9	1.4e-118
WP_164482260.1|1295655_1295994_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	74.1	3.2e-49
WP_164482261.1|1295997_1299390_-|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	53.3	1.8e-224
WP_164482262.1|1299410_1299683_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	64.8	7.5e-25
WP_064352391.1|1299706_1300117_-|tail	phage tail protein	tail	F1C576	Cronobacter_phage	60.9	6.0e-34
WP_164482263.1|1300187_1300643_-|tail	phage tail protein	tail	K7P6W3	Enterobacteria_phage	77.3	3.5e-59
WP_164482264.1|1300697_1301045_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	54.9	9.2e-28
WP_164482265.1|1301041_1301488_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	56.8	1.6e-40
WP_164482267.1|1301484_1301823_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	64.9	7.1e-33
WP_164482268.1|1301831_1302161_-|head,tail	phage head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.9	3.2e-30
WP_096012292.1|1302202_1303411_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	73.9	1.3e-161
WP_105087469.1|1303420_1304269_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	66.5	3.7e-94
WP_164482269.1|1304281_1305586_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	80.9	1.0e-204
WP_164482270.1|1305585_1307316_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	78.0	2.9e-279
WP_096012288.1|1307315_1307789_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	70.7	3.3e-60
WP_164482271.1|1307987_1308338_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	1.0e-50
WP_164482272.1|1308261_1308924_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	71.8	2.0e-79
WP_164482273.1|1308904_1309417_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	56.1	1.0e-46
WP_164482275.1|1309423_1310881_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	74.8	2.0e-225
WP_164482277.1|1311328_1311508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482278.1|1311868_1312321_-	Rz lytic protein	NA	NA	NA	NA	NA
WP_121046861.1|1312317_1312743_-	lysozyme	NA	A0A0B5KND4	Acinetobacter_phage	61.4	3.7e-39
WP_024471897.1|1312726_1313080_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_105082319.1|1313302_1313575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482280.1|1313837_1314239_-	antitermination protein	NA	B6SCY2	Bacteriophage	48.1	2.0e-26
WP_164482282.1|1314260_1315274_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	53.1	8.0e-96
WP_164482284.1|1315270_1315987_-	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	55.5	1.4e-57
WP_164482286.1|1316123_1316489_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	61.3	3.9e-37
WP_164482287.1|1316485_1317793_-	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	70.7	3.8e-98
WP_164482289.1|1317908_1318340_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_164482290.1|1318349_1319231_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	63.0	1.9e-37
WP_164482292.1|1319227_1319410_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164482294.1|1319697_1320234_-	hypothetical protein	NA	R9TRN6	Vibrio_phage	39.6	2.0e-13
WP_121046849.1|1320259_1320481_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	60.6	9.3e-18
WP_121046936.1|1320566_1321235_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	79.5	4.0e-104
WP_019106222.1|1321671_1321830_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_164482295.1|1322542_1322779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482296.1|1322775_1323369_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	47.8	3.6e-16
WP_164482298.1|1323361_1323577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482300.1|1323569_1323914_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	71.4	4.7e-40
WP_164482301.1|1324174_1325350_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	30.1	2.2e-28
1326953:1327005	attR	GTCATGGGGTGTCAGGGGTCGGAGGTTCAAATCCTCTCGTGCCGACCAAATTA	NA	NA	NA	NA
>prophage 6
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	1644701	1691196	4550072	holin,integrase,terminase,tail	Salmonella_phage(27.91%)	56	1636968:1636983	1696151:1696166
1636968:1636983	attL	CGGCTGCCGCCAGCGG	NA	NA	NA	NA
WP_039339950.1|1644701_1645211_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	34.1	2.4e-08
WP_033740871.1|1645663_1645843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482407.1|1645941_1646715_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_164482408.1|1646801_1647116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482409.1|1647607_1648627_+	alpha/beta hydrolase fold domain-containing protein	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	38.9	4.0e-55
WP_164482410.1|1648999_1649563_-	DUF2514 family protein	NA	A0A193GYI0	Enterobacter_phage	51.1	3.6e-37
WP_164482411.1|1649559_1650075_-	glycoside hydrolase family protein	NA	A0A088FRS5	Escherichia_phage	53.8	3.1e-40
WP_164483218.1|1650058_1650364_-|holin	phage holin family protein	holin	A0A248XD85	Klebsiella_phage	40.6	2.1e-12
WP_164482412.1|1650350_1650764_-	hypothetical protein	NA	T1SA79	Salmonella_phage	41.2	6.0e-18
WP_164482413.1|1650931_1652029_-	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.6	6.3e-22
WP_164482414.1|1652095_1654519_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	60.3	3.1e-77
WP_164482415.1|1654695_1654956_+	hypothetical protein	NA	H2D0F7	Salmonella_phage	39.0	2.9e-10
WP_164482416.1|1655033_1655213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482417.1|1655209_1657939_-	hypothetical protein	NA	Q858F8	Salmonella_phage	74.7	0.0e+00
WP_164482418.1|1657938_1659792_-	hypothetical protein	NA	Q858F9	Salmonella_phage	48.5	1.7e-152
WP_164482419.1|1659791_1662302_-	hypothetical protein	NA	Q858G0	Salmonella_phage	52.6	1.1e-239
WP_164482420.1|1662313_1662886_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	44.2	1.2e-21
WP_164482421.1|1662885_1663350_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	50.0	4.4e-41
WP_164482422.1|1663349_1665824_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	69.5	0.0e+00
WP_164482423.1|1665823_1666429_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	63.7	1.2e-70
WP_164482424.1|1666428_1666755_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	46.4	2.8e-18
WP_164482425.1|1666804_1667212_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	54.6	2.4e-27
WP_164482426.1|1667223_1667661_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	82.1	2.6e-59
WP_164482427.1|1667714_1668701_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	89.9	1.3e-172
WP_164482428.1|1668712_1669420_-	peptidase	NA	G9L6C4	Escherichia_phage	56.9	2.8e-39
WP_164482429.1|1669428_1669878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482430.1|1669877_1670174_-	hypothetical protein	NA	A0A193GYH3	Enterobacter_phage	47.4	2.6e-15
WP_164482431.1|1670170_1671835_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	69.0	9.3e-219
WP_164482432.1|1671850_1672057_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	67.6	2.9e-05
WP_164482433.1|1672831_1673041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482434.1|1673037_1674510_-|terminase	terminase	terminase	A0A193GYS2	Enterobacter_phage	78.7	2.2e-235
WP_164483219.1|1674502_1675042_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	56.1	1.2e-47
WP_164482435.1|1675175_1675448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482436.1|1675511_1675850_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	72.3	1.9e-41
WP_164482298.1|1675842_1676058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482437.1|1676050_1676644_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	38.1	2.0e-14
WP_164482438.1|1676633_1677125_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	49.1	4.8e-38
WP_164482439.1|1677866_1678214_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	65.0	2.0e-35
WP_164482440.1|1678434_1679184_-	replication protein	NA	G9L6A9	Escherichia_phage	51.5	4.5e-64
WP_164482441.1|1679180_1679969_-	Pyocin large subunit	NA	T1SA92	Salmonella_phage	62.8	1.1e-76
WP_164482442.1|1679968_1680178_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	69.1	5.5e-20
WP_164482443.1|1680349_1680577_-	hypothetical protein	NA	Q858D6	Salmonella_phage	47.8	1.1e-10
WP_164482444.1|1680731_1681307_+	helix-turn-helix domain-containing protein	NA	A0A193GYL7	Enterobacter_phage	44.6	5.6e-38
WP_164482445.1|1681786_1681930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482446.1|1681933_1682218_+	host nuclease inhibitor GamL	NA	NA	NA	NA	NA
WP_164482447.1|1682214_1683069_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E5AGE0	Erwinia_phage	71.0	2.1e-118
WP_164482448.1|1683065_1684076_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	77.4	3.8e-90
WP_164482449.1|1684135_1684405_+	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	62.5	4.2e-12
WP_164482450.1|1684407_1684758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482451.1|1684754_1685417_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	69.4	3.7e-94
WP_164482452.1|1685413_1686010_+	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	49.1	5.5e-20
WP_164482453.1|1686006_1686462_+	ASCH domain-containing protein	NA	A0A2H4IB20	Erwinia_phage	48.8	8.4e-29
WP_164482454.1|1686449_1686623_+	MFS transporter permease	NA	NA	NA	NA	NA
WP_164482455.1|1686607_1687864_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	70.8	1.1e-171
WP_006120616.1|1688076_1689657_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_033740877.1|1689729_1691196_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	1.4e-88
1696151:1696166	attR	CGGCTGCCGCCAGCGG	NA	NA	NA	NA
>prophage 7
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	2209380	2284251	4550072	plate,tRNA,holin,tail,lysis	Erwinia_phage(61.29%)	76	NA	NA
WP_006118207.1|2209380_2210394_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	1.1e-105
WP_001144069.1|2210672_2210888_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_164482586.1|2211004_2212750_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	6.8e-71
WP_028723590.1|2213301_2215146_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_164482587.1|2215218_2215734_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_164482588.1|2216624_2216771_-	hypothetical protein	NA	F1BUU3	Erwinia_phage	70.7	2.9e-07
WP_164483224.1|2217073_2217598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110268417.1|2217618_2218059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081316785.1|2218055_2218208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110268437.1|2218452_2218707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039341980.1|2219598_2219790_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_164482589.1|2219928_2220459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033739904.1|2220833_2221055_-	ogr/Delta-like zinc finger family protein	NA	F1BUT0	Erwinia_phage	69.6	3.7e-22
WP_164482590.1|2221128_2222286_-	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	42.4	5.0e-78
WP_164482591.1|2222287_2222791_-|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	70.8	4.0e-56
WP_164482592.1|2222797_2225044_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	40.7	6.5e-66
WP_013027268.1|2225036_2225159_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	61.5	7.4e-09
WP_033739909.1|2225191_2225488_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	72.2	7.1e-29
WP_033739911.1|2225542_2226055_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	84.7	3.3e-82
WP_039341968.1|2226067_2227237_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	89.5	3.6e-201
WP_164482593.1|2227338_2227632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033739914.1|2227644_2228223_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	76.8	1.7e-74
WP_164482594.1|2228284_2228758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482595.1|2228800_2229286_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	33.5	6.6e-16
WP_164482596.1|2229606_2229783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482597.1|2231360_2231969_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	82.2	4.5e-94
WP_033739920.1|2231961_2232870_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	83.4	5.0e-134
WP_058708656.1|2232873_2233224_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	79.3	4.0e-47
WP_033739923.1|2233220_2233805_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	78.9	3.8e-82
WP_133745575.1|2233896_2234367_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.5	1.1e-47
WP_033739927.1|2234453_2234888_-|lysis	phage lysis regulatory protein, LysB family	lysis	F1BUQ1	Erwinia_phage	57.6	8.8e-36
WP_033739928.1|2234884_2235394_-	lysozyme	NA	E5G6N1	Salmonella_phage	65.2	2.8e-57
WP_033739930.1|2235377_2235602_-	hypothetical protein	NA	F1BUQ4	Erwinia_phage	82.4	1.7e-30
WP_033739932.1|2235607_2235811_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	79.1	5.0e-26
WP_072021722.1|2236409_2236604_-	hypothetical protein	NA	F1BUR9	Erwinia_phage	66.7	1.7e-15
WP_033739934.1|2237435_2237846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006118222.1|2240262_2240490_-	TraR/DksA C4-type zinc finger protein	NA	F1BUS2	Erwinia_phage	51.4	1.3e-14
WP_006118223.1|2240489_2240708_-	DUF2732 family protein	NA	F1BUS3	Erwinia_phage	51.4	1.9e-07
WP_033739936.1|2240774_2241143_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	72.2	3.6e-38
WP_006118225.1|2241569_2242154_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	39.7	3.2e-33
WP_006118226.1|2242244_2243789_-	MCP four helix bundle domain-containing protein	NA	NA	NA	NA	NA
WP_058708651.1|2244700_2246629_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_033739939.1|2246908_2247166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033739941.1|2247291_2247489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054633066.1|2247594_2247867_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_033739952.1|2247998_2248268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033739954.1|2248402_2248642_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_164482598.1|2248919_2249225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033739960.1|2249968_2250211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174250618.1|2250818_2252984_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_033739962.1|2253249_2253489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039341927.1|2253882_2255352_-	transcription factor	NA	NA	NA	NA	NA
WP_164482599.1|2255694_2257476_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_164483226.1|2257503_2259081_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.8	1.0e-20
WP_164482600.1|2259603_2260701_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_033739966.1|2260720_2262145_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	2.5e-18
WP_006118229.1|2262408_2263884_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_039341920.1|2263880_2264513_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_039341918.1|2265084_2265894_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_164482601.1|2266003_2266711_+	laccase domain-containing protein	NA	NA	NA	NA	NA
WP_110268779.1|2266880_2268902_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_164482602.1|2268902_2270021_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_006118297.1|2270103_2270607_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_164482603.1|2270603_2272292_-	chloride channel protein	NA	NA	NA	NA	NA
WP_162285863.1|2272426_2273407_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_164482604.1|2273666_2274638_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	36.4	7.5e-35
WP_164483228.1|2274693_2276184_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_164483227.1|2276183_2277635_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_033739988.1|2277637_2279053_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_164482605.1|2279452_2280757_+	MFS transporter	NA	NA	NA	NA	NA
WP_006118304.1|2280844_2281621_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_006118305.1|2281934_2282609_+	DedA family protein	NA	NA	NA	NA	NA
WP_006118306.1|2282605_2282953_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_033739991.1|2283137_2283512_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_006118308.1|2283547_2283853_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_006118309.1|2283855_2284251_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 8
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	2355726	2415972	4550072	protease,tRNA,transposase,integrase,tail	Wolbachia_phage(12.5%)	54	2367955:2367970	2421585:2421600
WP_006120940.1|2355726_2356731_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_164482621.1|2356734_2357967_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_006120942.1|2358144_2359425_-	GTPase HflX	NA	NA	NA	NA	NA
WP_033740039.1|2359500_2359815_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_006120944.1|2359919_2360870_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_054686971.1|2360862_2362707_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	28.7	3.9e-56
WP_006120946.1|2362756_2364433_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	29.0	3.0e-23
WP_033740042.1|2364429_2364906_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_164482622.1|2364902_2366423_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_033740044.1|2366421_2367561_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
2367955:2367970	attL	GCTCTACCAACTGAGC	NA	NA	NA	NA
WP_006120954.1|2368336_2368885_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.4	1.8e-30
WP_164482623.1|2368984_2370034_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_164482624.1|2370126_2371023_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_164482625.1|2371034_2374373_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_164482626.1|2374510_2375449_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_006120962.1|2375985_2376456_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_039341751.1|2376941_2377205_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_006120964.1|2377278_2377551_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_006120965.1|2377645_2377909_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_033740054.1|2378114_2379059_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.2e-72
WP_033740055.1|2379201_2379486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039341745.1|2379541_2380996_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_164482627.1|2381109_2383062_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_033740058.1|2383071_2384004_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_006120970.1|2384011_2384215_-	AaeX family protein	NA	NA	NA	NA	NA
WP_164482628.1|2384444_2385362_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_006120972.1|2385542_2386988_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_164482629.1|2387053_2390881_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_033740062.1|2391014_2392484_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006120975.1|2392485_2393067_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_006120976.1|2393075_2393564_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_006120977.1|2393560_2394583_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003855260.1|2394730_2395774_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_110268752.1|2396083_2398033_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_033740066.1|2398315_2399320_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_164482630.1|2399320_2399923_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_033740114.1|2400144_2400597_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_033740068.1|2400622_2401087_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_039341728.1|2401098_2402448_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_033740072.1|2402520_2402763_+	YhdT family protein	NA	NA	NA	NA	NA
WP_033740073.1|2402752_2404198_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_033740074.1|2404213_2405098_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_033740115.1|2405498_2406464_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003855228.1|2406487_2406784_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_164482631.1|2406859_2409160_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	41.1	1.0e-151
WP_164481809.1|2409176_2409383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482633.1|2409938_2410106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482634.1|2410089_2410425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482635.1|2410427_2411306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482636.1|2412043_2412268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174250619.1|2412277_2413516_-	virulence-associated E family protein	NA	A0A193GYG9	Enterobacter_phage	65.0	3.6e-151
WP_164482638.1|2413962_2414235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482639.1|2414247_2414433_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_164483229.1|2414760_2415972_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	58.1	8.5e-137
2421585:2421600	attR	GCTCTACCAACTGAGC	NA	NA	NA	NA
>prophage 9
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	2606350	2621834	4550072	protease,capsid,integrase,tail,terminase,head,portal	uncultured_Caudovirales_phage(76.92%)	21	2604532:2604546	2626071:2626085
2604532:2604546	attL	CAGGCTGCCATCGGC	NA	NA	NA	NA
WP_164482681.1|2606350_2607580_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	3.0e-129
WP_164482682.1|2607572_2608334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482683.1|2608510_2608813_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_174250621.1|2609080_2609584_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	70.5	1.5e-42
WP_164483231.1|2610428_2610629_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_164482685.1|2610621_2610801_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_164482686.1|2610793_2610985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482687.1|2610977_2611274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164483232.1|2611276_2613391_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.0	6.8e-206
WP_164482688.1|2613741_2614023_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	59.1	9.4e-23
WP_164482689.1|2614062_2614539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164482690.1|2614813_2615980_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	83.8	1.2e-183
WP_164482691.1|2616031_2616592_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	85.5	4.4e-88
WP_164482692.1|2616593_2617811_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	82.0	1.3e-196
WP_164482693.1|2617807_2618146_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	48.6	2.3e-23
WP_164482694.1|2618138_2618441_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	71.9	6.8e-35
WP_164482695.1|2618442_2618880_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	69.2	1.9e-54
WP_164482696.1|2618872_2619013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164482697.1|2619191_2619548_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	89.7	2.6e-54
WP_164482698.1|2619531_2621193_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	86.8	4.1e-291
WP_164483233.1|2621237_2621834_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	67.2	7.8e-67
2626071:2626085	attR	GCCGATGGCAGCCTG	NA	NA	NA	NA
>prophage 10
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	3818354	3828389	4550072		Streptococcus_phage(25.0%)	10	NA	NA
WP_110268574.1|3818354_3819467_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.5	6.9e-109
WP_058702747.1|3819817_3820921_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.0	1.5e-60
WP_006118058.1|3820930_3822184_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.8	1.5e-91
WP_039338546.1|3822543_3823275_+	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	35.6	5.6e-43
WP_072193621.1|3823694_3823973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033738569.1|3824160_3824628_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	44.0	5.6e-28
WP_006118062.1|3824624_3824972_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	42.9	7.1e-20
WP_033738571.1|3824968_3825262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033738573.1|3825461_3827210_+	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	48.0	3.0e-159
WP_033738574.1|3827480_3828389_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.3	1.7e-33
>prophage 11
NZ_CP049115	Pantoea stewartii strain ZJ-FGZX1 chromosome, complete genome	4550072	3886966	3894068	4550072	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_164483017.1|3886966_3888214_-	glucosyl transferase	NA	O22006	Shigella_phage	37.5	3.5e-69
WP_033738636.1|3888203_3889139_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	83.2	1.3e-145
WP_033738784.1|3889141_3889495_-	GtrA family protein	NA	F1C5B1	Cronobacter_phage	66.9	2.6e-38
WP_054634410.1|3889735_3890884_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	2.8e-89
WP_006117993.1|3890883_3891216_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.1	5.7e-11
WP_072021736.1|3891241_3893089_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_006117989.1|3893099_3894068_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.5	2.5e-46
