The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	224505	252617	6874121	integrase,terminase,holin,portal,head,protease	uncultured_Caudovirales_phage(42.11%)	32	215953:215968	225768:225783
215953:215968	attL	TCGATGCGCTGCTGGC	NA	NA	NA	NA
WP_164488220.1|224505_225756_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	68.2	6.0e-162
WP_164488221.1|225727_225958_-	AlpA family phage regulatory protein	NA	B7SYF9	Stenotrophomonas_phage	50.0	2.3e-11
225768:225783	attR	TCGATGCGCTGCTGGC	NA	NA	NA	NA
WP_024767496.1|226253_226532_-	DUF4031 domain-containing protein	NA	A0A0S2SYJ4	Pseudomonas_phage	80.7	1.3e-37
WP_164488223.1|228042_229875_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	36.6	1.8e-90
WP_164488224.1|229871_230942_-	RNA-directed DNA polymerase	NA	H7BUU7	unidentified_phage	35.8	3.7e-43
WP_024767146.1|231264_231627_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_024767145.1|231641_232304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767144.1|232366_232981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767142.1|234378_234858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767141.1|234935_235748_-	DUF2303 family protein	NA	A5LH63	Enterobacteria_phage	42.3	2.6e-49
WP_024767140.1|235790_236138_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	47.2	8.6e-18
WP_024767106.1|236352_236589_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	44.2	3.2e-08
WP_024767139.1|236585_236837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767138.1|236833_237202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767137.1|237198_237483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128082597.1|237493_237838_-	DUF3310 domain-containing protein	NA	A0A221J776	Mycobacterium_phage	57.8	1.7e-13
WP_024767135.1|238344_238554_-	hypothetical protein	NA	A0A2H4JG20	uncultured_Caudovirales_phage	50.7	1.6e-06
WP_079742336.1|238649_239000_-	S24 family peptidase	NA	G9L676	Escherichia_phage	54.1	3.9e-26
WP_024767133.1|239528_239762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767132.1|240262_240766_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	58.7	1.2e-31
WP_024767131.1|240758_240968_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_038803815.1|240964_243703_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.9	0.0e+00
WP_024767130.1|244054_244648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767129.1|244841_245210_+	hypothetical protein	NA	E5FFI2	Burkholderia_phage	39.1	1.6e-09
WP_037007849.1|245202_245493_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_024767127.1|245495_246248_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	48.3	8.9e-44
WP_024766801.1|246488_247082_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	56.8	8.6e-50
WP_024766800.1|247085_249089_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	68.6	5.9e-260
WP_024766799.1|249101_249329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766798.1|249325_250783_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	64.6	2.0e-177
WP_024766797.1|250779_251985_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	46.7	8.6e-81
WP_024766796.1|251981_252617_+|head	head decoration protein	head	NA	NA	NA	NA
>prophage 2
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	261363	271505	6874121		Pseudomonas_phage(50.0%)	10	NA	NA
WP_024766785.1|261363_264915_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	35.5	7.9e-183
WP_024766784.1|264914_265889_+	hypothetical protein	NA	A0A1L2C9I0	Pseudomonas_phage	38.6	1.8e-52
WP_024766783.1|265892_266654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164488291.1|266917_268414_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	34.0	9.4e-45
WP_024766781.1|268413_268650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766780.1|268646_268937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081754084.1|268936_269452_+	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	62.6	2.6e-50
WP_024766778.1|269461_269932_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	47.2	1.5e-17
WP_024766777.1|270156_270456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038803760.1|270818_271505_-	NrdJb	NA	A0A191VYJ2	Roseobacter_phage	39.2	1.9e-29
>prophage 3
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	620764	665289	6874121	tRNA,holin,tail,plate	uncultured_Caudovirales_phage(33.33%)	43	NA	NA
WP_024763614.1|620764_621790_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.4	1.5e-105
WP_024763613.1|621884_622454_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_015475255.1|622534_622888_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_024763612.1|622878_623415_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024763611.1|623529_624759_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	42.6	5.3e-78
WP_024763610.1|624926_625436_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_024763609.1|625494_627048_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_024763608.1|627044_628316_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	2.4e-09
WP_038803509.1|628418_630341_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_024763607.1|630628_630958_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_024763606.1|631001_631826_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	30.7	1.5e-07
WP_024763605.1|631825_632206_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_024763604.1|632202_633030_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_038803510.1|633146_634148_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_089285796.1|634259_635552_-	molecular chaperone SurA	NA	NA	NA	NA	NA
WP_024763603.1|635532_638301_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_024763602.1|638430_639453_+	phosphotransferase	NA	NA	NA	NA	NA
WP_024763601.1|639449_640124_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_024763600.1|640125_640890_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_024763599.1|640891_641944_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_024763598.1|642111_644523_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024763597.1|644592_645222_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024763596.1|645386_646424_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024763595.1|646604_647714_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.0	5.2e-24
WP_024763594.1|647782_648832_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024763593.1|649061_650309_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024763592.1|650322_651150_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038803512.1|651341_652016_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_038803513.1|652015_652834_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_038803514.1|653047_654541_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_024763591.1|654714_655041_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_024763590.1|655162_655933_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	56.7	8.2e-69
WP_024763589.1|656345_656555_+	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	45.2	1.7e-08
WP_024763588.1|656574_656934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763587.1|657015_657489_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024763586.1|657804_658149_+|holin	holin	holin	B5TK61	Pseudomonas_phage	50.0	1.2e-24
WP_024763585.1|658166_658697_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	40.6	4.2e-24
WP_024763584.1|658693_659257_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	59.7	6.7e-44
WP_024763583.1|659366_659693_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	62.0	1.3e-31
WP_024763582.1|659689_660580_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	61.3	4.0e-91
WP_024763581.1|660572_661187_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	59.9	1.2e-62
WP_024763579.1|663612_664773_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.7	3.2e-173
WP_024763578.1|664785_665289_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	67.3	8.6e-59
>prophage 4
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	668639	673943	6874121	tail	Pseudomonas_phage(37.5%)	8	NA	NA
WP_024763574.1|668639_668849_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.8	5.7e-17
WP_024763573.1|668913_669918_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	57.9	7.9e-104
WP_024763572.1|669919_670549_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	63.9	7.9e-70
WP_024763571.1|670545_670902_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	42.1	2.3e-10
WP_024763570.1|670898_671150_+	hypothetical protein	NA	A0A0S2SYC6	Pseudomonas_phage	53.3	8.7e-12
WP_024763569.1|671467_672064_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	1.8e-71
WP_024763568.1|672060_673110_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.5	1.1e-111
WP_024763567.1|673106_673943_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	54.6	4.7e-70
>prophage 5
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	1620750	1643994	6874121	transposase,integrase	Pseudomonas_phage(50.0%)	38	1609744:1609760	1656593:1656609
1609744:1609760	attL	GGCTGGGCAACCGGCGC	NA	NA	NA	NA
WP_024767745.1|1620750_1621488_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	28.7	1.1e-06
WP_024767746.1|1621491_1621686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767747.1|1621694_1622162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767748.1|1622154_1622598_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_024767749.1|1622594_1623005_-	DUF1320 domain-containing protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	44.4	5.2e-22
WP_024767750.1|1623010_1623490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767751.1|1623502_1624420_-	hypothetical protein	NA	L7P7Y9	Pseudomonas_phage	56.1	2.3e-86
WP_024767752.1|1624422_1625442_-	hypothetical protein	NA	A0A2H4J9A2	uncultured_Caudovirales_phage	44.8	3.0e-58
WP_051445743.1|1626046_1626874_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	51.4	1.0e-80
WP_024767754.1|1626870_1628445_-	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	51.9	2.1e-148
WP_152619047.1|1628444_1629932_-	hypothetical protein	NA	A0A2H4JF57	uncultured_Caudovirales_phage	74.2	9.2e-210
WP_024767755.1|1630024_1630537_-	DUF3486 family protein	NA	A0A2H4JD50	uncultured_Caudovirales_phage	78.5	9.6e-66
WP_024767756.1|1630538_1630859_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	75.0	9.7e-40
WP_024767757.1|1630851_1631226_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	46.5	6.4e-19
WP_024767758.1|1631225_1631861_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	44.7	2.4e-05
WP_024767759.1|1631857_1632121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767760.1|1632117_1632621_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	48.8	1.5e-31
WP_024767761.1|1632610_1632955_-	hypothetical protein	NA	L7P853	Pseudomonas_phage	51.5	3.4e-22
WP_037008287.1|1633035_1633473_-	membrane protein	NA	NA	NA	NA	NA
WP_024767763.1|1633469_1633874_-	regulatory protein GemA	NA	A0A2H4J581	uncultured_Caudovirales_phage	51.5	1.0e-30
WP_038803272.1|1633870_1634149_-	hypothetical protein	NA	A0A0A1IX71	Pseudomonas_phage	36.0	1.8e-05
WP_024767764.1|1634156_1634831_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	71.0	4.6e-84
WP_024767765.1|1634906_1635158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767766.1|1635166_1635532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767767.1|1635533_1635752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038803273.1|1635748_1635967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767768.1|1635968_1636241_-	hypothetical protein	NA	A0A0A1IUY5	Pseudomonas_phage	59.1	2.0e-22
WP_037018723.1|1636243_1636861_-	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	71.2	2.2e-80
WP_051445744.1|1636878_1637205_-	hypothetical protein	NA	H6V800	Pseudomonas_virus	58.9	4.0e-25
WP_024767770.1|1637188_1637575_-	hypothetical protein	NA	A0A0U5KQ28	unidentified_phage	58.3	4.7e-33
WP_037008288.1|1638361_1638541_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	73.8	2.5e-21
WP_024767773.1|1638543_1639263_-	AAA family ATPase	NA	A0A2H4J809	uncultured_Caudovirales_phage	66.5	7.9e-90
WP_024767774.1|1639280_1641326_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	58.1	6.7e-227
WP_051445745.1|1641383_1641890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128082624.1|1642076_1642316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767776.1|1642312_1642756_-	hypothetical protein	NA	A0A0A1IVF5	Pseudomonas_phage	65.3	6.9e-44
WP_024767777.1|1642758_1643097_-	transcriptional regulator	NA	A0A0A1IVZ1	Pseudomonas_phage	62.2	1.9e-25
WP_024767778.1|1643277_1643994_+	helix-turn-helix transcriptional regulator	NA	A0SML1	Pseudomonas_virus	61.8	5.5e-75
1656593:1656609	attR	GGCTGGGCAACCGGCGC	NA	NA	NA	NA
>prophage 6
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	2014362	2022150	6874121		uncultured_Mediterranean_phage(16.67%)	7	NA	NA
WP_088418250.1|2014362_2014998_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	54.1	2.4e-42
WP_128082570.1|2015128_2015920_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	46.9	2.7e-14
WP_038803400.1|2016015_2017020_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	7.0e-36
WP_015476292.1|2017451_2017775_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_024765301.1|2017840_2020381_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.0	2.3e-27
WP_024765300.1|2020496_2021009_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	71.8	2.5e-53
WP_038803401.1|2021094_2022150_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.6	2.0e-113
>prophage 7
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	2299900	2314209	6874121	integrase	Pseudomonas_phage(50.0%)	22	2297163:2297177	2315128:2315142
2297163:2297177	attL	CGCCTTCTTCGAGAA	NA	NA	NA	NA
WP_003090661.1|2299900_2300203_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.0e-11
WP_015476661.1|2300183_2300540_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024763166.1|2300786_2301965_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	74.0	9.7e-170
WP_024763167.1|2302357_2302855_-	methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	61.7	1.0e-56
WP_024763169.1|2303393_2303609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128082485.1|2303605_2303863_-	hypothetical protein	NA	A0A0S2SY42	Pseudomonas_phage	46.3	8.1e-05
WP_024763171.1|2303903_2304182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763172.1|2304174_2304717_-	hypothetical protein	NA	A0A0S2SYB5	Pseudomonas_phage	36.8	6.5e-12
WP_024763173.1|2304716_2306621_-	hypothetical protein	NA	A0A2P1JUF9	Erwinia_phage	49.5	5.3e-16
WP_024763174.1|2306617_2306842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763175.1|2306838_2307039_-	hypothetical protein	NA	A0A0S2SYC2	Pseudomonas_phage	62.7	9.0e-12
WP_024763176.1|2307016_2307709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763177.1|2307765_2308245_-	single-stranded DNA-binding protein	NA	A0A0U4K5C0	Pseudomonas_phage	81.3	4.2e-55
WP_024763178.1|2308241_2308883_-	YqaJ viral recombinase family protein	NA	R9TG13	Synechococcus_phage	41.2	4.8e-30
WP_024763179.1|2308863_2309709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763180.1|2309738_2310806_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	77.2	8.2e-43
WP_157837640.1|2310990_2311131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128082490.1|2311235_2311625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763181.1|2311687_2312473_-	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	66.7	9.3e-60
WP_024763182.1|2312597_2312807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763183.1|2312803_2313118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763184.1|2313114_2314209_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	34.0	1.8e-48
2315128:2315142	attR	CGCCTTCTTCGAGAA	NA	NA	NA	NA
>prophage 8
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	2318547	2353147	6874121	tail,terminase,capsid,portal,head	Pseudomonas_phage(65.52%)	50	NA	NA
WP_024763190.1|2318547_2319063_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	55.5	1.5e-26
WP_037006712.1|2319087_2319852_-	helix-turn-helix domain-containing protein	NA	B5TK58	Pseudomonas_phage	55.2	2.6e-67
WP_024763192.1|2319957_2320173_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024763193.1|2320465_2320663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763194.1|2320844_2321438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051445574.1|2321439_2321643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763195.1|2321646_2321994_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024763196.1|2321990_2322695_+	helix-turn-helix domain-containing protein	NA	A0A127KNX8	Pseudomonas_phage	46.6	2.7e-26
WP_024763197.1|2322687_2324076_+	replicative DNA helicase	NA	A0A127KNK8	Pseudomonas_phage	50.9	4.4e-121
WP_024763198.1|2324068_2324272_+	conjugal transfer protein TraR	NA	H2BDI2	Pseudomonas_virus	66.2	5.0e-18
WP_024763199.1|2324264_2324624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157837643.1|2324735_2324900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763200.1|2324892_2325294_+	NinB family protein	NA	A0A059VG13	Pseudomonas_phage	52.8	1.1e-32
WP_024763201.1|2325290_2325593_+	DUF1364 family protein	NA	A0A1J0GVP4	Pseudoalteromonas_phage	50.5	2.2e-17
WP_024763202.1|2325589_2326483_+	HNH endonuclease	NA	B4UTX2	Rhizobium_phage	38.5	2.0e-13
WP_024763203.1|2326565_2326814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763204.1|2326813_2327053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160297873.1|2327077_2327239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763205.1|2327235_2327436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763206.1|2327432_2327816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763207.1|2328144_2329332_+	hypothetical protein	NA	A0A2I7QJB2	Vibrio_phage	52.7	5.1e-110
WP_024763208.1|2329354_2329732_+	hypothetical protein	NA	W6MVN8	Pseudomonas_phage	68.3	2.3e-40
WP_128082486.1|2329728_2330025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038803433.1|2330303_2330690_+	hypothetical protein	NA	W6MYB2	Pseudomonas_phage	64.8	1.2e-39
WP_037006714.1|2330700_2330937_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	65.8	1.4e-24
WP_157837645.1|2330936_2331098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763211.1|2331097_2331505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051445577.1|2331565_2331775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763213.1|2331774_2332110_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_128082487.1|2332209_2332611_+	hypothetical protein	NA	C4ML02	Xanthomonas_virus	47.8	7.9e-07
WP_038803429.1|2332612_2334271_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	69.2	2.6e-229
WP_024763215.1|2334465_2336439_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	44.7	7.6e-135
WP_024763216.1|2336502_2336745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763217.1|2336754_2338128_+|portal	phage portal protein	portal	B5WZS2	Pseudomonas_phage	82.6	1.6e-203
WP_024763218.1|2338124_2339081_+	hypothetical protein	NA	B5WZS3	Pseudomonas_phage	66.3	2.0e-72
WP_024763219.1|2339080_2339455_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B5WZS4	Pseudomonas_phage	89.5	1.5e-55
WP_024763220.1|2339729_2340071_+|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	86.7	4.3e-54
WP_024763221.1|2340070_2340631_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	72.8	1.7e-79
WP_024763222.1|2341251_2342064_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	79.3	8.0e-131
WP_081753957.1|2342014_2342626_+	methyltransferase domain-containing protein	NA	B5WZS8	Pseudomonas_phage	70.8	1.8e-87
WP_024763224.1|2342618_2343065_+	hypothetical protein	NA	B5WZS9	Pseudomonas_phage	83.1	4.8e-53
WP_081753958.1|2343064_2343436_+	DUF3168 domain-containing protein	NA	B5WZT0	Pseudomonas_phage	81.3	2.3e-53
WP_024763225.1|2343624_2344119_+	hypothetical protein	NA	A0A1U9GN34	Vibrio_phage	54.8	6.3e-46
WP_024763226.1|2344128_2344491_+	hypothetical protein	NA	B5WZT2	Pseudomonas_phage	65.8	1.3e-40
WP_024763227.1|2344568_2344799_+	hypothetical protein	NA	B5WZT3	Pseudomonas_phage	66.2	2.6e-23
WP_024763228.1|2344810_2347831_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.9	5.4e-116
WP_024763229.1|2347830_2348706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081753959.1|2348760_2349648_+	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_024763231.1|2349644_2350076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763232.1|2350072_2353147_+	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	29.0	6.0e-46
>prophage 9
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	2517101	2646259	6874121	integrase,terminase,tail,plate,holin,capsid,portal,head,protease,tRNA	Pseudomonas_virus(33.73%)	139	2525230:2525256	2608462:2608488
WP_024765725.1|2517101_2517713_+|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_024765726.1|2517870_2519199_-|protease	membrane protease subunit, stomatin/prohibitin	protease	A0A0F6WCV7	Sinorhizobium_phage	28.3	8.1e-40
WP_024765727.1|2519323_2520046_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024765728.1|2520050_2520557_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	36.0	1.2e-15
WP_038803694.1|2520678_2522361_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	61.2	3.4e-200
WP_024765729.1|2522364_2523753_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	35.7	5.1e-45
WP_038803695.1|2523817_2524672_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.2	3.5e-28
2525230:2525256	attL	GAGTTCGAGTCTCTCCGTCCGCACCAT	NA	NA	NA	NA
WP_164488241.1|2525417_2526668_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	68.2	7.9e-162
WP_164488242.1|2526639_2526870_-	AlpA family phage regulatory protein	NA	B7SYF9	Stenotrophomonas_phage	48.5	6.8e-11
WP_024767484.1|2526866_2527169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767483.1|2527165_2527414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767482.1|2527394_2528123_-	hypothetical protein	NA	A0A0S2SYB5	Pseudomonas_phage	49.4	1.2e-24
WP_164488243.1|2529287_2531120_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	36.8	2.4e-90
WP_164488244.1|2531116_2532187_-	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	33.4	4.4e-44
WP_024767099.1|2532509_2532872_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_024767100.1|2532886_2533549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767101.1|2533611_2534226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767103.1|2535623_2536103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767104.1|2536178_2536991_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	44.9	2.0e-49
WP_024767105.1|2537038_2537386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767106.1|2537602_2537839_-	transcriptional regulator	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	44.2	3.2e-08
WP_024767107.1|2537835_2538087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767108.1|2538083_2538452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767109.1|2538448_2538733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128082595.1|2538743_2539088_-	DUF3310 domain-containing protein	NA	A0A221J776	Mycobacterium_phage	57.8	1.7e-13
WP_024767111.1|2539594_2539804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160297878.1|2539948_2540788_-	helix-turn-helix domain-containing protein	NA	A0A2H4J8A8	uncultured_Caudovirales_phage	51.8	3.9e-64
WP_024767113.1|2540809_2541064_+	hypothetical protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	57.5	5.9e-16
WP_024767114.1|2541223_2541727_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	57.9	2.0e-31
WP_024767115.1|2541719_2541929_+	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	57.8	9.5e-12
WP_024767116.1|2541925_2542606_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	55.0	2.0e-58
WP_164488245.1|2542602_2545347_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.5	0.0e+00
WP_024767117.1|2545687_2546281_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	48.1	3.4e-22
WP_024767118.1|2546472_2546841_+	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	33.1	3.3e-07
WP_037007819.1|2546833_2547124_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_024767120.1|2547126_2547879_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	48.8	5.2e-44
WP_024766801.1|2548119_2548713_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	56.8	8.6e-50
WP_024766800.1|2548716_2550720_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	68.6	5.9e-260
WP_024766799.1|2550732_2550960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766798.1|2550956_2552414_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	64.6	2.0e-177
WP_024766797.1|2552410_2553616_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	46.7	8.6e-81
WP_024766796.1|2553612_2554248_+|head	head decoration protein	head	NA	NA	NA	NA
WP_024766795.1|2554319_2555318_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	57.8	3.0e-111
WP_024766794.1|2555320_2555635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766793.1|2555631_2556069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766792.1|2556113_2556335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766791.1|2556367_2557120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128082588.1|2557202_2557745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052239123.1|2557981_2558494_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_024766788.1|2558551_2562208_+	hypothetical protein	NA	B7SYE7	Stenotrophomonas_phage	30.9	2.3e-44
WP_024766787.1|2562213_2562612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766786.1|2562625_2562931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766785.1|2562995_2566547_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	35.5	7.9e-183
WP_024766784.1|2566546_2567521_+	hypothetical protein	NA	A0A1L2C9I0	Pseudomonas_phage	38.6	1.8e-52
WP_024766783.1|2567524_2568286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164488291.1|2568549_2570046_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	34.0	9.4e-45
WP_024766781.1|2570045_2570282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766780.1|2570278_2570569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081754084.1|2570568_2571084_+	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	62.6	2.6e-50
WP_024766778.1|2571093_2571564_+	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	47.2	1.5e-17
WP_024766777.1|2571788_2572088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763238.1|2572591_2573758_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	69.9	7.1e-165
WP_164488246.1|2573848_2574025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763239.1|2574021_2574642_-	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	52.6	3.0e-53
WP_024763240.1|2574634_2576365_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	63.9	5.9e-192
WP_024763241.1|2576354_2576552_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	74.6	2.0e-19
WP_024763242.1|2576544_2577102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763243.1|2577161_2578121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763244.1|2578186_2578543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763245.1|2578527_2578983_-	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	30.1	1.7e-05
WP_024763246.1|2579033_2579864_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	31.2	7.1e-26
WP_038803139.1|2579909_2582633_-	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	85.4	0.0e+00
WP_024763247.1|2582629_2582866_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	66.2	3.5e-23
WP_024763248.1|2583015_2583315_-	transcriptional regulator	NA	Q9ZXJ1	Pseudomonas_virus	59.3	4.8e-25
WP_024763249.1|2583311_2583785_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	58.9	1.4e-47
WP_024763250.1|2583815_2584028_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	52.2	9.9e-09
WP_024763251.1|2584114_2584453_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	41.0	5.1e-15
WP_157837648.1|2584670_2584847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763252.1|2584981_2585422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037006764.1|2585422_2586688_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	77.5	1.7e-180
WP_024763254.1|2586684_2587125_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	72.6	9.8e-59
WP_024763255.1|2587131_2589696_-	hypothetical protein	NA	A4PE52	Ralstonia_virus	46.6	4.0e-176
WP_024763256.1|2589685_2589805_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	87.2	7.0e-12
WP_024763257.1|2589813_2590161_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	63.9	2.3e-26
WP_024763258.1|2590241_2590757_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	70.2	1.1e-64
WP_024763259.1|2590812_2591985_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	75.8	2.8e-169
WP_024763260.1|2592086_2592455_-	DUF1353 domain-containing protein	NA	A0A2H4JDM4	uncultured_Caudovirales_phage	65.5	1.5e-39
WP_024763261.1|2592451_2592958_-	DUF4376 domain-containing protein	NA	A0A1S5R1J2	Pseudomonas_phage	54.9	4.8e-25
WP_024763262.1|2592968_2594621_-|tail	tail protein	tail	A0A077K818	Ralstonia_phage	53.4	4.6e-77
WP_024763263.1|2594611_2595238_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	73.2	8.4e-72
WP_024763264.1|2595237_2596152_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	77.6	6.7e-126
WP_024763265.1|2596148_2596490_-|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	68.1	1.3e-39
WP_024763266.1|2596486_2597059_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	69.5	1.8e-57
WP_024763267.1|2597120_2597579_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	68.0	1.2e-51
WP_024763268.1|2597571_2598105_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	58.4	2.4e-51
WP_162483997.1|2598088_2598232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763269.1|2598206_2598650_-	peptidase	NA	Q9ZXL5	Pseudomonas_virus	57.2	4.0e-28
WP_024763270.1|2598646_2598850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763271.1|2598921_2599758_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	64.3	9.5e-87
WP_017519566.1|2599754_2600027_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	71.9	1.9e-28
WP_017519565.1|2600028_2600382_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	65.5	6.5e-37
WP_024763272.1|2600403_2600616_-|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	68.6	8.7e-21
WP_024763273.1|2600615_2601080_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	53.2	1.9e-36
WP_024763274.1|2601183_2601993_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	67.0	3.3e-76
WP_024763275.1|2602004_2603018_-|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	68.2	4.9e-130
WP_024763276.1|2603054_2603906_-|capsid	GPO family capsid scaffolding protein	capsid	V9IQG8	Stenotrophomonas_phage	62.1	5.2e-56
WP_024763277.1|2604057_2605818_+|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	87.7	1.6e-293
WP_024763278.1|2605817_2606867_+|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	76.2	7.1e-148
WP_024763279.1|2607011_2607671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763280.1|2608629_2609940_+	trigger factor	NA	NA	NA	NA	NA
2608462:2608488	attR	GAGTTCGAGTCTCTCCGTCCGCACCAT	NA	NA	NA	NA
WP_024763281.1|2610033_2610672_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.0	4.6e-57
WP_017519553.1|2610779_2612060_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.8	1.6e-138
WP_024763282.1|2612193_2614590_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	1.7e-221
WP_003087931.1|2614726_2614999_+	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	60.7	2.5e-20
WP_024763283.1|2615226_2617116_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_038803140.1|2617205_2618003_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_024763284.1|2618026_2619637_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.9e-19
WP_038803141.1|2619638_2620658_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024763285.1|2620662_2621745_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_024763286.1|2621744_2623610_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024763287.1|2623606_2625436_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024763288.1|2625553_2627176_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	25.8	1.5e-08
WP_024763289.1|2627255_2628050_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024763290.1|2628139_2628895_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024763291.1|2628906_2629350_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.5	9.6e-38
WP_037011876.1|2629422_2630160_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.8	8.8e-36
WP_024763292.1|2630367_2632620_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_024763293.1|2632726_2634913_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.7	3.2e-17
WP_024763294.1|2635105_2636449_+	amino acid permease	NA	NA	NA	NA	NA
WP_024763295.1|2636687_2637500_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024763296.1|2637542_2639216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037006768.1|2639215_2640055_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_024763298.1|2640079_2640862_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_024763299.1|2641020_2641665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024763300.1|2641754_2642522_-	SDR family oxidoreductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	34.5	8.1e-08
WP_024763301.1|2642550_2643618_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_017519529.1|2643937_2644249_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024763302.1|2644308_2645019_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024763303.1|2645230_2646259_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	30.3	5.0e-21
>prophage 10
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	2933366	2974748	6874121	tail,integrase,holin,head,transposase	Pseudomonas_phage(91.67%)	55	2947827:2947842	2978513:2978528
WP_024762357.1|2933366_2935025_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.7	1.3e-58
WP_024762356.1|2935034_2936057_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_037006496.1|2936321_2936798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762354.1|2936810_2937605_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	90.9	7.3e-145
WP_081753927.1|2937574_2937766_-	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	71.4	2.1e-18
WP_024762353.1|2937910_2940085_-	hypothetical protein	NA	A0A076FWY8	Pseudomonas_phage	65.3	8.1e-271
WP_024762352.1|2940074_2940290_-	hypothetical protein	NA	L7P7U5	Pseudomonas_phage	77.5	5.3e-26
WP_024762351.1|2940286_2940517_-	hypothetical protein	NA	A0A076FRB9	Pseudomonas_phage	73.6	3.5e-23
WP_024762350.1|2940525_2941347_-	DUF2163 domain-containing protein	NA	L7P7Q2	Pseudomonas_phage	63.7	4.6e-102
WP_052239070.1|2941336_2943040_-	hypothetical protein	NA	A0A125RNJ2	Pseudomonas_phage	60.2	1.2e-181
WP_024762349.1|2943039_2943930_-	hypothetical protein	NA	A0A060RFL0	Pseudomonas_phage	36.1	1.3e-46
WP_024762348.1|2943929_2944784_-	hypothetical protein	NA	H6WU10	Pseudomonas_phage	45.6	3.5e-68
WP_024762347.1|2944793_2948735_-|tail	phage tail tape measure protein	tail	A0A0S4L7E6	Pseudomonas_phage	61.7	3.2e-294
2947827:2947842	attL	GCCGGCGCTCATGCCG	NA	NA	NA	NA
WP_164488252.1|2948821_2948965_-	hypothetical protein	NA	J9SN84	Pseudomonas_phage	63.0	3.1e-06
WP_024762346.1|2948964_2949468_-	hypothetical protein	NA	J9STK7	Pseudomonas_phage	63.5	1.9e-58
WP_038803167.1|2949470_2950226_-	hypothetical protein	NA	Q5ZQX2	Pseudomonas_phage	78.2	1.2e-109
WP_024762345.1|2950229_2950439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037006495.1|2950441_2950888_-	bacteriophage protein	NA	J9SH57	Pseudomonas_phage	83.8	2.6e-67
WP_024762344.1|2950884_2951400_-	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	87.1	2.8e-81
WP_037006514.1|2951402_2951645_-	hypothetical protein	NA	J9STT1	Pseudomonas_phage	72.5	8.7e-25
WP_024762342.1|2951980_2952874_-|head	phage head protein	head	J9SVY7	Pseudomonas_phage	82.8	2.4e-144
WP_024762341.1|2952888_2953293_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	88.1	4.0e-59
WP_164488253.1|2953298_2954408_-	hypothetical protein	NA	J9SH47	Pseudomonas_phage	80.8	1.5e-164
WP_024762340.1|2954618_2955194_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	77.0	2.3e-84
WP_024762339.1|2955196_2956438_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	76.5	1.8e-190
WP_128082464.1|2956427_2957954_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	85.5	2.0e-252
WP_024762337.1|2958001_2959675_-	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	91.7	1.2e-303
WP_024762336.1|2959676_2960225_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	71.8	7.9e-58
WP_038803168.1|2960227_2960530_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	97.0	3.5e-47
WP_024762335.1|2960526_2960847_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	90.5	1.9e-43
WP_024762334.1|2960846_2961464_-	hypothetical protein	NA	J9SVX5	Pseudomonas_phage	73.1	2.0e-73
WP_024762333.1|2961450_2961654_-	hypothetical protein	NA	J9RWE5	Pseudomonas_phage	66.0	3.3e-09
WP_024762332.1|2961650_2961893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762331.1|2961889_2962519_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	79.9	3.2e-95
WP_037006513.1|2962521_2962824_-	membrane protein	NA	Q5ZQZ2	Pseudomonas_phage	58.8	1.3e-22
WP_128082462.1|2962974_2963466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762328.1|2963540_2964149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762327.1|2964152_2964569_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	63.4	6.3e-31
WP_024762326.1|2964664_2964871_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	82.4	4.8e-24
WP_024762325.1|2964882_2965374_+	hypothetical protein	NA	J9SGQ9	Pseudomonas_phage	74.2	1.3e-56
WP_024762324.1|2965501_2965987_+	hypothetical protein	NA	A4JWN5	Burkholderia_virus	58.9	1.7e-51
WP_024762323.1|2965979_2966240_+	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	70.9	9.3e-25
WP_024762322.1|2966236_2966545_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	65.0	3.3e-29
WP_081753925.1|2966631_2967528_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	65.9	1.2e-95
WP_038803169.1|2967531_2969307_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	71.9	5.4e-249
WP_024762320.1|2969306_2970485_+	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	78.8	5.9e-167
WP_128082463.1|2970591_2970816_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	54.8	2.7e-12
WP_051445541.1|2970812_2971097_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	76.1	1.6e-30
WP_037006511.1|2971222_2971576_+	hypothetical protein	NA	A0A0S4L050	Pseudomonas_phage	55.2	3.6e-27
WP_024762316.1|2971568_2972201_+	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	55.5	5.7e-60
WP_024762315.1|2972202_2972892_+	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	90.0	2.2e-113
WP_024762314.1|2972845_2973613_+	HNH endonuclease	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	39.5	3.9e-18
WP_024762313.1|2973596_2973809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024762312.1|2973808_2974369_+	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	82.3	4.0e-81
WP_024762311.1|2974379_2974748_+	hypothetical protein	NA	J9SGX4	Pseudomonas_phage	90.5	1.0e-53
2978513:2978528	attR	CGGCATGAGCGCCGGC	NA	NA	NA	NA
>prophage 11
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	3098665	3105317	6874121		uncultured_Caudovirales_phage(83.33%)	8	NA	NA
WP_024762772.1|3098665_3100000_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.0	3.2e-44
WP_038803179.1|3099996_3100881_-	DMT family transporter	NA	NA	NA	NA	NA
WP_024762773.1|3101102_3101852_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024762774.1|3101897_3102443_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	74.8	1.2e-61
WP_024762775.1|3102450_3103152_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	79.0	1.4e-104
WP_024762776.1|3103164_3103635_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	71.8	4.7e-59
WP_024762777.1|3103664_3104948_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.4	3.2e-174
WP_024762778.1|3104969_3105317_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	65.5	2.4e-36
>prophage 12
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	3669054	3715800	6874121	tail,terminase,integrase,capsid	Burkholderia_phage(25.53%)	64	3668774:3668829	3715883:3715938
3668774:3668829	attL	TGGTGCCCGGAGCCGGACTCGAACCGGCACGCCCAAAGGGCGAGAGATTTTAAGTC	NA	NA	NA	NA
WP_024767163.1|3669054_3669573_+	hypothetical protein	NA	Q5QF67	Pseudomonas_virus	40.7	1.7e-25
WP_024767162.1|3669576_3670266_+	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_024767161.1|3670267_3670537_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	58.8	2.6e-06
WP_024767160.1|3670533_3670947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767159.1|3670943_3671387_-	structural protein P5	NA	A0A2R3UAM8	Myoviridae_environmental_samples	57.9	3.3e-38
WP_164488259.1|3671469_3671892_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	40.2	5.1e-12
WP_051445735.1|3671980_3672184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767335.1|3672788_3674627_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	66.7	6.1e-86
WP_024767336.1|3674630_3675809_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	67.2	2.8e-137
WP_024767337.1|3675809_3676163_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	61.5	4.2e-36
WP_051445729.1|3676159_3676822_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	58.4	1.2e-60
WP_024767339.1|3676851_3677226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767340.1|3677222_3678206_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	58.1	7.7e-88
WP_024767341.1|3678733_3679048_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	43.4	9.5e-16
WP_024767342.1|3679040_3679646_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	43.2	4.0e-26
WP_052239127.1|3679647_3681363_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.8	1.3e-34
WP_164488218.1|3681363_3681522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164488260.1|3681557_3681998_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	33.1	2.8e-13
WP_024767525.1|3682066_3682615_+	hypothetical protein	NA	G0ZNE5	Cronobacter_phage	38.1	2.1e-18
WP_164488261.1|3682611_3683052_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	60.3	1.6e-40
WP_024767478.1|3683066_3684548_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	59.8	7.7e-156
WP_038803827.1|3684565_3685117_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	58.6	4.0e-57
WP_024767477.1|3685120_3685495_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	69.4	2.3e-40
WP_164488262.1|3685499_3686069_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	43.6	2.8e-29
WP_024767383.1|3686065_3686449_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	58.3	5.4e-37
WP_157837686.1|3686452_3686629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767382.1|3686638_3687637_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	68.0	2.2e-122
WP_038803823.1|3687650_3688145_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	53.7	1.8e-37
WP_024767381.1|3688155_3689454_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	41.8	1.1e-60
WP_024767380.1|3689450_3690239_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	58.9	1.9e-73
WP_082032848.1|3690174_3691650_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	58.6	4.8e-150
WP_024767378.1|3691649_3693080_-|terminase	phage terminase large subunit	terminase	A0A223LHF4	Pseudoalteromonas_phage	54.6	3.3e-140
WP_024767377.1|3693082_3693637_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	72.4	5.7e-64
WP_024767376.1|3693649_3693946_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	62.1	4.9e-22
WP_164488263.1|3693951_3694260_-	peptidase M48, Ste24p	NA	A0A125RNL3	Pseudomonas_phage	56.0	5.3e-19
WP_024767303.1|3694330_3694810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767304.1|3694903_3695494_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	52.2	1.5e-57
WP_024767305.1|3695490_3695913_-	VRR-NUC domain-containing protein	NA	A0A1J0GWD9	Alteromonas_phage	48.3	8.3e-23
WP_081754105.1|3695922_3697320_-	AAA family ATPase	NA	A0A1S6UAW9	Serratia_phage	28.4	3.6e-30
WP_024767307.1|3697586_3699839_-	hypothetical protein	NA	A0A173H0P8	Pseudoalteromonas_phage	24.7	2.3e-47
WP_024767308.1|3699838_3700147_-	hypothetical protein	NA	Q37905	Pseudomonas_phage	91.2	8.1e-44
WP_024767309.1|3700149_3700350_-	hypothetical protein	NA	A0A0U1UNM4	Pseudomonas_phage	68.3	6.7e-15
WP_051445727.1|3700458_3700920_+	helix-turn-helix transcriptional regulator	NA	A0A0U4JEE2	Pseudomonas_phage	55.4	1.7e-21
WP_024767310.1|3700900_3701368_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	33.8	1.5e-12
WP_024767311.1|3701360_3702299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164488264.1|3702989_3704018_+	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	91.1	1.8e-66
WP_128082600.1|3704031_3704217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081754104.1|3704213_3704408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767227.1|3704391_3704772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767226.1|3704773_3705556_+	ATP-binding protein	NA	A0A1B1INN1	uncultured_Mediterranean_phage	42.3	9.9e-46
WP_024767225.1|3705570_3706065_+	DUF669 domain-containing protein	NA	A0A140XG95	Salmonella_phage	47.0	8.2e-30
WP_024767224.1|3706073_3707117_+	hypothetical protein	NA	A0A1B1INT1	uncultured_Mediterranean_phage	45.1	7.2e-60
WP_024767223.1|3707113_3708784_+	DEAD/DEAH box helicase	NA	A0A0R6PL06	Moraxella_phage	36.3	4.8e-90
WP_157837683.1|3708916_3709081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767222.1|3709140_3711159_+	DNA methyltransferase	NA	A0A140IES2	Pseudomonas_phage	69.0	1.2e-268
WP_024767221.1|3711173_3711455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038803803.1|3711543_3711954_+	hypothetical protein	NA	J9SNQ5	Pseudomonas_phage	54.9	4.7e-31
WP_024767220.1|3711950_3712502_+	hypothetical protein	NA	I6NP82	Burkholderia_phage	34.3	1.2e-18
WP_038803804.1|3712498_3713119_+	hypothetical protein	NA	A0A2I7RF87	Vibrio_phage	29.4	1.8e-10
WP_024767218.1|3713207_3713405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767217.1|3713408_3714203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767216.1|3714202_3714436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767215.1|3714556_3714769_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_024767214.1|3714768_3715800_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	55.1	3.0e-98
3715883:3715938	attR	TGGTGCCCGGAGCCGGACTCGAACCGGCACGCCCAAAGGGCGAGAGATTTTAAGTC	NA	NA	NA	NA
>prophage 13
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	3721890	3775357	6874121	tail,terminase,integrase,capsid,tRNA	Pseudomonas_phage(31.58%)	81	3716920:3716937	3775039:3775056
3716920:3716937	attL	GCAGGTTCGGGATATTCA	NA	NA	NA	NA
WP_024767423.1|3721890_3722160_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	69.8	1.1e-07
WP_024767424.1|3722156_3722564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767425.1|3722560_3723004_-	structural protein P5	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	60.0	1.0e-39
WP_164488259.1|3723086_3723509_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	40.2	5.1e-12
WP_164488265.1|3723597_3723801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063831034.1|3724405_3726244_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	67.6	5.5e-87
WP_024767326.1|3726247_3727426_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	66.2	9.1e-136
WP_024767327.1|3727426_3727780_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	62.4	1.4e-36
WP_024767328.1|3727776_3728457_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	58.0	5.9e-63
WP_128082601.1|3728468_3728861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767329.1|3728857_3729841_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	56.1	1.1e-89
WP_024767330.1|3729870_3730374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767331.1|3730370_3730685_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	42.4	3.6e-15
WP_024767332.1|3730677_3731283_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	44.4	4.7e-27
WP_024767333.1|3731284_3733021_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.8	3.0e-34
WP_157837684.1|3733021_3733192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164488266.1|3733215_3733656_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	32.4	7.4e-14
WP_024767525.1|3733724_3734273_+	hypothetical protein	NA	G0ZNE5	Cronobacter_phage	38.1	2.1e-18
WP_164488267.1|3734269_3734710_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	60.3	1.2e-40
WP_038803829.1|3734724_3736206_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	60.4	3.1e-157
WP_038803828.1|3736223_3736775_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	57.5	3.7e-55
WP_024767486.1|3736778_3737153_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	70.4	7.8e-41
WP_164488268.1|3737157_3737721_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	40.6	1.4e-25
WP_024767383.1|3737717_3738101_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	58.3	5.4e-37
WP_157837686.1|3738104_3738281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767382.1|3738290_3739289_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	68.0	2.2e-122
WP_038803823.1|3739302_3739797_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	53.7	1.8e-37
WP_024767381.1|3739807_3741106_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	41.8	1.1e-60
WP_024767380.1|3741102_3741891_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	58.9	1.9e-73
WP_082032848.1|3741826_3743302_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	58.6	4.8e-150
WP_024767378.1|3743301_3744732_-|terminase	phage terminase large subunit	terminase	A0A223LHF4	Pseudoalteromonas_phage	54.6	3.3e-140
WP_024767377.1|3744734_3745289_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	72.4	5.7e-64
WP_024767376.1|3745301_3745598_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	62.1	4.9e-22
WP_164488269.1|3745603_3745927_-	peptidase M48, Ste24p	NA	A0A125RNL3	Pseudomonas_phage	74.5	9.1e-38
WP_051445667.1|3746042_3746345_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	74.7	1.4e-35
WP_051445666.1|3746295_3746913_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	88.3	1.5e-97
WP_024765191.1|3746941_3747385_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	90.5	6.6e-71
WP_157837664.1|3747381_3747549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051445665.1|3747545_3748289_-	hypothetical protein	NA	A0A2H4J1T4	uncultured_Caudovirales_phage	44.5	1.8e-20
WP_024765188.1|3749117_3749375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765187.1|3749393_3749702_-	hypothetical protein	NA	A0A2H4J960	uncultured_Caudovirales_phage	71.7	2.1e-36
WP_024765186.1|3749704_3749947_-	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	90.0	9.5e-32
WP_024765185.1|3750059_3750710_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTC8	Pseudomonas_phage	60.1	2.5e-50
WP_051445668.1|3750967_3751192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765183.1|3751294_3751546_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_024765182.1|3752149_3752569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765180.1|3752875_3753145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765179.1|3753113_3753296_+	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	86.4	9.7e-21
WP_024765178.1|3753288_3753615_+	hypothetical protein	NA	Q9MC68	Pseudomonas_phage	47.8	4.4e-16
WP_024765177.1|3753752_3754559_+	hypothetical protein	NA	H2BD50	Pseudomonas_phage	90.3	2.9e-141
WP_024765176.1|3754567_3754783_+	hypothetical protein	NA	J7I4L3	Pseudomonas_phage	83.1	9.7e-28
WP_024765175.1|3754779_3755703_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	88.2	1.0e-134
WP_024765174.1|3755709_3755910_+	hypothetical protein	NA	J7I437	Pseudomonas_phage	87.9	5.5e-25
WP_038803604.1|3755922_3756690_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	76.5	5.1e-119
WP_024765173.1|3756693_3757281_+	hypothetical protein	NA	A0A2I7QWC6	Vibrio_phage	45.7	1.4e-23
WP_024765172.1|3757280_3759023_+	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	68.7	2.3e-212
WP_024765171.1|3759071_3759299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765170.1|3759295_3759757_+	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	62.7	1.6e-51
WP_038803605.1|3759787_3760405_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_024765168.1|3760492_3761101_+	DUF1566 domain-containing protein	NA	A0A2I6PHV1	Pseudomonas_phage	35.5	6.4e-08
WP_024765167.1|3761153_3761510_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_081754031.1|3761715_3762906_+	RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	32.0	1.3e-44
WP_024765165.1|3762902_3763826_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_024765164.1|3763871_3764255_+	DUF1937 family protein	NA	A0A2K9VK38	Klebsiella_phage	40.8	2.0e-15
WP_024765163.1|3764251_3764458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765162.1|3764454_3765231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765161.1|3765227_3765770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765160.1|3765769_3766051_+	DUF4031 domain-containing protein	NA	A0A0S2SYJ4	Pseudomonas_phage	81.9	2.1e-38
WP_024765159.1|3766043_3766277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024765158.1|3766342_3766585_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_024765157.1|3766585_3767635_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	57.6	6.1e-107
WP_024765156.1|3767985_3768651_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	80.7	6.8e-88
WP_024765155.1|3768766_3769159_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	74.4	1.6e-49
WP_024765154.1|3769158_3769518_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	59.2	2.0e-33
WP_024765153.1|3769517_3769820_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	57.0	3.7e-25
WP_038803606.1|3769816_3770152_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	76.6	1.8e-41
WP_024765152.1|3770148_3771147_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	72.5	8.8e-140
WP_024765151.1|3771235_3772237_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_037007284.1|3772345_3772648_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_024765149.1|3772689_3774075_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_024765148.1|3774076_3775357_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.9	5.7e-99
3775039:3775056	attR	GCAGGTTCGGGATATTCA	NA	NA	NA	NA
>prophage 14
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	5091701	5098705	6874121	capsid	Pseudomonas_phage(100.0%)	12	NA	NA
WP_024763398.1|5091701_5092976_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	49.8	3.7e-114
WP_038803301.1|5093217_5094507_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	76.2	7.3e-171
WP_024763397.1|5094510_5094867_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	78.0	4.1e-47
WP_051445584.1|5094870_5095818_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	61.4	1.4e-30
WP_024763395.1|5096324_5096564_-|capsid	phage capsid protein	capsid	Q56VP2	Pseudomonas_phage	75.0	1.2e-21
WP_024763394.1|5096577_5096826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157837652.1|5096826_5096988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763393.1|5097003_5097330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763392.1|5097557_5097764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081753972.1|5097767_5098058_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	70.3	1.7e-35
WP_024763390.1|5098061_5098490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024763389.1|5098489_5098705_-	hypothetical protein	NA	Q56VP9	Pseudomonas_phage	56.3	4.8e-19
>prophage 15
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	5311343	5382863	6874121	tail,terminase,integrase,holin,capsid,head,portal,transposase,protease,tRNA	Pseudomonas_phage(54.0%)	87	5332052:5332070	5372594:5372612
WP_024762965.1|5311343_5312633_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024762964.1|5312651_5313764_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024762963.1|5313765_5314791_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024762962.1|5314787_5315546_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024762961.1|5315562_5316711_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024762960.1|5316740_5317172_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	1.6e-21
WP_024762959.1|5317422_5317623_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_024762958.1|5317637_5317976_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_024762957.1|5317982_5319842_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.3	1.1e-106
WP_024762956.1|5319886_5320408_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_024762955.1|5320416_5320740_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	1.5e-24
WP_015478505.1|5320766_5321153_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	4.6e-52
WP_024762954.1|5321180_5322395_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.7	4.8e-31
WP_024762953.1|5322423_5322918_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_024762952.1|5323058_5323844_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_024762951.1|5323836_5324616_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_024762950.1|5324763_5325579_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_037010115.1|5325709_5326246_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024762949.1|5326403_5327321_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.0	2.5e-48
WP_024762948.1|5327331_5329194_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_024762947.1|5329258_5329600_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	43.5	1.0e-10
WP_089285745.1|5329638_5330757_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.1	1.3e-91
WP_024762945.1|5330769_5331813_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
5332052:5332070	attL	TGGCGTAAATTTGGCGTAA	NA	NA	NA	NA
WP_024762944.1|5332806_5333064_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	76.8	6.4e-26
WP_024762943.1|5333060_5333432_-	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	62.7	6.8e-29
WP_024762942.1|5333428_5333944_-	hypothetical protein	NA	A0A0H5BBZ5	Pseudomonas_phage	55.3	1.7e-38
WP_052239083.1|5334001_5335438_-|tail	tail fiber domain-containing protein	tail	A0A0S2SY45	Pseudomonas_phage	64.8	2.6e-36
WP_024762941.1|5335447_5336122_-	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	37.9	7.0e-40
WP_024762940.1|5336118_5336412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762939.1|5336408_5339855_-	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	73.9	0.0e+00
WP_038803283.1|5339911_5340490_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	67.0	1.2e-59
WP_024762938.1|5340544_5341027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762937.1|5341023_5341815_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	74.9	6.6e-114
WP_024762936.1|5341807_5342050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762935.1|5342052_5342799_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.9	1.6e-117
WP_024762934.1|5342795_5343134_-|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	50.0	6.2e-29
WP_024762933.1|5343133_5346409_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	34.0	1.8e-85
WP_024762932.1|5346448_5346676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762931.1|5346672_5347017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762930.1|5347058_5347562_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	77.0	3.1e-69
WP_024762929.1|5347594_5347981_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	63.8	9.9e-39
WP_024762928.1|5347973_5348546_-	hypothetical protein	NA	A0A2H4J8D5	uncultured_Caudovirales_phage	53.4	3.4e-43
WP_024762927.1|5348549_5348732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762926.1|5348737_5349061_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	58.4	1.5e-19
WP_024762925.1|5349060_5349384_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	62.5	1.0e-28
WP_024762924.1|5349383_5349587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762923.1|5349646_5350846_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.7	1.5e-149
WP_024762922.1|5350842_5351487_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	72.9	1.1e-85
WP_024762921.1|5351470_5352694_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	71.3	3.2e-168
WP_024762920.1|5352690_5354373_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	61.0	1.7e-196
WP_024762919.1|5354376_5354877_-	hypothetical protein	NA	S4TNN3	Salmonella_phage	33.3	1.9e-10
WP_024762918.1|5354980_5355319_-	HNH endonuclease	NA	Q7Y5F7	Xanthomonas_virus	41.6	4.6e-16
WP_024762917.1|5355322_5355652_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	81.0	5.3e-41
WP_024762916.1|5355785_5356268_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	29.3	6.4e-11
WP_024762915.1|5356376_5356766_-	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	78.1	6.9e-56
WP_024762914.1|5356762_5357026_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	58.0	1.1e-17
WP_038803282.1|5357049_5358318_-|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	46.7	5.8e-104
WP_024762913.1|5358314_5358584_-	hypothetical protein	NA	B5WZY5	Pseudomonas_phage	51.8	3.3e-17
WP_052239085.1|5358580_5360002_-	replicative DNA helicase	NA	A0A0A0YUG7	Pseudomonas_phage	79.0	3.8e-205
WP_024762912.1|5360001_5360829_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	45.5	2.0e-52
WP_024762911.1|5360815_5361781_-	hypothetical protein	NA	A0A125RNK1	Pseudomonas_phage	51.6	1.4e-28
WP_024762910.1|5361971_5362205_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	85.7	8.6e-30
WP_024762909.1|5362201_5363053_-	hypothetical protein	NA	A0A0A0YQ39	Pseudomonas_phage	64.4	5.9e-84
WP_024762908.1|5363049_5363838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762907.1|5363834_5364170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762906.1|5364644_5364962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128082478.1|5365274_5365826_+	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	63.1	3.5e-53
WP_024762904.1|5365961_5366348_+	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	69.2	7.1e-37
WP_024762902.1|5366716_5367550_+|transposase	transposase	transposase	A0A0A0YRT7	Pseudomonas_phage	88.8	1.5e-113
WP_024762901.1|5367603_5367801_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	60.8	3.4e-11
WP_024762900.1|5367803_5368025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024762899.1|5368021_5368231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128082476.1|5368230_5368914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037006640.1|5368906_5369332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024762896.1|5369335_5369635_+	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	72.7	1.2e-36
WP_128082475.1|5369652_5370132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024762894.1|5370118_5370439_-	STAS-like domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	35.0	1.9e-11
WP_128082474.1|5370435_5371506_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024762892.1|5371581_5372580_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	83.9	2.0e-128
WP_024762891.1|5372798_5374349_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
5372594:5372612	attR	TGGCGTAAATTTGGCGTAA	NA	NA	NA	NA
WP_024762890.1|5374510_5375023_+	RDD family protein	NA	NA	NA	NA	NA
WP_024762889.1|5375074_5376142_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_024762888.1|5376134_5377259_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024762887.1|5377449_5378940_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.0	2.6e-50
WP_024762886.1|5378974_5379403_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_024762885.1|5379422_5379794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024762884.1|5380013_5382863_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	1.3e-146
>prophage 16
NZ_CP049140	Pseudomonas nitroreducens strain HBP1 chromosome, complete genome	6874121	6806647	6844188	6874121	holin,protease	Bacillus_virus(50.0%)	32	NA	NA
WP_024766699.1|6806647_6807826_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.1	5.0e-25
WP_038803445.1|6807831_6808671_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_024766698.1|6808725_6809664_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_024766697.1|6809901_6810840_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_024766696.1|6811174_6812551_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_024766695.1|6812934_6814041_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_024766694.1|6814202_6815660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024766693.1|6815684_6815936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024766692.1|6816198_6817128_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024766691.1|6817135_6817609_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_038803446.1|6817690_6818656_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_024767459.1|6818783_6819668_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_024767458.1|6819741_6820680_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_024767457.1|6820903_6821902_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_024767456.1|6822165_6822636_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_038803447.1|6822819_6824448_-	alcohol dehydrogenase	NA	A0A1V0S9J5	Catovirus	27.4	1.2e-45
WP_024764975.1|6824635_6825469_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	2.3e-32
WP_024764976.1|6825456_6826263_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	33.6	8.1e-27
WP_024764977.1|6826320_6827295_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038803448.1|6827613_6830019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024764979.1|6830158_6831076_+	AEC family transporter	NA	NA	NA	NA	NA
WP_024764980.1|6831341_6832646_+	CitMHS family transporter	NA	NA	NA	NA	NA
WP_024764981.1|6832678_6833440_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	2.4e-36
WP_024764982.1|6833501_6833975_-	water stress/hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
WP_038803449.1|6833992_6835300_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024764983.1|6835655_6837380_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_024764984.1|6837476_6838511_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024764985.1|6838581_6839538_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_024764986.1|6839743_6841117_+	insulinase family protein	NA	NA	NA	NA	NA
WP_024764987.1|6841140_6841692_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024764988.1|6841816_6843106_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	37.7	3.5e-72
WP_024764989.1|6843612_6844188_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP049142	Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence	425042	144535	152007	425042	protease	Acinetobacter_phage(33.33%)	9	NA	NA
WP_024767833.1|144535_145294_+	trehalose-phosphatase	NA	A0A172Q0Q4	Acinetobacter_phage	24.7	1.9e-09
WP_024767832.1|145286_146381_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.0	9.0e-37
WP_024767831.1|146380_147331_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_024767830.1|147327_148056_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_024767829.1|148058_148652_+	stress protein	NA	A0A1J0GW82	Streptomyces_phage	30.2	2.0e-14
WP_038803762.1|148648_149857_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_024767828.1|149907_150357_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	30.2	2.7e-11
WP_024767827.1|150368_151403_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	44.8	3.2e-68
WP_037012137.1|151431_152007_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.3	1.4e-33
>prophage 2
NZ_CP049142	Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence	425042	215436	252991	425042	protease,transposase,integrase	Shigella_phage(33.33%)	33	218903:218916	255863:255876
WP_085988824.1|215436_216593_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.1	6.0e-47
WP_082032842.1|218386_219880_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
218903:218916	attL	CGGGCCGATCAGGC	NA	NA	NA	NA
WP_081754107.1|219985_220873_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024767363.1|221588_222008_+	DoxX family protein	NA	NA	NA	NA	NA
WP_024767362.1|222080_222773_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_024767361.1|222775_223378_-	LysE family translocator	NA	NA	NA	NA	NA
WP_024767360.1|223439_224060_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024767359.1|224132_224735_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	35.1	5.9e-22
WP_024767358.1|224769_225216_-	DoxX family protein	NA	NA	NA	NA	NA
WP_024767357.1|225368_226700_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024767237.1|229746_230499_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_164488307.1|230509_231421_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024767235.1|231557_232271_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_037007937.1|232418_232790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024767233.1|233159_234605_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_024767232.1|234615_234819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024767231.1|234957_236091_+	HPP family protein	NA	NA	NA	NA	NA
WP_017516353.1|236139_237000_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038803798.1|237172_237907_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_037005818.1|237986_238694_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_017516356.1|238778_239645_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017519876.1|239892_241329_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_017516357.1|241525_241936_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024767455.1|242116_242746_+	hydrolase	NA	NA	NA	NA	NA
WP_024767454.1|243771_244071_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_081754114.1|244540_244792_-	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	50.0	1.9e-11
WP_024767453.1|244982_245231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017519876.1|246014_247451_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_017516605.1|247632_248352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024765029.1|248404_248770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023101915.1|248904_249588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003125304.1|249812_251975_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071534698.1|251971_252991_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
255863:255876	attR	CGGGCCGATCAGGC	NA	NA	NA	NA
